CN110004176B - Construction method of hybrid larch genetic transformation system - Google Patents
Construction method of hybrid larch genetic transformation system Download PDFInfo
- Publication number
- CN110004176B CN110004176B CN201910294917.XA CN201910294917A CN110004176B CN 110004176 B CN110004176 B CN 110004176B CN 201910294917 A CN201910294917 A CN 201910294917A CN 110004176 B CN110004176 B CN 110004176B
- Authority
- CN
- China
- Prior art keywords
- culture
- larch
- callus
- culture medium
- hybrid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/22—Improving land use; Improving water use or availability; Controlling erosion
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/40—Afforestation or reforestation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A construction method of a hybrid larch genetic transformation system relates to a construction method of a hybrid larch transformation system. Aims to solve the problems of difficult induction of the embryogenic callus and low transformation rate of the embryogenic callus in the conventional tissue culture of the hybrid larch. The method comprises the following steps: 1. inoculating the pre-treated immature zygotic embryo of the hybrid larch in a culture medium, and culturing until embryogenic callus appears; 2. inoculating the embryonic callus into a culture medium, and carrying out dark culture; 3. transferring the embryonic callus into a culture medium for propagation culture; 4. selecting embryonic callus, and carrying out genetic transformation on hybrid larch by using a target gene through an agrobacterium infection method; 5. transferring the embryogenic callus into a culture medium for transitional culture; 6. and (3) putting the callus subjected to transitional culture into a culture medium for somatic embryogenesis. The transformation rate of the embryogenic callus obtained by the method is as high as 22.2%. The invention is used for constructing the genetic transformation system of the hybrid larch.
Description
Technical Field
The invention relates to a construction method of a hybrid larch transformation system.
Background
Larix Gmelini is one of important economic, ecological and afforestation tree species in northeast China. The pine needle-leaved trees grow quickly compared with other pine trees, spruce trees and the like, the pine needle-leaved trees grow quickly in the early stage, the pine needle-leaved trees are well known for high stress resistance, the wood is heavy and solid, and the bending resistance and the pressure resistance are high, so that the wood has high process value; in addition, the wood fiber is long, the wall thickness of the tracheids is thick, and the industrially produced paper has the advantages of strong tensile force and difficult breakage. The distribution range is wider, most wood resources are available in northeast regions, and the adaptability is strong, but the utilization value of the wood resources is more obviously reflected along with the shortage of wood resources in China and even in the world.
In the early stage of research, many combined selection tests on larch seeds and seed sources are carried out, and a plurality of hybrid larch seed gardens with high genetic gain are established to obtain a plurality of good seeds, but the larch has a long growth period, and in addition, the sexual propagation is likely to cause great variation of progeny thereof, and some good characters are difficult to maintain, so that large-scale propagation is difficult. The increasing demand of society for larch wood cannot be met in a short time due to the shortage of wood resources.
Somatic embryogenesis has the advantages of strong reproductive capacity, complete structure and growth which is not influenced by factors such as season, natural conditions, quantity of materials obtained and the like, and is a method for rapidly and massively asexually propagating improved varieties in a short period. Somatic embryogenesis in Larix genus began to progress rapidly since the induction of embryogenic callus by Klimaszewska (1989) using the cotyledonary propagules of hybrid Larix eurolepis (L.x leptin europaea) embryos as explants. Although relatively stable somatic embryogenesis systems have been established in European larch, north American larch, japanese larch, north China larch and the like, hybrid larch with hybrid vigor is rarely reported, and although the induction rate of hybrid larch is low, only 10% of hybrid larch is induced by taking immature zygotic embryos as explants, and the number of somatic embryogenesis is only 18.1 per gram at present, research on the somatic embryogenesis system of the hybrid larch is necessary; in addition, larch is the first pine and fir plant to obtain transgenosis, and is a rare gymnosperm which is successfully transformed by utilizing agrobacterium rhizogenes, agrobacterium tumefaciens and gene gun, since Huang et al obtained the first transgenic european larch in 1991, the larch transgenosis has been developed to a certain extent, and then european larch, japanese larch, north China larch, xingan larch, japanese larch x long white larch and the like are provided, but the development is slower. For example, leve v et al use embryonic cells of japanese larch x european larch (Larix kaempferi x l. However, the transformation efficiency is very low, and the transformation rate of the embryogenic callus is only 1% -2%.
Disclosure of Invention
The invention provides a construction method of a hybrid larch genetic transformation system, aiming at solving the problems of difficult induction of embryonic callus and low transformation rate of the embryonic callus in the conventional tissue culture of the hybrid larch.
The construction method of the hybrid larch genetic transformation system comprises the following steps:
1. taking the pre-treated immature zygotic embryo of the hybrid larch, inoculating the immature zygotic embryo into a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT and 6.0g/L agar, and carrying out dark culture until embryogenic callus appears;
2. inoculating the embryonic callus into BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/LKT and 6.0g/L agar, and dark culturing at 22-25 deg.C until the callus is not browned;
3. then transferring the well-grown embryogenic callus into a BM modified culture medium containing 0.02-0.25 mg/L2, 4-D, 0-1.0 mg/LKT and 6.0g/L agar for culture, carrying out dark culture at the temperature of 22-25 ℃, carrying out subculture once for two weeks, and carrying out propagation culture on the embryogenic callus;
4. selecting the embryogenic callus with good growth, and carrying out genetic transformation on hybrid larch by using a target gene through an agrobacterium infection method;
5. then 100-200 mg/group of embryogenic callus with good growth and stable proliferation is taken and transferred into a 1/4BM culture medium without growth regulator for transitional culture before somatic embryo induction so as to achieve synchronism of somatic embryo generation and higher generation amount, and the conditions of transitional culture are as follows: culturing at 22-25 deg.c in dark for 10-12 days;
6. putting the callus after transition culture into a culture medium containing 10-30 mg/L ABA and 5-15 mg/LAgNO 3 、75～100g/L PEG 4000 And 6.0g/L agar in BM modified culture medium, and culturing at 22-25 deg.C in dark for 4-6 weeks.
Further, the hybrid larch of the first step is Japanese larch x Xingan larch. The seed collection period is 6 months and 28 days to 7 months and 15 days every year.
Further, the pretreatment method of the hybrid larch immature zygotic embryo in the step one specifically comprises the following steps:
peeling off seed coats of fully grown immature hybrid larch, placing on filter paper wetted by deionized water, placing the filter paper in an empty culture dish, and storing for 12h in a refrigerator at 4 ℃; then, cleaning the refrigerated seeds for 3-5 times by using sterilized deionized water in a superclean workbench; then alcohol with the volume fraction of 75% is used for disinfection for 1min, and the deionized water after disinfection is used for cleaning for 3 to 5 times; then transferring the mixture into a sodium hypochlorite solution with the volume concentration of 3% (10% sodium hypochlorite: deionized water =3: 7), shaking gently for 8-15min, and then washing with sterilized deionized water for 3-5 times; and finally, longitudinally cutting the middle of the seed by using a sterilized blade, slightly separating the embryo and the endosperm, putting the embryo and the endosperm into an inoculation culture medium with the cut downwards, or stripping the endosperm, picking the internal embryo and directly inoculating the embryo into the inoculation culture medium. The inoculation culture medium is a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT hormone and 6.0g/L agar.
Further, the temperature of the dark culture in the first step is 22-25 ℃.
Further, the BM modified medium comprises the following components: KNO 3 909.9mg·L -1 、KH 2 PO 4 136.1mg·L -1 、Ca(NO 3 ) 2 ·4H 2 O 236.2mg·L -1 、NH 4 NO 3 200.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 256.5mg·L -1 、MgCl 2 ·6H 2 O 101.7mg·L -1 、MgSO 4 ·7H 2 O 246mg·L -1 、KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 、FeSO 4 ·7H 2 O 2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 、Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 450mg/L L-glutamine, 500mg/L acid hydrolyzed casein and 30g/L sucrose.
Preferably, the pH of the BM modified medium is 5.8.
Further, the fourth step is that the method for selecting the embryogenic callus with good growth and carrying out the genetic transformation of the hybrid larch by the target gene through an agrobacterium infection method comprises the following steps:
(1) Firstly, selecting the embryogenic callus which grows well and is cultured for 12 days in a proliferation way, and dispersing the embryogenic callus;
(2) Preparing an invasive dyeing solution: placing the agrobacterium liquid (the agrobacterium competence is GV 3101) containing the target gene in a centrifuge with the temperature of 4 ℃ and the pressure of 8000g for centrifugation for 15min, then discarding the supernatant and collecting the thalli; then, suspending the thalli again by using a liquid suspension culture medium to be used as an invasion and infection solution, wherein the OD value of the invasion and infection solution is 0.4-0.6; the liquid suspension culture medium is a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT and 100uM acetosyringone;
(3) Infection and co-culture: selecting 400mg of dispersed embryogenic callus, placing in the invasion dye solution for infection for 15-25min, and shaking gently to uniformly disperse the callus in the invasion dye solution to contact the infection dye solution in the largest area. After infection, the infected callus is screened out by a 60-mesh cell screen, the callus is placed on sterile filter paper, redundant bacteria liquid on the surface of the callus is absorbed, and finally the callus is transferred to a co-culture medium for dark culture for 1 to 4 days. The co-culture medium is a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 100uM acetosyringone and 6.0g/L agar;
(4) And (3) bacteria removal test: when the bacteria is removed, a 60-mesh cell sieve is used, the callus after co-culture is firstly placed in sterile water for washing for 2 times, and then the callus is placed in a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 500mg/L Cef (Cef) and 6.0g/L agar for washing for 2 times, and 5min each time. Finally, absorbing the redundant liquid on the surface by using sterile filter paper, and putting the liquid into a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 200mg/L Cef and 6.0g/L agar for recovery culture for 10 days;
(5) Screening and culturing: transferring the callus after the recovery culture into a screening culture medium, and screening for 3 times in total to obtain embryogenic callus after genetic transformation; screening and culturing for 4 weeks to count the induction rate of the resistant callus. The screening culture medium is a BM modified culture medium containing 3mg/L hygromycin, 0.1 mg/L2, 4-D, 0.2mg/L KT and 6.0g/L agar.
The invention has the beneficial effects that:
the invention takes the immature zygotic embryo of the hybrid larch as an explant to carry out embryogenic callus induction, obtains callus with stronger multiplication capacity, stably and continuously maintains the embryogenic property, has the induction rate of 20 percent, has fastest multiplication (increased by 47.27 times compared with the weighing before three days) when being cultured on a multiplication culture medium for 12 days, has larger multiplication rate at the moment, reaches 300.74 percent, can keep fresh and active, has larger multiplication amount, and is the optimal successive transfer cycle. The number of somatic embryogenesis was 150/g. The highest induction rate of the existing tissue culture method of hybrid larch is less than 10%, and the somatic embryogenesis amount is lower than 20 per gram. Therefore, the method is a breakthrough compared with the prior art.
In addition, the transformation rate of the embryogenic callus obtained by the method is as high as 22.2%. The method provides a certain foundation for molecular breeding research such as rapid large-scale propagation of hybrid larch fine varieties and genetic transformation of excellent genes.
The method can solve the problems that the conventional breeding method of the hybrid larch has long breeding period, the sexual propagation hybrid progeny has large variation, the obtained excellent seed source is difficult to keep continuously and the like, can lay a foundation for the molecular breeding research of the larch through genetic engineering breeding, and greatly shortens the breeding period for the preservation of the excellent character gene of the larch.
Drawings
FIG. 1 is a photograph of embryogenic callus just induced from the hybrid larch in example 1;
FIG. 2 is a microscopic image of embryogenic callus that has just been induced in example 1;
FIG. 3 is a photograph of embryogenic callus obtained after proliferation of hybrid Larix Gmelini in example 1;
FIG. 4 is a microscopic image of embryogenic callus obtained after proliferation of hybrid larch in example 1;
FIG. 5 is a drawing of co-cultivation after infection with hybrid larch;
FIG. 6 is a drawing showing the recovery culture of hybrid larch after co-culture;
FIG. 7 is a photograph of the first screening culture after the recovery culture;
FIG. 8 is a photograph of a second screening culture after recovery culture;
FIG. 9 is a photograph of the third screening culture after the recovery culture;
FIG. 10 is a gel electrophoresis image of a validation screen;
FIG. 11 is a photograph after subculture before induction of somatic embryos of hybrid larch in example 1;
FIG. 12 is a microscopic examination of hybrid larch embryos of example 1 after subculture before induction;
FIG. 13 is a photograph of somatic embryogenesis of hybrid larch in example 1;
FIG. 14 is a microscopic picture of hybrid larch somatic embryogenesis in example 1.
Detailed Description
The technical solution of the present invention is not limited to the following specific embodiments, but includes any combination of the specific embodiments.
The first embodiment is as follows: the construction method of the hybrid larch genetic transformation system of the embodiment comprises the following steps:
1. taking the pre-treated immature zygotic embryo of the hybrid larch, inoculating the immature zygotic embryo into a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT and 6.0g/L agar, and carrying out dark culture until embryogenic callus appears;
2. inoculating the embryonic callus into BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/LKT and 6.0g/L agar, and dark culturing at 22-25 deg.C until the callus is not browned;
3. then transferring the well-grown embryogenic callus into a BM modified culture medium containing 0.02-0.25 mg/L2, 4-D, 0-1.0 mg/LKT and 6.0g/L agar for culture, carrying out dark culture at the temperature of 22-25 ℃, carrying out subculture once for two weeks, and carrying out propagation culture on the embryogenic callus;
4. selecting the embryogenic callus with good growth, and carrying out genetic transformation on the hybrid larch by the target gene through an agrobacterium infection method;
5. then 100-200 mg/group of embryogenic callus with good growth vigor and stable proliferation is taken and transferred into a 1/4BM culture medium which is removed of growth regulators and added with 6.0g/L agar for transitional culture before somatic embryo induction so as to achieve synchronism and higher generation amount of somatic embryos;
6. putting the callus after transition culture into a culture medium containing 10-30 mg/L ABA and 5-15 mg/LAgNO 3 、75～100g/L PEG 4000 And 6.0g/L agar, and performing somatic embryogenesis in BM modified medium under the following culture conditions: culturing at 22-25 deg.c in dark for 4-6 weeks.
The second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the hybrid larch is Japanese larch x Xingan larch. . The rest is the same as the first embodiment.
The third concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: step one, the seed collecting period of the hybrid larch is 6 months, 28 days to 7 months and 15 days each year. The rest is the same as the first embodiment.
The fourth concrete implementation mode is as follows: the first difference between the present embodiment and the specific embodiment is: the pretreatment method of the hybrid larch immature zygotic embryo in the first step specifically comprises the following steps:
peeling seed coats of fully grown immature hybrid larch, placing on filter paper wetted by deionized water, placing the filter paper in an empty culture dish, and storing for 12h in a refrigerator at 4 ℃; then, cleaning the refrigerated seeds for 3-5 times by using sterilized deionized water in a super clean bench; then alcohol with the volume fraction of 75% is used for disinfection for 1min, and the deionized water after disinfection is used for cleaning for 3 to 5 times; then transferring the mixture into a sodium hypochlorite solution with the volume concentration of 3% (10% sodium hypochlorite: deionized water =3: 7), shaking gently for 8-15min, and then washing with sterilized deionized water for 3-5 times; and finally, longitudinally cutting the middle of the seed by using a sterilized blade, slightly separating the embryo and the endosperm, putting the embryo and the endosperm into an inoculation culture medium with the cut downwards, or stripping the endosperm, picking the internal embryo and directly inoculating the embryo into the inoculation culture medium. The rest is the same as the first embodiment.
The fifth concrete implementation mode is as follows: the fourth difference between this embodiment and the specific embodiment is that: the inoculation culture medium is a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT hormone and 6.0g/L agar. The rest is the same as the fourth embodiment.
The sixth specific implementation mode: the first difference between the present embodiment and the specific embodiment is: step one the dark culture conditions are: the temperature is 22-25 ℃. The rest is the same as the first embodiment.
The seventh embodiment: the first difference between the present embodiment and the specific embodiment is: the BM modified medium comprises the following components: KNO 3 909.9mg·L -1 、KH 2 PO 4 136.1mg·L -1 、Ca(NO 3 ) 2 ·4H 2 O 236.2mg·L -1 、NH 4 NO 3 200.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 256.5mg·L -1 、MgCl 2 ·6H 2 O 101.7mg·L -1 、MgSO 4 ·7H 2 O 246mg·L -1 、KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 、FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 、Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 450mg/L L-glutamine, 500mg/L acid hydrolyzed casein and 30g/L sucrose. The rest is the same as the first embodiment.
The specific implementation mode is eight: the first difference between the present embodiment and the specific embodiment is: the pH of the BM modified medium was 5.8. The rest is the same as the first embodiment.
The specific implementation method nine: the first difference between the present embodiment and the specific embodiment is: the transitional culture conditions in the fifth step are as follows: the temperature is 22-25 ℃, dark culture is carried out, and the culture time is 10-12 days. The rest is the same as the first embodiment.
The detailed implementation mode is ten: the first difference between the present embodiment and the specific embodiment is: step five, the 1/4BM modified culture medium without the growth regulator comprises the following components: KNO 3 227.475mg·L -1 、KH 2 PO 4 34.025mg·L -1 ；Ca(NO 3 ) 2 ·4H 2 O 59.05mg·L -1 ；NH 4 NO 3 50.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 64.125mg·L -1 、MgCl 2 ·6H 2 O 25.425mg·L -1 、MgSO 4 ·7H 2 O 61.5mg·L -1 ；KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 ；FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 ；Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 . The rest is the same as the first embodiment.
The following examples are given to illustrate the present invention, and the following examples are carried out on the premise of the technical solution of the present invention, and give detailed embodiments and specific procedures, but the scope of the present invention is not limited to the following examples.
Example 1:
the method for constructing the hybrid larch genetic transformation system comprises the following steps of: the pH of the medium used in the method is strictly controlled at 5.8 each time.
1. Taking the pre-treated immature zygotic embryo of the hybrid larch, inoculating the immature zygotic embryo into a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT and 6.0g/L agar, and carrying out dark culture until embryogenic callus appears; the temperature of dark culture is 23 ℃;
the pretreatment method of the immature zygotic embryo of the hybrid larch comprises the following steps:
peeling seed coats of fully grown immature hybrid larch, placing on filter paper wetted by deionized water, placing the filter paper in an empty culture dish, and storing for 12h in a refrigerator at 4 ℃; then, cleaning the refrigerated seeds for 3-5 times by using sterilized deionized water in a super clean bench; then alcohol with the volume fraction of 75% is used for disinfection for 1min, and the deionized water after disinfection is used for cleaning for 3 to 5 times; then transferring the mixture into a sodium hypochlorite solution with the volume concentration of 3% (10% sodium hypochlorite: deionized water =3: 7), shaking gently for 8-15min, and then washing with sterilized deionized water for 3-5 times; and finally, longitudinally cutting the middle of the seed by using a sterilized blade, slightly separating the embryo and the endosperm, putting the embryo and the endosperm into an inoculation culture medium with the cut downwards, or stripping the endosperm, picking the internal embryo and directly inoculating the embryo into the inoculation culture medium. The inoculation culture medium is a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT hormone and 6.0g/L agar.
2. Continuously inoculating the embryogenic callus into BM modified culture medium containing 1.0 mg/L2, 4-D, 0.2mg/LKT and 6.0g/L agar, and performing dark culture at 23 deg.C until callus does not brown;
3. transferring the well-grown embryogenic callus into BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/LKT and 6.0g/L agar for culture, performing dark culture at 23 deg.C, performing subculture for two weeks, and performing proliferation culture of embryogenic callus;
4. selecting the embryogenic callus with good growth, and carrying out genetic transformation on hybrid larch by using a target gene through an agrobacterium infection method;
the specific method comprises the following steps:
(1) Firstly, selecting the embryogenic callus which grows well and is cultured for 12 days in a proliferation way, and dispersing the embryogenic callus;
(2) Preparing an invasive dyeing solution: placing the agrobacterium liquid (the agrobacterium competence is GV 3101) containing the target gene in a centrifuge with the temperature of 4 ℃ and the weight of 8000g for centrifugation for 15min, then discarding the supernatant, and collecting thalli; then, suspending the thalli again by using a liquid suspension culture medium to be used as an invasion and infection solution, wherein the OD value of the invasion and infection solution is 0.4-0.6; the liquid suspension culture medium is a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT and 100uM acetosyringone;
(3) Infection and co-culture: picking 400mg of the dispersed embryogenic callus, placing the embryogenic callus in the invasion dye solution for infection for 15-25min, and gently shaking the embryogenic callus without stopping the infection dye solution to uniformly disperse the embryogenic callus in the invasion dye solution so as to contact the infection dye solution in the largest area. After infection, the infected callus is screened out by a 60-mesh cell screen, the callus is placed on sterile filter paper, redundant bacteria liquid on the surface of the callus is absorbed, and finally the callus is transferred to a co-culture medium for dark culture for 1 to 4 days. The co-culture medium is a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 100uM acetosyringone and 6.0g/L agar;
(4) And (3) bacteria removal test: when the bacteria is removed, a 60-mesh cell sieve is used, the callus after co-culture is firstly placed in sterile water for washing for 2 times, and then the callus is placed in a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 500mg/L Cef (Cef) and 6.0g/L agar for washing for 2 times, and 5min each time. Finally, absorbing the redundant liquid on the surface by using sterile filter paper, and putting the liquid into a BM modified culture medium containing 0.1 mg/L2, 4-D, 0.2mg/L KT, 200mg/L Cef and 6.0g/L agar for recovery culture for 10 days;
(5) Screening and culturing: transferring the callus after the recovery culture into a screening culture medium, and screening for 3 times in total to obtain embryogenic callus after genetic transformation; screening and culturing for 4 weeks to count the induction rate of the resistant callus. The screening culture medium is a BM modified culture medium containing 3mg/L hygromycin, 0.1 mg/L2, 4-D, 0.2mg/L KT and 6.0g/L agar.
The preparation method of the agrobacterium containing the target gene comprises the following steps:
extracting total RNA of the whole seedling of hybrid larch by a CTAB method, then carrying out PCR amplification by cDNA reverse transcription by a takara reverse transcription kit with primers of 1301+ miRNA-F and 1301+ miRNA-R as a template;
1301+miRNA-F：ATGACCATGATTACGAATTCGTGCTTGATCCCTACAATAAG
1301+miRNA-R：ACGGCCAGTGCCAAGCTTTGAAAATAAATGCATTATCACTTC
after the target gene fragment is recovered, carrying out double enzyme digestion on the plasmid pCAMBIA1301 by using EcoRI and HindIII, carrying out result detection by agarose gel electrophoresis after enzyme digestion, cutting gel of a corresponding strip of the large fragment of the vector, and recovering an enzyme digestion product by using a Wharton's jelly recovery kit;
adding the target gene fragment and the linearized vector subjected to double enzyme digestion into an EP tube together for recombination reaction, uniformly mixing, keeping at 37 ℃ for 20min, immediately converting DH5 alpha competent cells, inverting at 37 ℃ and culturing overnight; the molar ratio of the target gene fragment to the linearized vector after double enzyme digestion is (3-10): 1;
carrying out colony PCR verification on the grown single colony the next day, selecting the single colony which is detected to be positive, putting the single colony in an LB culture medium added with kanamycin antibiotic for shaking the bacteria overnight, and then extracting plasmids in bacteria liquid, namely the recombinant vector containing the target gene; the target gene is miRNA precursor sequence, and the gene sequence is shown as SEQ ID NO:1 is shown.
The recombinant vector containing the target gene is transformed into GV3101 competent cells by the following specific method: adding 5-10 μ L plasmid, mixing, ice-cooling for 10min, liquid nitrogen quick-freezing for 5min, water-bathing at 37 deg.C for 5min, and ice-cooling for 5min. Adding 800 μ L of nonreactive LB liquid culture medium, shaking at 28 deg.C for 3-4h, centrifuging at 4000rpm for 1min, discarding part of supernatant, leaving about 150 μ L of liquid to resuspend thallus, spreading on LB solid culture medium containing kanamycin and gentamycin, and performing inverted culture at 28 deg.C. The single colony grown out is subjected to colony PCR positive verification.
5. Taking 150 mg/group of embryogenic callus with good growth vigor and stable proliferation, transferring the embryogenic callus into a 1/4BM modified culture medium added with 6.0g/L agar for transitional culture before somatic embryo induction so as to achieve synchronism of somatic embryo generation and higher generation amount, wherein the transitional culture conditions are as follows: culturing at 23 deg.C in dark for 10 days;
6. putting the callus subjected to transition culture into a medium containing 15mg/L ABA and 5mg/L AgNO 3 、100g/LPEG 4000 And 6.0g/L agar, and culturing at 23 deg.C in dark for 5 weeks.
Step one, the hybrid larch is hybrid larch which is Japanese larch multiplied by Xingan larch.
The BM modified culture medium comprises the following components: KNO 3 909.9mg·L -1 、KH 2 PO 4 136.1mg·L -1 ；Ca(NO 3 ) 2 ·4H 2 O 236.2mg·L -1 ；NH 4 NO 3 200.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 256.5mg·L -1 、MgCl 2 ·6H 2 O 101.7mg·L -1 、MgSO 4 ·7H 2 O 246mg·L -1 ；KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 ；FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 、Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 450mg/L L-glutamine, 500mg/L acid hydrolyzed casein and 30g/L sucrose.
The 1/4BM modified culture medium comprises the following components: KNO 3 227.475mg·L -1 、KH 2 PO 4 34.025mg·L -1 ；Ca(NO 3 ) 2 ·4H 2 O 59.05mg·L -1 ；NH 4 NO 3 50.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 64.125mg·L -1 、MgCl 2 ·6H 2 O 25.425mg·L -1 、MgSO 4 ·7H 2 O 61.5mg·L -1 ；KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 ；FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 ；Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 450mg/L L-glutamine, 500mg/L acid hydrolyzed casein, 1g/L inositol and 30g/L sucrose.
In the method of the present example, the embryogenic callus induction rate was high, 10%, and the callus was in the form of clear white crystals. The growth is faster during proliferation culture, the proliferation capacity is particularly strong, and the fresh weight increase of the tissue reaches the maximum when the tissue is cultured on a proliferation culture medium for 33 days, and is 1104.4mg (the proliferation rate is 636.3%). Thereafter, a negative increase in proliferation amount began to occur. But the state of the embryogenic callus is best at 9-12 days, the proliferation is fastest at 12 days (increased by 47.27 times compared with the amount weighed before three days), the proliferation rate is larger at the moment and reaches 300.74%, and the embryogenic callus can keep fresh and vitality and has larger proliferation amount, thereby being the optimal subculture period. FIG. 1 shows the result of embryogenic callus induction and FIG. 2 shows the result of microscopy. The proliferated embryogenic callus is shown in FIG. 3 and the microscopic image is shown in FIG. 4.
The callus obtained after selection had a resistance rate of 22.2% (number of callus pieces selected/number of callus pieces just placed on the selection medium), co-culture was as shown in FIG. 5, recovery culture was as shown in FIG. 6, and pictures of callus selected for the first, second, and third times were as shown in FIGS. 7, 8, and 9. The gel electrophoresis pattern verified after three screens is shown in figure 10.
After the embryogenic callus is subjected to the transient culture before somatic embryo induction, the callus becomes dense and compact, and the surface has small protrusions, as shown in FIG. 11, and as shown in FIG. 12 by microscopic examination.
The somatic embryogenesis amount after somatic embryo induction culture is 150/g at most, and the actual figure 13 and the microscopic figure of somatic embryogenesis are shown in figure 14.
Sequence listing
<110> northeast forestry university
<120> construction method of hybrid larch genetic transformation system
<160> 3
<210> 1
<211> 112
<212> DNA
<213> Larix genus
<220>
<223> -miRNA precursor sequences
<400> 1
gugcuugauc ccuacaauaa gcuuuucagc ccguucacgg uaaaguuuau aauguaacuu 60
ugcagaguga guggcuggaa aacuuauuga agugauaaug cauuuauuuu ca 112
<210> 2
<211> 41
<212> DNA
<213> Artificial sequence
<220>
<223> primer 1301+miRNA-F
<400> 2
ATGACCATGATTACGAATTCGTGCTTGATCCCTACAATAAG 41
<210> 3
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> primer 1301+miRNA-R
<400> 3
ACGGCCAGTGCCAAGCTTTGAAAATAAATGCATTATCACTTC 42
Claims (7)
1. A method for constructing a genetic transformation system of hybrid larch, which is characterized by comprising the following steps:
1. taking the pre-treated immature zygotic embryo of the hybrid larch, inoculating the immature zygotic embryo into a BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT and 6.0g/L agar, and carrying out dark culture until embryogenic callus appears;
2. inoculating the embryonic callus into BM modified culture medium containing 0.2-2.5 mg/L2, 4-D, 0-1.0 mg/L KT and 6.0g/L agar, and performing dark culture at 22-25 deg.C until the callus is not browned;
3. then transferring the good-growing embryogenic callus into BM modified culture medium containing 0.02-0.25 mg/L2, 4-D and 0-1.0 mg/LKT to perform multiplication culture of the embryogenic callus, performing dark culture at the temperature of 22-25 ℃, and performing subculture once for two weeks;
4. selecting the embryogenic callus with good growth, and carrying out genetic transformation on the hybrid larch by the target gene through an agrobacterium infection method;
5. then 100-200 mg/group of embryogenic callus with good growth vigor and stable proliferation is taken and transferred into a 1/4BM modified culture medium added with 6.0g/L agar for transitional culture before somatic embryo induction;
6. putting the callus after transition culture into a culture medium containing 10-30 mg/L ABA and 5-15 mg/LAgNO 3 、75～100g/L PEG 4000 And 6.0g/L agar in BM modified medium for somatic embryogenesisThe culture conditions of (A) are: culturing at 22-25 deg.c in dark for 4-6 weeks;
step one, the hybrid larch is Japanese larch multiplied by Xingan larch;
the BM modified medium comprises the following components: KNO 3 909.9mg·L -1 、KH 2 PO 4 136.1mg·L -1 、Ca(NO 3 ) 2 ·4H 2 O 236.2mg·L -1 、NH 4 NO 3 200.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 256.5mg·L -1 、MgCl 2 ·6H 2 O 101.7mg·L -1 、MgSO 4 ·7H 2 O 246mg·L -1 、KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 、FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA 3.73mg·L -1 、Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 、Glycine 2.0mg·L -1 450mg/L L-glutamine, 500mg/L acid hydrolyzed casein and 30g/L sucrose;
the 1/4BM modified culture medium in the step five comprises the following components: KNO 3 227.475mg·L -1 、KH 2 PO 4 34.025mg·L -1 ；Ca(NO 3 ) 2 ·4H 2 O 59.05mg·L -1 ；NH 4 NO 3 50.0mg·L -1 、Mg(NO 3 ) 2 ·6H 2 O 64.125mg·L -1 、MgCl 2 ·6H 2 O 25.425mg·L -1 、MgSO 4 ·7H 2 O 61.5mg·L -1 ；KI 4.15mg·L -1 、H 3 BO 3 15.5mg·L -1 、MnSO 4 ·H 2 O 10.5mg·L -1 、ZnSO 4 ·7H 2 O 14.688mg·L -1 、Na 2 MoO 4 ·2H 2 O 0.125mg·L -1 、CuSO 4 ·5H 2 O 0.1725mg·L -1 、CoCl·6H 2 O 0.125mg·L -1 ；FeSO 4 ·7H 2 O2.78mg·L -1 、Na 2 EDTA3.73mg·L -1 ；Inositol 1g·L -1 、Vitamin B 1 1.0mg·L -1 、Vitamin B 6 1.0mg·L -1 、Nicotinic acid 0.5mg·L -1 And Glycine 2.0 mg. L -1 。
2. The method for constructing a genetic transformation system for hybrid larch according to claim 1, wherein the seed collection period for hybrid larch at step one is from 6 months 28 to 7 months 15 days per year.
3. The method for constructing a genetic transformation system of hybrid larch according to claim 2, wherein the method for pretreating the immature zygotic embryo of hybrid larch in the first step comprises:
peeling off seed coats of fully grown immature hybrid larch, placing on filter paper wetted by deionized water, placing the filter paper in an empty culture dish, and storing for 12h in a refrigerator at 4 ℃; then, cleaning the refrigerated seeds for 3-5 times by using sterilized deionized water in a superclean workbench; then alcohol with volume fraction of 75% is used for disinfection for 1min, and deionized water after disinfection is used for washing for 3-5 times; then transferring the sodium hypochlorite solution into a sodium hypochlorite solution with the volume concentration of 3%, continuously shaking for 8-15min, and then washing for 3-5 times by using sterilized deionized water; and finally, longitudinally cutting the middle of the seed by using a sterilized blade, slightly separating the embryo and the endosperm, putting the embryo and the endosperm into an inoculation culture medium with the cut downwards, or stripping the endosperm, picking the embryo in the embryo, and directly inoculating the embryo into the inoculation culture medium.
4. The method for constructing a hybrid larch genetic transformation system according to claim 3, wherein the inoculation medium is a BM modified medium containing 0.2 to 2.5mg/L of 2,4-D, 0 to 1.0mg/L of KT hormone, and 6.0g/L of agar.
5. The method for constructing a genetic transformation system for hybrid larch as claimed in claim 4, wherein the conditions for the dark culture in the first step are: the temperature is 22-25 ℃.
6. The method for constructing a hybrid larch genetic transformation system according to claim 5, wherein the pH of the BM modified medium is 5.8.
7. The method for constructing a genetic transformation system for hybrid larch according to claim 6, wherein the conditions for the subculture in the fifth step are: culturing at 22-25 deg.c in dark for 10-12 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910294917.XA CN110004176B (en) | 2019-04-12 | 2019-04-12 | Construction method of hybrid larch genetic transformation system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910294917.XA CN110004176B (en) | 2019-04-12 | 2019-04-12 | Construction method of hybrid larch genetic transformation system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110004176A CN110004176A (en) | 2019-07-12 |
| CN110004176B true CN110004176B (en) | 2023-03-10 |
Family
ID=67171441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910294917.XA Active CN110004176B (en) | 2019-04-12 | 2019-04-12 | Construction method of hybrid larch genetic transformation system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110004176B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113736821B (en) * | 2021-09-06 | 2023-04-11 | 东北林业大学 | Genetic transformation method for embryonic callus of Korean pine |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101218894A (en) * | 2007-09-26 | 2008-07-16 | 南京林业大学 | Embryogenesis and plant strain regeneration method for hybrid somatic cell of slash pine and cuban pine |
| CN104839028A (en) * | 2015-06-02 | 2015-08-19 | 东北林业大学 | Method for inducing hybrid larch plant regeneration through in vitro culture of adventitious buds |
| CN105409767A (en) * | 2015-10-23 | 2016-03-23 | 东北林业大学 | Transitional culture medium improving somatic embryogenesis and and plant regeneration efficiency of larix olgensis and culture method |
| CN105432465A (en) * | 2015-11-12 | 2016-03-30 | 东北林业大学 | Method for improving embryonic callus induction rate and embryo transfer rate of pinus koraiensis |
| CN106893737A (en) * | 2015-12-17 | 2017-06-27 | 中国林业科学研究院林业研究所 | A kind of genetic transforming method of larch cells,primordial |
| CN111280065A (en) * | 2020-04-07 | 2020-06-16 | 北京林业大学 | Method for regenerating larch somatic embryos |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101112177A (en) * | 2007-09-07 | 2008-01-30 | 南京林业大学 | Solid and liquid alternated culture inducement crossbreeding Chinese tulip tree liquid suspend cell embryo high-frequency generating and regenerating method |
| CN101112178B (en) * | 2007-09-07 | 2011-03-09 | 南京林业大学 | Crossbred Chinese tulip tree clone trophozoite suspension cell line inducement method for the generating and regenerating of somatic embryo |
| US9447421B2 (en) * | 2010-06-24 | 2016-09-20 | Syngenta Participations Ag | Methods for Agrobacterium-mediated transformation of sugar cane |
-
2019
- 2019-04-12 CN CN201910294917.XA patent/CN110004176B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101218894A (en) * | 2007-09-26 | 2008-07-16 | 南京林业大学 | Embryogenesis and plant strain regeneration method for hybrid somatic cell of slash pine and cuban pine |
| CN104839028A (en) * | 2015-06-02 | 2015-08-19 | 东北林业大学 | Method for inducing hybrid larch plant regeneration through in vitro culture of adventitious buds |
| CN105409767A (en) * | 2015-10-23 | 2016-03-23 | 东北林业大学 | Transitional culture medium improving somatic embryogenesis and and plant regeneration efficiency of larix olgensis and culture method |
| CN105432465A (en) * | 2015-11-12 | 2016-03-30 | 东北林业大学 | Method for improving embryonic callus induction rate and embryo transfer rate of pinus koraiensis |
| CN106893737A (en) * | 2015-12-17 | 2017-06-27 | 中国林业科学研究院林业研究所 | A kind of genetic transforming method of larch cells,primordial |
| CN111280065A (en) * | 2020-04-07 | 2020-06-16 | 北京林业大学 | Method for regenerating larch somatic embryos |
Non-Patent Citations (4)
| Title |
|---|
| 利用胚性愈伤组织进行落叶松遗传转化体系的研究;王静;《中国优秀硕士学位论文全文数据库》;20080215;全文 * |
| 杂种落叶松（兴10×日13）再生体系的建立及优化;张莉等;《植物研究》;20160515;第36卷(第3期);全文 * |
| 落叶松胚性愈伤组织悬浮培养体系的优化;宋跃等;《林业科学》;20180701;第54卷(第7期);全文 * |
| 长白落叶松胚性愈伤组织诱导及体细胞胚胎发生;宋跃等;《林业科学》;20161015;第52卷(第10期);第53页左栏第3段、第1.2.3-1.2.5节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110004176A (en) | 2019-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN102154364A (en) | Method for agrobacterium tumefaciens-mediated genetic transformation of sugarcane | |
| CN111690678B (en) | Method for obtaining whole transgenic woody plant by utilizing agrobacterium rhizogenes transformation | |
| KR19990076718A (en) | Growth and / or Screening Methods of Plant Raw Materials | |
| CN102296086A (en) | Agrobacterium tumefaciens-mediated barley mature embryo callus transformation method | |
| CN113278650A (en) | Genetic transformation method for agrobacterium-infected populus argentea callus | |
| CN104004783B (en) | A kind of method improving cotton transgenic efficiency | |
| CN110004176B (en) | Construction method of hybrid larch genetic transformation system | |
| CN102191269B (en) | Non tissue culture gene transferring method by using half of peanut seed as acceptor | |
| CN105441479B (en) | Method for establishing transgenic system of Dendrocalamus hamiltonii | |
| CN108901844B (en) | Method for constructing lycoris genus genetic transformation system | |
| CN113736821B (en) | Genetic transformation method for embryonic callus of Korean pine | |
| CN110305894B (en) | Rapid and efficient catalpa bungei genetic transformation method | |
| CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN107034231B (en) | Gene transformation method of Chinese chestnut | |
| Zhang et al. | An efficient regeneration protocol for Agrobacterium-mediated transformation of melon (Cucumis melo L.) | |
| CN115786232B (en) | Quick suspension culture and genetic transformation method for saussurea involucrata cells | |
| CN106244595B (en) | China fir phytosulfokine-α CLPSK1 gene and its application | |
| CN117660525B (en) | Rice haploid induction method | |
| CN112813076B (en) | sgRNA composition for knocking out cotton GhTSTs gene and application of sgRNA composition in creating cotton short-fiber-free mutant | |
| Moore et al. | Agrobacterium-mediated transformation of grapefruit (Citrus paradisi Macf.) with genes from citrus tristeza virus | |
| CN114149996B (en) | Application of GhAIL6 gene in promoting cotton embryogenic callus formation | |
| CN114107371B (en) | Cucumber green mottle mosaic virus gene mediated transgenic tobacco method | |
| CN116445540B (en) | Construction method of sweet potato leaf curl virus infectious clone and efficient and simple sweet potato infection method | |
| CN115896160B (en) | Method for efficiently and rapidly obtaining apple stable transgenic plants by using agrobacterium rhizogenes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |