CN110029103B

CN110029103B - Automatic kit for constructing BRCA1/2 gene variation detection library

Info

Publication number: CN110029103B
Application number: CN201910366839.XA
Authority: CN
Inventors: 陈俊; 李夏静; 陈才夫; 李福根; 许青; 熊磊
Original assignee: Shanghai 3D Medicines Co Ltd
Current assignee: Shanghai 3D Medicines Co Ltd
Priority date: 2019-04-30
Filing date: 2019-04-30
Publication date: 2022-12-27
Anticipated expiration: 2039-04-30
Also published as: CN110029103A

Abstract

The invention relates to an automatic kit for constructing a BRCA1/2 gene variation detection library. The invention provides an amplicon library construction kit for BRCA1/2 gene, which comprises: 1) a first primer for performing a first round of PCR amplification, 2) a second primer for performing a second round of PCR amplification, 3) a third primer and a fourth primer for performing a third round of PCR amplification using a second round of PCR amplification product as a template to construct an amplicon library of the target gene, wherein the first primer and the second primer are specific primers for the BRCA1/2 gene, wherein 1), 2) and 3) above are placed in separate containers, respectively. The kit disclosed by the invention automatically constructs the amplicon library, so that the complexity of operation and the demand for detection samples are obviously reduced, and the overall quality of sequencing data is improved.

Description

Automatic kit for constructing BRCA1/2 gene variation detection library

Technical Field

The invention relates to an automated kit for gene detection library construction. In particular, the invention relates to an automatic kit for constructing a BRCA1/2 gene variation detection library.

Background

The Human Genome Project (HGP), which costs $ 30 billion and is completed over 10 years, brings up a natural and repetitive change to genomics research, and by determining the sequence of Human Genome DNA, searching the position of genes on chromosomes, defining the structure and function of genes, reading all genetic information of Human, human being comprehensively knows themselves on a molecular level for the first time. A new generation of sequencing technology promotes the generation of a colorful genome map.

The next generation sequencing technology is also called Massively Parallel Sequencing (MPS), which refers to a sequencing technology that performs parallel sequencing reaction on hundreds of thousands to millions of DNA molecules simultaneously by using the principle of sequencing while synthesizing, and then analyzes obtained original image data or electrochemical signals through bioinformatics, and finally obtains information such as a nucleic acid sequence or copy number of a sample to be tested, and is also called high-throughput sequencing, deep sequencing and the like.

However, some studies do not require sequencing of the whole genome, but rather only specific genomic regions. Amplicon sequencing is a research strategy of high-throughput sequencing after enrichment of target region DNA by designing primers of a genome region of interest, amplifying by PCR.

Amplicon sequencing technology usually uses a large number of primers, and in order to avoid the generation of a large number of primer dimers, a common method is to split a reaction system from one tube to multiple tubes, so as to reduce the number of primers in each tube of reaction and reduce the generation of primer dimers. However, the method greatly increases the complexity of the operation and the required amount of the detection sample. Meanwhile, in the existing main amplicon database construction technology, when a target region is amplified, a multi-cycle PCR program is usually used, because the amplification efficiency of different primers is different, the uniformity of the amplified region can be obviously different after the multi-cycle PCR program through bidirectional primer exponential PCR amplification, and finally the overall quality of sequencing data can be deteriorated.

For BRCA1/2 gene variation detection libraries, various reagents are required to be added manually in the current method, the construction time is long, and the consistency of experimental operation is not easy to ensure. In addition, as described above, in the existing construction method, the reaction system needs to be split from one tube to multiple tubes, so as to reduce the generation of primer dimers, and the significant difference of the uniformity of the amplification region caused by the difference of the amplification efficiency of different primers needs to be considered to perform manual intervention on the PCR process, so that the full automation of the whole construction process is difficult to realize.

Disclosure of Invention

The inventor carries out targeted research on the defects of the amplicon sequencing technology used in the current next generation sequencing process, provides a new BRCA1/2 gene variation detection library construction method, greatly shortens the workload required by the whole library construction process during variation detection, and reduces the requirement on the sample size. On the basis of the novel construction method of the BRCA1/2 gene variation detection library, the inventor further designs a whole set of full-automatic BRCA1/2 gene variation detection library construction kit suitable for the method, thereby realizing the real full-automatic library construction without manual intervention in the whole construction experiment process.

In some embodiments, the present invention provides a kit for amplicon library construction of the BRCA1/2 gene, the kit comprising: 1) a first primer for performing a first round of PCR amplification, 2) a second primer for performing a second round of PCR amplification, 3) a third primer and a fourth primer for performing a third round of PCR amplification using a second round of PCR amplification product as a template to construct an amplicon library of a target gene, wherein the first primer and the second primer are specific primers for a BRCAl/2 gene, and wherein 1), 2) and 3) above are placed in separate containers, respectively. In some embodiments, the first primer and the second primer are used for targeted amplification of a region comprising the BRCA1/2 gene in a sample, the targeted amplification comprising 1) performing a first round of PCR amplification with the first primer using the sample as a template, and 2) performing a second round of PCR amplification with the second primer using a product of the first round of PCR amplification as a template. In some embodiments, the third primer and the fourth primer are used as templates for the second round of PCR amplification, and the amplicon library of the BRCA1/2 gene is constructed by the third round of PCR amplification. In some embodiments, the sample may comprise genomic DNA from the subject or cDNA obtained by reverse transcription. In some embodiments, the sample may comprise a BRCA1/2 gene from the subject. In some embodiments, the BRCA1/2 gene from the subject may include a wild-type BRCA1/2 gene or a variant BRCA1/2 gene.

In some embodiments, the first round of PCR amplification and/or the second round of PCR amplification in the methods of the invention may be performed for an appropriate number of cycles, for example for 1-10 cycles, for example 1,2,3,4,5,6,7,8,9, 10 cycles. In some embodiments, the number of cycles of the present invention is preferably less than 10 cycles. In some embodiments, the first round of PCR amplification and/or the second round of PCR amplification in the present invention is performed for only 3 cycles, i.e., three cycles of denaturation, annealing, extension. In some embodiments, the amount of first primer and/or second primer is suitable for performing the cycle number. In some embodiments, one cycle of denaturation, annealing, and extension in the methods of the invention may comprise one or more anneals, e.g., 1,2,3,4,5 anneals. It has been found that the first round of PCR amplification and/or the second round of PCR amplification can construct a library of amplicons of the high quality BRCA1/2 gene by performing only 3 cycles, preferably multiple anneals in 1 cycle. In some embodiments, the amplicon library of the BRCA1/2 gene constructed by the present invention has a more uniform distribution of sequencing depth. In some embodiments, the temperature of the denaturation, annealing, extension cycle may be appropriately selected according to the first and/or second primer employed. In some embodiments, the annealing temperature for the first round PCR amplification and/or the second round PCR amplification in the methods of the invention is not particularly limited, and any annealing temperature between 55 ℃ and 70 ℃ may be used, for example, 55 ℃,56 ℃,57 ℃,58 ℃,59 ℃,60 ℃,61 ℃,62 ℃,63 ℃,64 ℃,65 ℃,66 ℃,67 ℃,68 ℃,69 ℃,70 ℃ or any temperature between. In some embodiments, the annealing time for the first round of PCR amplification and/or the second round of PCR amplification in the methods of the invention is not particularly limited, e.g., can anneal for 30-180 seconds, e.g., 30 seconds, 45 seconds, 60 seconds, 75 seconds, 90 seconds, 105 seconds, 120 seconds, 135 seconds, 150 seconds, 165 seconds, 180 seconds, or any time in between. In some embodiments, the annealing comprises annealing at different temperatures between 55 ℃ and 70 ℃. In some embodiments, for example, the annealing may include annealing at 57 ℃ for 30 seconds, 59 ℃ for 30 seconds, 61 ℃ for 30 seconds, and 62 ℃ for 30 seconds, with a total annealing time between 30 and 180 seconds. By way of example, the annealing may include annealing at 55 ℃ for 15 seconds, 56 ℃ for 30 seconds, 61 ℃ for 45 seconds, and 62 ℃ for 15 seconds, with a total annealing time between 30 and 180 seconds. In some embodiments, the amount of the first primer and/or the second primer is suitable for performing the first round of PCR amplification and/or the second round of PCR amplification for less than 10 cycles, e.g., less than 5 cycles, e.g., for 5, 4, 3, 2, 1 cycles.

In some embodiments, the first primer and the second primer in the present invention may be a forward primer and a reverse primer, respectively, or vice versa, i.e., the first primer and the second primer may be a reverse primer and a forward primer, respectively.

In some embodiments, the first and second primers of the invention comprise specific sequences that target the brcai/2 gene. In some embodiments, a linker or index sequence may be added to the amplification product, as known to those of skill in the art. In some embodiments, the first and second primers of the invention may further comprise an adapter and/or an index sequence. In some embodiments, the linker or index sequence may be added during the third round of PCR amplification. In some embodiments, the linker and/or index sequences in the present invention are not particularly limited, and one skilled in the art may employ an appropriate sequence as the linker and/or index sequence.

In some embodiments, the first, second and/or third round of PCR in the present invention comprises a purification step and corresponding purification means and/or reagents. Methods for purifying PCR amplification products are well known to those skilled in the art, and the purification step can be performed, for example, by magnetic beads. In some embodiments, the first, second and/or third round of PCR (including purification steps) of the invention are performed in one vessel. As described above, in order to avoid the generation of large amounts of primer dimers, it is usually necessary to split the reaction system from one tube to multiple tubes during the sequencing technique of amplicon to reduce the number of primers in each reaction tube and to reduce the generation of primer dimers. In contrast, the present invention can perform a few cycles (e.g., only one cycle) with a single primer, enabling PCR in one vessel without the need to split the PCR reaction system from one tube to multiple tubes. In some embodiments, the present invention significantly reduces the complexity of the procedure. More importantly, the method of the present invention, by being carried out in a single container, can reduce the amount of sample required for testing, thereby enabling testing that was not possible in the prior art due to insufficient sample volume. By reducing the operation steps and the sample requirements, the invention can also reduce the errors caused by multi-step operation, improve the sensitivity and reliability of detection and improve the overall quality of sequencing data. In some embodiments, the kits of the invention further comprise one or more of: 4) A purification device, e.g., magnetic beads, for purification of the first, second, and/or third round PCR amplification products, 5) a purification reagent, e.g., ethanol or PEG, for purification of the first, second, and/or third round PCR amplification products, 6) a blocking reagent, e.g., mineral oil, for heat blocking the PCR mixture, 7) a washing reagent, e.g., water, for washing the pipettor, 8) an elution reagent, e.g., water, for eluting the adsorbate from the purification device, wherein 4), 5), 6), 7), and/or 8) are placed in separate containers, or the same reagent is placed in the same container, e.g., if the purification, washing, and/or elution reagents are the same, which may be placed in the same container. Such agents are known in the art and are readily available. In some embodiments, the kit comprises one or more reaction vessels for performing a PCR reaction. In some embodiments, the first, second, and/or third round of PCR is performed in the same vessel. In some embodiments, the kit further comprises a waste container for collecting waste.

In some embodiments, the kit comprises a PCR mixture, wherein the PCR mixture is placed in the same container as 1), 2), and 3) or in separate containers. The PCR mixture contains reagents necessary for carrying out the PCR reaction, such as polymerase, dNTPs, buffers. In some embodiments, any commercially available suitable PCR reaction mixture may be used. In some embodiments, the mixture may be placed in one or more containers, preferably one container.

In some embodiments, the container of the present invention is used in the broadest sense without particular limitation. For example, the container may be a reagent tube, a hole, a recess, etc., and may have various shapes. In some embodiments, the container may be in a closed or non-closed form, e.g., may have individual or common lids. In some embodiments, the material of the container is not particularly limited, and may be any material having suitable strength, rigidity, sealability, and/or corrosion resistance, such as metal, alloy, plastic, resin, and the like. In some embodiments, the container may be manufactured separately and then assembled into the cartridge. In some embodiments, one or more of the receptacles are formed on a substrate, e.g., the receptacles are wells on a substrate. In some embodiments, the containers are placed in the same cassette or formed in the same substrate, e.g., in the same enclosed cassette or enclosed substrate. In some embodiments, the containers may be distributed with the same or different sizes, suitable for holding the same or different amounts of reagents. In some embodiments, the contents of the components in the kit of the present invention are not particularly limited, and may be appropriately designed by those skilled in the art according to the experimental needs, and thus further appropriately sized containers.

In some embodiments, the kit of the present invention is a fully automated banking kit, and only the cartridge containing the desired reagent is placed in the instrument, and no manual intervention is required throughout the banking process until the banking is completed.

In some embodiments, the first primer and/or the second primer in the present invention include a specific sequence targeting BRCA1/2 gene in one or more of the following primers (the following sequences may comprise any suitable linker and/or index sequence that can be substituted for the linker and/or index sequence, as long as the specific sequence targeting BRCA1/2 gene is not changed):

in some embodiments, the invention includes one or more of the specific sequences listed herein that target the BRCA1/2 gene. In some embodiments, specific sequences listed herein that target the BRCA1/2 gene may be combined with each other, but preferably a combination of a forward primer and a reverse primer pair is employed. In some embodiments, the invention includes any one or more pairs of forward and reverse primers in the specific sequences listed herein that target the BRCA1/2 gene (i.e., pairs of primers that match the listed primer numbers, such as the pairs of primers for BRCA1_17_f1 and BRCA1_17 _r1).

In some embodiments, in addition to the specific sequence targeting the BRCA1/2 gene, the sequences of the invention can comprise any suitable linker and/or primer for high throughput sequencing analysis, and such sequences can vary depending on the platform of the high throughput sequencing analysis and are known to those of skill in the art. For example, in some embodiments, suitable sequences may include linkers and/or primers suitable for Illumina sequencing analysis. In some embodiments, suitable sequences include, for example, one or more of the following:

TruSeq Universal Adapter：

5′AAIGAIACGGCGACCACCGAGAICIACACTCTTTCCCIACACGACGCTCTTCCGAICT3′：

TruSeq Indexed Adapter：5′GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3′：

PCR Primer 1.0：5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3′：

PCR Primer 2.0：5′CAAGCAGAAGACGGCATACGAGAT3′；

flow cell anchor TruSeq Universal Adapter:5 'AATGATTACGGCGGACCACCGA 3';

flow cell anchored TruSeq induced Adapter:5 'CAAGCAGAGACGGCATACG 3';

Read 2Sequencing Primer：5′GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3′：

Multiplexing Index Read Sequencing Primer：5′GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

3′：Read 1 Sequencing Primer：5′ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′。

in some embodiments, it has been found that the main parameters for designing the existing primers are Tm value and GC content of the primers, and the length of the primers, etc., but such a Tm-based primer design principle cannot eliminate amplification preference introduced by DNA polymerase, resulting in severe amplification preference, which may significantly affect the accuracy of the detection result, and therefore it is preferable to select a favorable primer sequence by adjusting the start site and the end site of the specific targeting region of the BRCA1/2 primer according to the experimental result. In some embodiments, the inventors have found that the adjusted BRCA1/2 specific primer sequences described above can significantly reduce the amplification bias of DNA polymerase compared to existing primer sequence construction libraries, improving the overall accuracy of the detection results. In some embodiments, the first round of PCR amplification and/or the second round of PCR amplification in the present invention comprises annealing at 55 ℃ to 70 ℃ for 30 to 180 seconds, optionally the annealing comprises annealing at a different temperature between 55 ℃ to 70 ℃ for 30 to 180 seconds. In some embodiments, the first round of PCR amplification and/or the second round of PCR amplification in the present invention comprises annealing at 57 ℃,59 ℃,61 ℃ and 62 ℃ for 30 seconds each. In some embodiments, the first round of PCR amplification and/or the second round of PCR amplification in the present invention comprises annealing at 52 ℃, 55 ℃,58 ℃ and 61 ℃ for 30 seconds each.

In some embodiments, the kits of the invention comprise a container comprising PCR reagents, such as DNA polymerase, primers, and PCR buffer. In some embodiments, the container comprises one or more primers listed herein that target a specific sequence of the BRCA1/2 gene. In some embodiments, the kit can be used to construct an amplicon library of the BRCA1/2 gene and/or detect BRCA1/2 gene variation.

In some embodiments, the single primer PCR library construction process is used, so that the possibility of primer dimer formation and the influence on the library construction process are greatly reduced, and finally, BRCA1/2 gene variation detection can be completed in one reaction. In some embodiments, the present invention employs improved primer designs suitable for use in the present invention, improving the overall quality of sequencing data. In some embodiments, the present invention employs improved primers that reduce the amplification bias introduced by the DNA polymerase during multiplex PCR, thereby increasing the overall accuracy of the detection results.

In some embodiments, the invention employs single primer PCR for pooling. At present, the library construction process adopted for amplicon sequencing is to simultaneously add paired upstream and downstream primers into a reaction system during multiplex PCR. In the process, when the number of the primers is large, or obvious staggering exists among the positions of the primers, primer dimers are easily formed. And the difference of the amplification efficiency of different primers is gradually amplified along with the exponential amplification of the PCR, and finally, the quality of sequencing data is possibly integrally deteriorated. The single primer amplification method used by the invention divides the forward primer and the reverse primer into two times to be put into a reaction system for reaction, thereby reducing the possibility of dimer formation, and simultaneously, because only a single primer participates in the PCR process, the growth mode of the amplification product is linear growth, the difference of PCR efficiency among different primers is greatly reduced, and the integral quality of sequencing data is improved.

The invention optimizes the defects of the amplicon sequencing technology used in the current new generation sequencing process, greatly shortens the workload required by the whole library construction process, and reduces the requirement on the sample size.

Description of terms:

building an amplicon library: the amplicon library construction method is a method for enriching a target DNA region by utilizing a multiplex PCR technology so as to construct a library for sequencing of a new generation.

Tm value: the melting temperature of DNA is a temperature at which the ultraviolet absorption value reaches 1/2 of the maximum value during the thermal denaturation of the double helix structure of DNA.

Genomic library: the whole genome DNA of an organism is cut into a collection formed by cloning DNA fragments with certain lengths, and the collection can be used for downstream amplification, sanger sequencing or next generation sequencing.

A new generation of sequencing technology: the technology is also called Massively Parallel Sequencing (MPS), and is a sequencing technology that performs parallel sequencing reaction on hundreds of thousands to millions of DNA molecules simultaneously by using the principle of sequencing while synthesizing, and then analyzes obtained original image data or electrochemical signals through bioinformatics, and finally obtains information such as a nucleic acid sequence or copy number of a sample to be tested, and is also called high-throughput sequencing, deep sequencing, next-generation sequencing, and the like.

Drawings

FIG. 1 shows a library construction process for conventional amplicon sequencing, in which paired upstream and downstream primers are simultaneously added to a reaction system during multiplex PCR.

FIG. 2 shows an exemplary scheme of a single primer amplification method used in the present invention.

FIG. 3 shows an exemplary comparison of the present invention with a prior art method (CleanPlex BRCA1&2panel, PARAGON-916005).

FIG. 4 shows the presence of primers or primer dimers in the product of the prior art method (CleanPlex BRCA1&2panel, PARAGON-916005).

FIG. 5 shows that no primer and no dimer remained in the product of the method of the present invention.

FIG. 6 shows the uniformity analysis of sequencing depth after sequencing using PARAGON-916005 and the libraries constructed according to the invention. The method has the advantages that the difference between the highest value and the lowest value of the sequencing depth is smaller, and the whole sequencing depth distribution is more uniform.

FIG. 7 shows an exemplary configuration of the present invention in which various reagents are packaged in a rectangular reagent strip that may be designed with an appropriate number of wells, e.g., 15 wells; certain differences can be designed among different holes in size and shape. FIG. 7 shows the bottom structure of the entire reagent strip, where each well is designed to dispense or serve the following reagents: (1) magnetic beads; (2) empty; (3) r PCR mix; (4) mineral oil; (5) index PCR primer; (6) f, PCR mix; (7) 80% ethanol (F PCR); (8) PEG; (9) KAPAHiFi; r 80% ethanol (index PCR);

washer water(H ₂ O)；

elution water(H ₂ O)；

80% ethanol (FPCR);

a reaction well;

a waste liquid hole.

FIG. 8 shows the comparison between the automatic library construction and the manual library construction, and the results show that the fragment sizes and distributions of the automatic library construction and the manual library construction are similar, and the quality of the constructed library is excellent.

Detailed Description

BRCA1/2 library construction

1 Main reagents and instruments

2 Experimental procedures

2.1 Forward Primer-PCR

2.1.1 use of Hot-Start

DNA Polymerase in a Ready-to-Use Master Mix, in PCR tubes, configured as F-PCR Mix according to the following table:

2.1.2 simple centrifugation after gentle vortex mixing, place the PCR tube in the PCR instrument and run the following program:

2.2 F primer PCR product purification

2.2.1 taking out the agencourt ampu0re XP-PCR purification beads from the refrigerator at 4 ℃ in advance, and balancing for 30min at room temperature;

2.2.2 vortex mixing the room temperature balanced ampure beads, taking 48ul ampure beads (1.2X) to a new 1.5mL centrifuge tube, and transferring all the 40ul PCR products in the previous step;

2.2.3 vortex and mix the PCR product and the magnetic bead evenly, incubate for 5min at room temperature;

2.2.4 after the incubation is finished, placing the centrifuge tube on a magnetic frame and standing for 2-3min, and after the solution is clarified, removing the solution, wherein the contact of magnetic beads is avoided;

2.2.5 adding 200ul of fresh 80% ethanol into the centrifuge tube, standing for 30s, then absorbing and removing the ethanol, and repeatedly washing once;

2.2.6 after discarding the ethanol, air-drying the beads until the surface is frosted, adding 11ul of Nuclear-free H after air-drying the beads ₂ O, incubating for 3min at room temperature;

2.2.7 after the incubation is finished, placing the centrifugal tube on a magnetic frame, standing for 2-3min, after the solution is clarified, sucking 10ul of the solution, transferring the solution into a new PCR tube, and sucking a small amount of magnetic beads to avoid influencing the subsequent experiment;

2.3 Reverse Primer-PCR

2.3.1 use of Hot-Start

DNA Polymerase in a Ready-to-UseMaster Mix, in a PCR tube, the R-PCR Mix was configured as follows:

2.3.2 simple centrifugation after gentle vortex mixing, place the PCR tube in the PCR instrument and run the following program:

2.4 Reverse Primer-PCR product purification

2.4.1 vortex and mix the ampure beads after room temperature equilibration;

2.4.2 get 48ul ampure beads (1.2X) to a new 1.5mL centrifuge tube and transfer all the 40ul PCR products in the previous step;

2.4.3 vortex and mix the PCR product and the magnetic bead evenly, incubate for 5min at room temperature;

2.4.4 after the incubation is finished, placing the centrifuge tube on a magnetic frame and standing for 2-3min, and after the solution is clarified, removing the solution, wherein the contact of magnetic beads is avoided;

2.4.5 adding 200ul of fresh 80% ethanol into the centrifuge tube, standing for 30s, removing the ethanol by suction, and repeatedly washing;

2.4.6 after discarding the ethanol, air-drying the magnetic beads until the surface is frosted, adding 21ul of nucleic-free H after air-drying the magnetic beads ₂ O, incubating for 3min at room temperature;

2.4.7 after the incubation is finished, placing the centrifuge tube on a magnetic frame, standing for 2-3min, and after the solution is clarified, sucking 20ul of the solution and transferring the solution to a new PCR tube;

2.5 Index-PCR

2.5.1 the following reaction system was prepared in 0.2ml of 2.4.7 PCR Tube;

2.5.2 vortex and mix evenly, after centrifugation, the following reactions are carried out:

2.6 PCR product recovery

2.6.1 transfer all the 50ul reaction products from the previous step into a 1.5ml centrifuge tube, add 60ul of AMpure Beads (1.2 x) which are uniformly vortexed, mix them by vortexing, stand for 5min at room temperature and place them on a magnetic frame, and discard the supernatant after the AMpure Beads are completely separated.

2.6.2 keeping the sample on the magnetic frame, adding 200ul 80% ethanol, removing the supernatant after 30s, and then repeatedly washing once again;

2.6.3 drying until no liquid drops remain;

2.6.4 adding 41ul of clean-free water, mixing evenly by vortex, standing for 5min at room temperature, standing on a magnetic frame, completely separating AMpure Beads, and transferring 40ul of supernatant into a 1.5ml centrifuge tube;

2.6.5 adding 48ul of AMpure Beads (1.2X) into the centrifuge tube, uniformly mixing, standing at room temperature for 5min, standing on a magnetic frame, completely separating the AMpure Beads, and then discarding the supernatant;

2.6.6 repeat step 2.6.2-2.6.3 for 1 time;

2.6.7 adding 21ul of clean-free water, mixing evenly by vortex, standing for 5min at room temperature, standing on a magnetic frame, completely separating AMpure Beads, and transferring 20ul of supernatant to a 1.5ml centrifuge tube;

2.7 product QC

2.7.1 reference reagents and instructions for use with the instrument, library concentration measurements were performed on a Qubit 3.0 instrument using the Qubit dsDNA HS Assay Kit.

2.7.2 reference reagents and Instrument instructions library fragment size measurements were performed on a Labchip GX Touch instrument using a 24DNA Extended Range Labchip and HT DNA High Sens Reagent Kit, dual Protocol.

3. Comparison of the present invention with existing methods (see, e.g., FIG. 3)

The invention has the advantages that:

1. the initial sample does not need to be divided into two parts for library construction, so that the complexity of operation and the requirement on the amount of the initial sample are reduced.

2. The bidirectional primer is amplified in two steps during targeted amplification, only 1 PCR cycle is needed, the possibility of primer dimer formation is reduced, the PCR time is shortened, and uniformity change caused by PCR index amplification cannot be introduced.

3. The overall operation time is significantly reduced.

Compared with the existing method (such as the commercial product CleanPlex BRCAl &2panel,

PARAGON-916005):

1. the overall operating time is shortened by about half an hour:

2. library quality:

a. the picture in FIG. 4 is derived from the quality control section of the product specification of CleanPlex BRCA1&2panel, PARAGON-916005, and it can be observed that there are still a few primers or primer dimers in the product:

b. in FIG. 5, the quality control of the product of the present invention is shown, and it can be seen that there is no primer and dimer residue:

3. the sequencing result is subjected to homogeneity analysis (figure 6), the difference between the highest value and the lowest value of the sequencing depth is smaller, and the whole sequencing depth is more uniformly distributed:

primer List

4. Full-automatic warehouse building kit

The kit was prepared as shown in fig. 7, and the components and construction process of the kit were as described in the following table:

the library construction procedure was adjusted appropriately (see table below), libraries were constructed from the fully automated library construction kit and compared to manual library construction.

The results showed that the full-automatic library construction showed the same excellent library quality as the manual library construction (see FIG. 8)

The exemplary embodiments of the present invention are explained by the above embodiments. The embodiments do not limit the technical solutions of the present invention. Those skilled in the art will understand that: modifications may be made to the above-described embodiments, or equivalents may be substituted for some or all of the features thereof. Such modifications or substitutions are intended to be within the scope of the present invention.

Claims

1. An amplicon library construction kit for the BRCA1/2 gene, the kit comprising: 1) a first primer for performing a first round of PCR amplification, 2) a second primer for performing a second round of PCR amplification, 3) a third primer and a fourth primer for performing a third round of PCR amplification using a second round of PCR amplification product as a template to construct an amplicon library of a target gene, wherein the first primer and the second primer are specific primers for BRCA1/2 gene, wherein 1), 2) and 3) above are placed in separate containers, respectively, wherein the first primer and the second primer are a forward primer and a reverse primer, respectively, or a reverse primer and a forward primer, respectively, wherein the first primer and the second primer comprise specific sequences targeting the BRCA1/2 gene among the following primers:

BRCA2_26_F1 CTTTCCCTACACGACGCTCTTCCGATCTGCATCCCTGTGTAAGTGCATTTTGGTC

BRCA2_26_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTACACACATAAGGAACAGTTTATGGTTC

BRCA2_27_F1 CTTTCCCTACACGACGCTCTTCCGATCTCTGTCACTGGTTAAAACTAAGGTGGGA

BRCA2_27_F2 CTTTCCCTACACGACGCTCTTCCGATCTAAGGGCTGACTCTGCCGCTG

BRCA2_27_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAATTTATCTAATTCTTTTACAGGAGATTGGTA

BRCA2_27_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCAAACCTATGAGACATTATTTTCATCG

BRCA2_30_F1 CTTTCCCTACACGACGCTCTTCCGATCTCTTTTAAAAATAAGATAAACTAGTTTTTGCCAG

BRCA2_30_F2 CTTTCCCTACACGACGCTCTTCCGATCTTTAACAATTTTCCCCTTTTTTTACCCC

BRCA2_30_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAGAATATTTACCTTCACAAACTTTGGT

BRCA2_30_F3 CTTTCCCTACACGACGCTCTTCCGATCTTGAAAAAATAATATCCTTAATGATCAGGGC

BRCA2_30_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAGGAAAGAAAATAGTTTATTTTTTATAGAAATGC

BRCA2_30_R3 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAGATGACAATTATCAACCTCATCTGC

BRCA2_32_F1 CTTTCCCTACACGACGCTCTTCCGATCTGATGTCTGACAAAAAATAAGTTTTTGCA

BRCA2_32_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCACAGGAAGTTAAAATCACATATAGGAC

BRCA2_34_F1 CTTTCCCTACACGACGCTCTTCCGATCTAAATTATATGGCTTATAAAATATTAATGTGCTTC

BRCA2_34_F2 CTTTCCCTACACGACGCTCTTCCGATCTCTAGCAAGACTAGGAAAAAAATTTTCC

BRCA2_34_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGATTTTTCACATTCATCAGCGTTTGC

BRCA2_34_F3 CTTTCCCTACACGACGCTCTTCCGATCTTAACCCTTTCAGGTCTAAATGGAGCCC

BRCA2_34_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCACATGAAGAAATATGCAATAGGGGT

BRCA2_34_F4 CTTTCCCTACACGACGCTCTTCCGATCTAATCTCATACAGACTGCATTCTTGCAG

BRCA2_34_R3 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCACTGGAGAAGTTCCAGATATTGCCT

BRCA2_34_F5 CTTTCCCTACACGACGCTCTTCCGATCTTACTGTTTGCTCACAGAAGGAGGACTC

BRCA2_34_R4 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCAGCTTCCATTATCAATTAAATTTGGA

BRCA2_34_F6 CTTTCCCTACACGACGCTCTTCCGATCTAATCAGAACTAATTAACTGTTCAGCCC

BRCA2_34_R5 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAAGTGGTGCTTCAAAAGCATTTGCT

BRCA2_34_R6 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAAACTTATCTACCATGTTTGAGTGA

BRCA2_37_F1 CTTTCCCTACACGACGCTCTTCCGATCTTGTCTCAAATTTTTTGTGTATTTACAG

BRCA2_37_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGTGTTAACTTCTTAACGTTAGTGTC

BRCA2_38_F2 CTTTCCCTACACGACGCTCTTCCGATCTATGAGACACTTGATTACTACAGGCAGA

BRCA2_38_F3 CTTTCCCTACACGACGCTCTTCCGATCTAAGCAAAACATTGATGGACATGGCTCT

BRCA2_38_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTCTTCACACTTTGTGAAAGTTACAGC

BRCA2_38_R3 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGATTTAGAAAATCTAAAACATTAAAAAGGGC

BRCA2_42_F1 CTTTCCCTACACGACGCTCTTCCGATCTTGTTTAAACAGTGGAATTCTAGAGTCA

BRCA2_42_F2 CTTTCCCTACACGACGCTCTTCCGATCTGTAGTGCAGATACCCAAAAAGTGGCC

BRCA2_42_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTAACTGGGCCTTAACAGCATACCAC

BRCA2_42_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGAATTTAACTGAATCAATGACTGATTTTTAC

BRCA2_44_F1 CTTTCCCTACACGACGCTCTTCCGATCTTTATATATGTGACTTTTTTGGTGTGTGTA

BRCA2_44_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTAAATTCAAAGTCTCTAAGACTTTGTTC

BRCA2_45_F1 CTTTCCCTACACGACGCTCTTCCGATCTTATGCTTGGTTCTTTAGTTTTAGTTGC

BRCA2_45_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAACATACTCCTTCCTGTGATGGCCAG

BRCA2_47_F1 CTTTCCCTACACGACGCTCTTCCGATCTTAGATGGAACTTTTTTGTTCTGATTGC

BRCA2_47_F2 CTTTCCCTACACGACGCTCTTCCGATCTAAGGGATGTCACAACCGTGTGGA

BRCA2_47_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTCTTTTTTTGAATAGCTTACAATACGC

BRCA2_47_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTATACAGATCCTCTTTTATATTATCTCTTTGTG

BRCA2_50_F1 CTTTCCCTACACGACGCTCTTCCGATCTGTTTGCAATTTATAAAGCAGCTTTTCC

BRCA2_50_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTACTAGGTATACAACAGAATATACGATGG

BRCA1_1_F1 CTTTCCCTACACGACGCTCTTCCGATCTGAGCTCCCAGGGCCTGGAAAGGCCAC

BRCA1_1_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGACCCTGGAGTCGATTGATTAGAGC

BRCA1_3_F1 CTTTCCCTACACGACGCTCTTCCGATCTCTCCCTCTCTGACAGGGCACC

BRCA1_3_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGCAAATTGACTTAAAATCCATACCCC

BRCA1_5_F1 CTTTCCCTACACGACGCTCTTCCGATCTGAACTCTGGGGTTCTCCCAGGC

BRCA1_5_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGATCTTCTGAAATCCAGTAGTGTTC

BRCA1_7_F1 CTTTCCCTACACGACGCTCTTCCGATCTACTATATGACTGAATGAATATCTCTGGTTA

BRCA1_7 R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAATGTTTAAATTAAACATCAACTCTGTCTC

BRCA1_8_F1 CTTTCCCTACACGACGCTCTTCCGATCTCTGAGGTGTTAAAGGGAGGAGGGGA

BRCA1_8_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGGTGTTTTCAGCCTCTGATTCTGTC

BRCA1_10_F1 CTTTCCCTACACGACGCTCTTCCGATCTACTGTGATTGTTTTCTAGATTTCTTCC

BRCA1_10_F2 CTTTCCCTACACGACGCTCTTCCGATCTGCAGTATCAGTAGTATGAGCAGCAGCT

BRCA1_10_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGTTGCAGAATCTGCCCAGAGTCC

BRCA1_10_R2 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTACTTTGTAATTCAACATTCATCGTTGT

BRCA1_11_F1 CTTTCCCTACACGACGCTCTTCCGATCTAAATCAAAGTGTTTGTTCCAATACAGC

BRCA1_11_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATGATTTGTCCTTTCACAATTGGTGG

BRCA1_12_F1 CTTTCCCTACACGACGCTCTTCCGATCTTTAACAATCAGAGTTCAATATAAATAAAGATGTC

BRCA1_12_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAAGCAGTAAAGTAGATTTGTTTTCTC

BRCA1_14_F1 CTTTCCCTACACGACGCTCTTCCGATCTTTGCTTAAGATATCAGTGTTTGGCCAA

BRCA1_14_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTTCTCAAAGTATTTCATTTTCTTGGT

BRCA1_17_F1 CTTTCCCTACACGACGCTCTTCCGATCTGCCTGTTAAGTTGGCAAACTTTGCC

BRCA1_17_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAACTAGAAGTTTCTAAAGGAGAGAGC

BRCA1_18_F1 CTTTCCCTACACGACGCTCTTCCGATCTTTAATATTAACTAAATAGGAAAATACCAG

BRCA1_18_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATTACATACTAGCTTAACTAGCATTGTAC

BRCA1_19_F1 CTTTCCCTACACGACGCTCTTCCGATCTGCAATTATTATTAAATACTTAAAAAACCTGAGAC

BRCA1_19_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTCCAGGCATCATACATGTTAGC

BRCA1_21_F1 CTTTCCCTACACGACGCTCTTCCGATCTACAGCACTTGAGTGTCATTCTTGGGA

BRCA1_21_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTGATTATAGAGGTTTTCTACTGTTGC

BRCA1_22_F1 CTTTCCCTACACGACGCTCTTCCGATCTTCTACTTTTTCCTACTGTGGTTGCTTC

BRCA1_22_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTAGGAAACTATTGCTTGTAATTCACC

BRCA1_23_F1 CTTTCCCTACACGACGCTCTTCCGATCTACAAAAACAAAAGCTAATAATGGAGCC

BRCA1_23_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCTCTGCTGTATTCTCAGTTCCTG

BRCA1_24_F1 CTTTCCCTACACGACGCTCTTCCGATCTTCCCAAATTAATACACTCTTGTGCTGA

BRCA1_24_R1 ACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAAGGACGTTGTCATTAGTTCTTTGGT。

2. the kit of claim 1, wherein the amount of the first primer and/or the second primer is suitable for performing the first round of PCR amplification and/or the second round of PCR amplification for less than 5 cycles.

3. The kit of claim 2, wherein the number of cycles is selected from 5, 4, 3, 2, or 1 cycles.

4. The kit of any of claims 1-3, wherein the first primer and the second primer comprise an adapter and/or index sequence in addition to the specific sequence targeting the BRCA1/2 gene.

5. The kit of any one of claims 1-3, wherein the kit further comprises one or more of: 4) A purification device for purification of the first, second and/or third round PCR amplification products, 5) a purification reagent for purification of the first, second and/or third round PCR amplification products, 6) a blocking reagent for heat blocking the PCR mixture, 7) a washing reagent for washing a pipettor, 8) an elution reagent for eluting the adsorbate from the purification device, wherein 4), 5), 6), 7) and/or 8) are placed in separate containers, or the same reagent is placed in the same container.

6. The kit of claim 5, wherein the kit comprises one or more of: 4) The purification device is magnetic beads, 5) the purification reagent is ethanol or PEG, 6) the sealing reagent is mineral oil, 7) the cleaning reagent is water, and 8) the elution reagent is water.

7. A kit as claimed in any one of claims 1 to 3, comprising one or more reaction vessels for performing a PCR reaction.

8. The kit of any one of claims 1-3, wherein the first, second, and/or third round of PCR are performed in the same vessel.

9. The kit of any one of claims 1-3, further comprising a waste container for collecting waste.

10. The kit of any one of claims 1-3, comprising a PCR mixture, wherein the PCR mixture is placed in the same container as 1), 2), and 3) or in separate containers.

11. A kit as claimed in any of claims 1 to 3, wherein the containers are manufactured separately and then assembled into the cartridge, or wherein one or more of the containers are formed on a substrate.

12. The kit of claim 11, wherein the container is a well on a substrate.

13. The kit of claim 11, wherein the containers are disposed in the same cartridge or formed in the same substrate.

14. The kit of claim 11, wherein the containers are placed in the same closed cassette or closed substrate.