CN110004165A - Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application - Google Patents
Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application Download PDFInfo
- Publication number
- CN110004165A CN110004165A CN201910272923.5A CN201910272923A CN110004165A CN 110004165 A CN110004165 A CN 110004165A CN 201910272923 A CN201910272923 A CN 201910272923A CN 110004165 A CN110004165 A CN 110004165A
- Authority
- CN
- China
- Prior art keywords
- peach
- ppiaah1
- auxin
- tomato
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to field of plant genetic project technology, are related to peach auxin amide hydrolysis enzyme genePpIAAH1And its application.The present invention passes through clone peach auxin hydroamidase gene family member, analyze expression pattern of the gene in solute type Peach fruits maturation, the function of verifying purpose gene in Micro-Tom tomato is finally transferred to the method for mediated by agriculture bacillus, be conducive to the response mechanism from the auxin signal being illustrated in peach maturation in molecular mechanism, to further realizing purposeful peach, targeted quality and character improvement, peach new varieties are cultivated, there is positive directive function.
Description
Technical field
The invention belongs to field of plant genetic project technology, are related to peach auxin amide hydrolysis enzyme genePpIAAH1And its
Using.
Background technique
Auxin is a kind of low molecular weight organic acid, is made of an aromatic rings and a carboxylic group, contains in plant
Measuring most auxin is IAA.Auxin plays an important role in many physiology courses of plant growth and development, such as the pole of plant
Property establish and maintain, apical dominance, phototropism, gravitropism and fruit formed (Woodward and Bartel, 2005;
Vanneste and Friml, 2009).
Peach [Prunus persica (L). Batsch] fruit is generally solute type (melting flesh, MF), belong to
Climacteric type fruit, softens rapidly after ethylene transition, reaches commodity maturation, and hard type Peach fruits maturity period (stony
Hard, SH) there is no ethylene transition peak, fruit does not soften.The processing of external source methyl α-naphthyl acetate can cause hard type Peach fruits Ripening and Softening,
Demonstrate the effect of auxin in the process.The study found that hard peach 1- amino-cyclopropane -1- carboxylic acid (1-
Aminocyclopropane-1-carboxylic acid, ACC) synthase genePpACS1The expression of (ACC synthase)
It remains at low levels always in fructescence, ethylene synthase is caused to be obstructed, and solute peachPpACS1The expression quantity of gene with
The maturation of fruit rises rapidly.
Auxin amide hydrolysis protein family can catalytic growth element amino acid reference state (IAA-Ala、IAA-LeuDeng) in
Amido bond hydrolysis to release the water stress of bioactivity, by adjusting the content for the IAA that dissociates in tissue, in turn
Regulating growth of plants.Research shows that the auxin amide hydrolysis protein in the species such as arabidopsis, turnip, M. truncatula
The processes such as family member takes part in the extension of plumular axis respectively, lateral root occurs, mushroom infects response and root nodule generates.
Summary of the invention
One of the objects of the present invention is to provide peach auxin amide hydrolysis enzyme genesPpIAAH1And its encoded egg
It is white.
The second object of the present invention is to provide peach auxin amide hydrolysis enzyme genePpIAAH1Recombinant vector.
The third object of the present invention is to provide peach auxin amide hydrolysis enzyme genePpIAAH1And its encoded egg
Application of the white, recombinant vector in tomato breeding, and in particular to changing tomato plant type, change tomato fruit shape or promoting tomato fruit
The application of real mature aspect.
To achieve the above object, the invention adopts the following technical scheme:
The present invention provides peach auxin amide hydrolysis enzyme genePpIAAH1, sequence is as shown in SEQ ID NO:1.
The present invention also provides peach auxin amide hydrolysis enzyme genesPpIAAH1The albumen of coding, amino acid sequence such as SEQ
Shown in ID NO:2.
The present invention also provides include the peach auxin amide hydrolysis enzyme genePpIAAH1Recombinant vector.
Preferably, the recombinant vector is bacillus Expression carrier.
The present invention also provides peach auxin amide hydrolysis enzyme genesPpIAAH1, peach auxin amide hydrolysis enzyme genePpIAAH1The albumen and peach auxin amide hydrolysis enzyme gene of codingPpIAAH1Application of the recombinant vector in tomato breeding.
Preferably, the tomato breeding is to change tomato plant type, change tomato fruit shape or promote Fruit Ripening of Tomato.
Preferably, the change tomato fruit shape is to change tomato to grow fruit point.
Preferably, the tomato breeding the following steps are included:
A: building contains the peach auxin amide hydrolysis enzyme genePpIAAH1Recombinant vector；
B: constructed recombinant vector is transformed into tomato tissue or cell；
C: it cultivates screening and obtains transgene tomato.
Compared with prior art, the beneficial effects of the present invention are:
It is mature in solute type Peach fruits to analyze the gene by clone peach auxin hydroamidase gene family member by the present invention
Expression pattern in the process is finally transferred to the function of verifying purpose gene in Micro-Tom tomato with the method for mediated by agriculture bacillus,
Be conducive to the response mechanism from the auxin signal being illustrated in peach maturation in molecular mechanism, have mesh to peach is further realized
, targeted quality and character improvement, cultivate peach new varieties, there is positive directive function.
Detailed description of the invention
Fig. 1 is peach auxin amide hydrolysis enzyme genePpIAAH1PCR amplification electropherogram, 2000 marker of M:DL, swimming
The band of road 1 and 2 isPpIAAH1Gene, size 1341bp.
Fig. 2 peach auxin amide hydrolysis enzyme genePpIAAHIWith auxin hydroamidase chadogram in peach, arabidopsis
Analysis, whereinPpILR3: ppa005836m；PpILR4: ppa025680m；PpILL1: ppa006515m；PpILL2:
ppa008809m；PpILL3: ppa005751m；PpILL4: ppa005752m；PpILL5: ppa006982m:AtILR1:
AT3G02875；AtIAR3: AT1G51760；AtILL1: AT5G56650；AtILL2: AT5G56660；AtILL3:
AT5G54140；AtILL5: AT1G51780；AtILL6: AT1G44350.
Fig. 3 is peach auxin amide hydrolysis enzyme genePpIAAHIThe point-to-point experimental result of yeast, Rec-P53 and P53
For positive control.
Fig. 4 is peach auxin amide hydrolysis enzyme genePpIAAH1Expression, wherein Fig. 4-a be in CN13 and CN16 peach fruit
The expression in real maturity period, Fig. 4-b are CN13 gene after 1-MCP is handledPpIAAH1Expression, Fig. 4-c be CN16 handled through NAA
Gene afterwardsPpIAAH1Expression, Fig. 4-d be CN16 gene after ethylene is handledPpIAAH1Expression.
Fig. 5 is that PCR identifies transgenic positive plant, 2000 marker of M:DL, and swimming lane 1,2,3,4,5,6,7,8 is to turn
Genotype Strains, swimming lane 9 are wild-type tomatoes plant.
Fig. 6 compares for the plant type of wild-type tomatoes and transgenic tomato plant.
Fig. 7 compares for the lateral root number of wild-type tomatoes and transgenic tomato plant.
It is colored comparison that Fig. 8, which is wild-type tomatoes and transgenic tomato plant,.
Fig. 9 compares for the number seeds of wild-type tomatoes and transgenic tamato fruit.
Figure 10 compares for the maturity period of wild-type tomatoes and transgenic tamato fruit.
Figure 11 compares for ethylene evolution during wild-type tomatoes and transgenic Fruit Ripening of Tomato and firmness change.
Figure 12 is quantifying for the ethylene synthetase key gene of wild-type tomatoes and transgenic tamato fruit different times
Analysis.
Figure 13 is the mature related gene and cell wall degradation of wild-type tomatoes and transgenic tamato fruit different times
The quantitative analysis of related gene.
Specific embodiment
The following examples are intended to illustrate the invention, but is not used to limit the scope of protection of the present invention.Unless otherwise specified, real
Apply the conventional means that technological means used in example is well known to those skilled in the art.Test method in following embodiments, such as
It is conventional method without special instruction.
Solute type kind ' middle nectarine No. 13 ' (' CN13 ') in the present invention (PrunuspersicaVar. nectarina)
It is provided with hard type ' middle nectarine No. 16 ' (' CN16 ') by Zhengzhou Fruit-tree Inst., Chinese Agriculture Science Academy's peach breeding nursery.
One peach auxin amide hydrolysis enzyme gene of embodimentPpIAAH1Separation and identification
Test method
1, genePpIAAH1Separation
Peach pulp RNA is extracted using plant polyose polyphenol kit (DP441, TIANGEN Biotech (Beijing) Co., Ltd.), is led to
It crosses reverse transcription reagent box (TIANGEN Biotech (Beijing) Co., Ltd.) and obtains single-stranded cDNA, using single-stranded cDNA as template, below
Stating sequence is primer, is purchased from the limited public affairs of Roche biotechnology by PCR(kit FastStart SYBR Green Master
Department) obtain genePpIAAH1Full length sequence, PCR amplification electropherogram is as shown in Figure 1.GenePpIAAH1Full length sequence such as sequence
In list shown in SEQ ID NO:1, total 1341bp encodes the amino acid sequence such as SEQ ID NO:2 institute in sequence table of albumen altogether
Show, totally 446, evolutionary analysis showsPpIAAH1With arabidopsis auxin amide hydrolysis enzyme geneAtILR1Condense together (figure
2).
Primer sequence are as follows:
It is positiveIAAH1f: 5'- ATGGGTTTCAATTTCACTT -3'；
ReverselyIAAH1r: 5'- CTAGAAATTAGAATTGTAGAG -3'.
It willPpIAAH1The method of the region CDS homologous recombination connect into the pGADT7 plasmid after EcoRI digestion；It willPpACS1It is connected with the method for homologous recombination into the pAbAi carrier after HindIII and XhoI double digestion after promoter PCR amplification
In.With Matchmaker Gold Yeast One-Hybrid Library Screening System Kit
(Clontech, San Francisco, USA) kit does yeast one-hybrid experiment, as a result as shown in Figure 3.The result shows thatPpIAAH1It can combinePpACS1Gene promoter (Fig. 3).
2, genePpIAAH1Expression analysis
Quantitative primer sequence are as follows:
It is positiveRTIAAH1f: 5'- TCTTCCAATAGGAGCAGCACT -3'；
ReverselyRTIAAH1r: 5'- CATTTGTGCTTTAGTAAGACGG -3'.
95 DEG C of 5min of initial denaturation, are denaturalized 95 DEG C of 30s, and anneal 60 DEG C of 30s, extend 72 DEG C of 30s, 45 circulations.
It is detected using qRT-PCRPpIAAH1Gene is in solute type ' middle nectarine No. 13 ' (CN13) and hard type ' middle nectarine 16
Number ' expression of (CN16) different times.Four sampling time points of two kinds (CN13 and CN16) be S3 period,
S4I period, S4II period and S4III period.For MF type Peach fruits, S3 period is fruit expanding period；S4I period is fruit
Prepare release ethylene real transition early period；S4II period is the fruit transition phase, there is the release of a small amount of ethylene；And S4III period is fruit
In the real transition later period, ethylene is largely discharged, and fruit softens rapidly.For SH type Peach fruits, S3 period fruit or green
Color, S4I period fruit color are gradually converted from green to white, and S4II period fruit color slightly becomes white, S4III period
Fruit color is white.Choose Actin(ppa007242m) as reference gene (Brandi et al., 2011), with 2-ΔΔCt
Formula calculates gene relative expression quantity (Livak and Schmittgen, 2001), as a result as shown in Figure 4.
Fig. 4-a indicates peach auxin amide hydrolysis enzyme genePpIAAH1In CN13 and CN16 Peach fruits different ripening stages
Expression.As can be seen that peach auxin amide hydrolysis enzyme gene in CN13 kindPpIAAH1With the development of Peach fruits, in S4II
Period reaches peak value, then reduces again；Peach auxin amide hydrolysis enzyme genePpIAAH1Expression quantity in CN13 Peach fruits is bright
It is aobvious to be higher than CN16 Peach fruits.
Fig. 4-b be CN13 through 1-MCP(1- methyl cyclopropene) processing after peach auxin amide hydrolysis enzyme genePpIAAH1's
Expression, Fig. 4-c be CN16 through NAA(methyl α-naphthyl acetate) processing after auxin amide hydrolysis enzyme genePpIAAH1Expression, Fig. 4-d is
CN16 peach auxin amide hydrolysis enzyme gene after ethylene is handledPpIAAH1Expression.As can be seen that being in S4II developmental stage
CN13 through 10 μ L L−11-MCP processing after, peach auxin amide hydrolysis enzyme genePpIAAH1Expression in 1 day after treatment
Obvious up-regulation；And in the S4III stage of development CN16 adopt after through methyl α-naphthyl acetate (1 mM NAA) or ethylene (1000 ppm
Ethephon it) handles, peach auxin amide hydrolysis enzyme gene can be significantly inhibitedPpIAAH1Expression.
3, genePpIAAH1Functional Validation Test
For researchPpIAAH1Whether gene participates in the auxin signal pathway in peach maturation, passes through transgene tomato
To analyze and identify its function.
3.1 building recombinant vectors
Then target fragment is connected by pTOPO-blunt carrier cloning with one-step cloning kit (Vazyme, Nanjing of China)
Onto pK2GW7 carrier.Primer difference is as follows:
vIAAH1f: 5'- GGGGACAAGTTTG TACAAAAAAGCAGGCT -3'；
vIAAH1r: 5'- GGGGACCACTTT GTACAAGAAAGCTGGGT -3'.
1% agarose electrophoresis detects PCR reaction product, and positive colony is sent to the Shanghai biotech inc Sheng Gong
Sequencing.
The screening of 3.2 transgene tomato positive strains
Genetic conversion system efficiently, mature is not yet established in view of peach, therefore is used for using model plant Micro-Tom tomatoPpIAAH1The functional verification of gene, tomato conversion method is referring to Sun et al(2006), Bee Lynn Chew and Yu
Pan(University of Nottingham) optimization.The 70% alcohol surface sterilization of Micro-Tom tomato seeds, after rinsed with sterile water 3 times, 10% time
Sodium chlorate sterilizes 1h.It cleans 6 times in sterile water after taking-up, is dried on filter paper.Seed is seeded in pH=5.9, contains 0.8% agar
50%MS culture medium in.Plant is in the h brightness of 14 h/10, and 25 DEG C, 80% relative humidity, 250 μm of ol m-2 s-1Light intensity
Tissue culture is cultivated in room.
It extracts by sequencingPpIAAH1-pK2GW7The plasmid of carrier, frozen-thawed method are transferred in Agrobacterium GV3101.
Agrobacterium bacterial concentration OD to 0.5 is adjusted, disseminates conversion Micro-Tom tomato with leaf disk method, and break up on root media
Leaf and root.After growing up to seedling, DNA is extracted, Standard PCR identifies positive plant, as shown in Figure 5.After T0 is harvested for seed, containing
Have card receive mycin 1/2MS culture medium on screen positive plant.Transgenic positive plant contains antibiotic resistance gene, is containing antibiosis
It grows to be transplanted in soil after true leaf and main root on the culture medium of element and cultivates and harvest T1 for seed.After T1 is sowed for seed, benefit
With T2 for the difference of transgene tomato observation and wild type.It tests below and utilizes T2 generation and offspring's homozygous line.
PCR Molecular Identification positive plant primer:
PK2GW7F:5'- TTCTTGTTCCCATTTCTCTCT -3'；
PK2GW7R:5'- AGCTGGTCACCTGTAATTCAC -3'.
For confirming that segment is inserted into.
Embodiment two genePpIAAH1Effect in transgenic tomato
2.1 genePpIAAH1Influence to tomato plant shape
Fig. 6 and Fig. 7 is respectively that the plant type of wild-type tomatoes and transgenic tomato plant and lateral root number compare.It can be with from figure
Find out, compared with wild type, 2 typical transgenic lines (PpIAAH1-22WithPpIAAH1-30) in growth phase transgenosis
Plant does not have branch, and lateral root number is reduced.
It is colored comparison that Fig. 8, which is wild-type tomatoes and transgenic tomato plant,.It can be seen from the figure that with wild type phase
Than transgenosisPpIAAH1Cause fallen flowers.
2.2 genePpIAAH1Influence to Tomato Fruit Development
Fig. 9 and Figure 10 is respectively to compare in the number seeds of wild-type tomatoes and transgenic tamato fruit and maturity period.
From fig. 9, it can be seen that compared with wild type, 2 typical transgenic linesPpILR1-22WithPpILR1-30Fruit
Real seed number is reduced.
From fig. 10 it can be seen that the maturity period of wild type and transgenosis fruit is significantly different, 2 transgenic lines
(PpIAAH1-22WithPpIAAH1-30) fruit obviously do sth. in advance mature 8~10 days than wild type；In addition wild type and transgenosis
The fruit shapes of fruit are significantly different, 2 transgenic lines (PpIAAH1-22WithPpIAAH1-30) fruit with apparent
Fruit point, through measuring, the fruit point length of transgenic line fruit is up to 2 ~ 3mm.It can be seen thatPpIAAH1In two transgenic line fruits
The obvious characteristic overexpressed in development is to lead to the change of fructescence and fruit is made to grow fruit point.
2.3 genePpIAAH1Influence to tamato fruit hardness and ethylene yield
Figure 11 compares for ethylene evolution during wild-type tomatoes and transgenic Fruit Ripening of Tomato and firmness change, Br in figure
Indicate veraison, Br+1 indicates that Br+2 is indicated annesl two days annesl 1 day, and Br+3 is indicated annesl 3 days, and Br+6 is indicated annesl 6 days.
From Figure 11-a can be seen that the acetate releasing quantity of wild-type tomatoes and transgenic tomato fruit maturation early period not
Disconnected to rise, in combination with Fig. 9 it is found that the acetate releasing quantity of wild-type tomatoes reaches peak value in Br+3, subsequent burst size starts
Decline；Compared with wild type, the ethylene evolution of transgenic tomato reaches peak value, and ethylene when Br+3, Br+6 in Br+2
Burst size is higher than wild type.It can be seen that wild type and Transgenic tomato fruit hardness as fruit maturation is continuous from Figure 11-b
Decline；Compared with wild type, the hardness of transgenosis fruit is slightly decreased.
Figure 12 is quantifying for the ethylene synthetase key gene of wild-type tomatoes and transgenic tamato fruit different times
Analysis.It can be recognized from fig. 12 that ethylene synthetase key gene is (such asSlACO1、SlACS2、SlACS4、SlEIL1、SlEIL3、 SlEIL4、SlETR2、SlETR5), whereinSlACS2WithSlACS4Gene is obviously higher than wild type in the expression in Br+2 period, together
When also indicate thatPpIAAH1Gene may promote the maturation of tamato fruit by promoting the release of ethylene, this is indicated with Fig. 9
The meaning that the transgene tomato maturity period shifts to an earlier date is consistent.
Transgene tomato shows very strong auxin Relevant phenotype, including vegetation growth of plant phenotype, parthenocarpy and
The change of fruit shapes.To understandPpIAAH1Fruit development period (Br, Br+ are chosen in effect of gene during after tomato is adopted
1, Br+2, Br+3 and Br+6), and detect plant fruit-ripening related genes and cell wall degradation related gene (SlAP2a、SlCNR、 SlE4、SlFUL2、SlNOR、SlNR、SlPG、SlRIN、SlTAG1、SlFUL1、SlTAGL1) expression, as shown in figure 13.From
Figure 13 can be seen thatSlAP2a、SlNR、SlNOR、SlFUL1WithSlRINWild type is obviously compared in expression of the gene in Br+3 period
It is high；And cell wall degradation related geneSlPGMuch higher than the expression in wild type.These results suggest thatPpIAAH1Base
Because the maturation of fruit may be adjusted by the expression of mature related gene and cell wall degradation related gene in regulation tomato.
The embodiment of the above, only presently preferred embodiments of the present invention, is only used to explain the present invention, not limit
The scope of the present invention processed to those of ordinary skill in the art certainly can be according to skill disclosed in this specification
Art content makes other embodiments easily by way of replacing or changing, therefore all made in the principle of the present invention
Changes and improvements etc., should be included in scope of the present invention patent.
SEQUENCE LISTING
<110>Zhengzhou Fruit-tree Inst., Chinese Agriculture Science Academy
<120>peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application
<130> 2019
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 1341
<212> DNA
<213>auxin amide hydrolysis enzyme gene PpIAAH1
<400> 1
atgggtttca atttcacttt ctccttgtgc ttcttgttat cactaaaagc tgcactcttt 60
catcaaactt gggctgaata tggatcagag ctcgagttct tgactcggga gttgctggaa 120
gcggcaagag atcccgagtt ctttgaatgg atgagagggt tgaggaggag aattcaccag 180
caccctgagc tgggatttga ggagcacagg acaagtgaac tcgtcaggtc cgagcttgac 240
tcactgggaa ttgagtacaa gtggcctgta gccaaaactg gggtggtggc ttctattggc 300
tctggctcta agcctgtctt tgctcttaga gctgacatgg atgccctccc tctgcaggaa 360
ttggtagact gggaatacaa gagcaagatt gatgggaaga tgcatgcttg tggtcatgat 420
tctcatgtag caatgctact tggagcagcc aagttgcttc aagacaaaag agatatgttg 480
aagggaactg tgaaactagt tttccagcct ggtgaggagg gttatgccgg tgcttaccat 540
atgttacaag atggtgtttt aaatgatatt gataccatct tgagtttaca tgttttgcca 600
tcagtgccta ctggtgccgt agcttcgagg cgtggtccaa tacttgctgg tgtagggctc 660
ttctcagcta caatacaagg gcaaggaggg catggagcat cccctcatca gacaagggac 720
ccaattcttg cagcagcctt gacaaccctt gctctccaac agattgtgtc tcgagagacc 780
gatccgcttg aatccagagt ggtaacagtt gggtatctac agggaggtca agcactaaat 840
gtgatcccag acagtgtgaa acttggggga acttttagga gcttgacttc tgagggcctc 900
tcatatctca aagaaaggat taaagagatc atagagcaac aagcagctgt gcatcgttgt 960
actgcggtgg tggacttcat ggaggacaga ccactgcctc atccaccaat gactaataat 1020
gacgcgctgt atgaacatgt gaagaaggtc ggcgaggtcc ttcttgggaa acctaatgtg 1080
cagcttctgc cactgacaat gggttcggag gatttcagct tcttctcgga gaagactgct 1140
gctgcaatct ttgttgttgg gataaagaat gagactctga aatcagaccg agacttgcac 1200
tcaccctact tttttatcga tgaggaggct cttccaatag gagcagcact tcatactgca 1260
gctgcaatct catacttgga tggccatgat gatgttaaca ctcagcagga acatggttcg 1320
ctctacaatt ctaatttcta g 1341
<210> 2
<211> 446
<212> PRT
<213>auxin amide hydrolysis enzyme gene PpIAAH1 encodes albumen
<400> 2
Met Gly Phe Asn Phe Thr Phe Ser Leu Cys Phe Leu Leu Ser Leu Lys
1 5 10 15
Ala Ala Leu Phe His Gln Thr Trp Ala Glu Tyr Gly Ser Glu Leu Glu
20 25 30
Phe Leu Thr Arg Glu Leu Leu Glu Ala Ala Arg Asp Pro Glu Phe Phe
35 40 45
Glu Trp Met Arg Gly Leu Arg Arg Arg Ile His Gln His Pro Glu Leu
50 55 60
Gly Phe Glu Glu His Arg Thr Ser Glu Leu Val Arg Ser Glu Leu Asp
65 70 75 80
Ser Leu Gly Ile Glu Tyr Lys Trp Pro Val Ala Lys Thr Gly Val Val
85 90 95
Ala Ser Ile Gly Ser Gly Ser Lys Pro Val Phe Ala Leu Arg Ala Asp
100 105 110
Met Asp Ala Leu Pro Leu Gln Glu Leu Val Asp Trp Glu Tyr Lys Ser
115 120 125
Lys Ile Asp Gly Lys Met His Ala Cys Gly His Asp Ser His Val Ala
130 135 140
Met Leu Leu Gly Ala Ala Lys Leu Leu Gln Asp Lys Arg Asp Met Leu
145 150 155 160
Lys Gly Thr Val Lys Leu Val Phe Gln Pro Gly Glu Glu Gly Tyr Ala
165 170 175
Gly Ala Tyr His Met Leu Gln Asp Gly Val Leu Asn Asp Ile Asp Thr
180 185 190
Ile Leu Ser Leu His Val Leu Pro Ser Val Pro Thr Gly Ala Val Ala
195 200 205
Ser Arg Arg Gly Pro Ile Leu Ala Gly Val Gly Leu Phe Ser Ala Thr
210 215 220
Ile Gln Gly Gln Gly Gly His Gly Ala Ser Pro His Gln Thr Arg Asp
225 230 235 240
Pro Ile Leu Ala Ala Ala Leu Thr Thr Leu Ala Leu Gln Gln Ile Val
245 250 255
Ser Arg Glu Thr Asp Pro Leu Glu Ser Arg Val Val Thr Val Gly Tyr
260 265 270
Leu Gln Gly Gly Gln Ala Leu Asn Val Ile Pro Asp Ser Val Lys Leu
275 280 285
Gly Gly Thr Phe Arg Ser Leu Thr Ser Glu Gly Leu Ser Tyr Leu Lys
290 295 300
Glu Arg Ile Lys Glu Ile Ile Glu Gln Gln Ala Ala Val His Arg Cys
305 310 315 320
Thr Ala Val Val Asp Phe Met Glu Asp Arg Pro Leu Pro His Pro Pro
325 330 335
Met Thr Asn Asn Asp Ala Leu Tyr Glu His Val Lys Lys Val Gly Glu
340 345 350
Val Leu Leu Gly Lys Pro Asn Val Gln Leu Leu Pro Leu Thr Met Gly
355 360 365
Ser Glu Asp Phe Ser Phe Phe Ser Glu Lys Thr Ala Ala Ala Ile Phe
370 375 380
Val Val Gly Ile Lys Asn Glu Thr Leu Lys Ser Asp Arg Asp Leu His
385 390 395 400
Ser Pro Tyr Phe Phe Ile Asp Glu Glu Ala Leu Pro Ile Gly Ala Ala
405 410 415
Leu His Thr Ala Ala Ala Ile Ser Tyr Leu Asp Gly His Asp Asp Val
420 425 430
Asn Thr Gln Gln Glu His Gly Ser Leu Tyr Asn Ser Asn Phe
435 440 445
<210> 3
<211> 19
<212> DNA
<213>forward direction IAAH1f
<400> 3
atgggtttca atttcactt 19
<210> 4
<211> 21
<212> DNA
<213>reversed IAAH1r
<400> 4
ctagaaatta gaattgtaga g 21
<210> 5
<211> 21
<212> DNA
<213>forward direction RTIAAH1f
<400> 5
tcttccaata ggagcagcac t 21
<210> 6
<211> 22
<212> DNA
<213>reversed RTIAAH1r
<400> 6
catttgtgct ttagtaagac gg 22
<210> 7
<211> 29
<212> DNA
<213> vIAAH1f
<400> 7
ggggacaagt ttgtacaaaa aagcaggct 29
<210> 8
<211> 29
<212> DNA
<213> vIAAH1r
<400> 8
ggggaccact ttgtacaaga aagctgggt 29
<210> 9
<211> 21
<212> DNA
<213> pK2GW7F
<400> 9
ttcttgttcc catttctctc t 21
<210> 10
<211> 21
<212> DNA
<213> pK2GW7R
<400> 10
agctggtcac ctgtaattca c 21
Claims (8)
1. peach auxin amide hydrolysis enzyme genePpIAAH1, which is characterized in that its sequence is as shown in SEQ ID NO:1.
2. peach auxin amide hydrolysis enzyme genePpIAAH1The albumen of coding, which is characterized in that its amino acid sequence such as SEQ ID
Shown in NO:2.
3. including peach auxin amide hydrolysis enzyme gene described in claim 1PpIAAH1Recombinant vector.
4. recombinant vector according to claim 3, which is characterized in that the recombinant vector is bacillus Expression carrier.
5. gene described in claim 1PpIAAH1, recombination described in albumen as claimed in claim 2 and claim 3 or 4
Application of the carrier in tomato breeding.
6. application according to claim 5, which is characterized in that the tomato breeding is to change tomato plant type, change tomato
Fruit shape promotes Fruit Ripening of Tomato.
7. application according to claim 6, which is characterized in that the change tomato fruit shape is to change tomato to grow fruit point.
8. according to the described in any item applications of claim 5 ~ 7, which is characterized in that the tomato breeding the following steps are included:
A: building contains peach auxin amide hydrolysis enzyme gene described in claim 1PpIAAH1Recombinant vector；
B: constructed recombinant vector is transformed into tomato tissue or cell；
C: it cultivates screening and obtains transgene tomato.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910272923.5A CN110004165A (en) | 2019-04-04 | 2019-04-04 | Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application |
| AU2020100459A AU2020100459A4 (en) | 2019-04-04 | 2020-03-25 | THE IAA-LEUCINE RESISTANT1-LIKE HYDROLASE GENE PpIAAH1 IN PEACH AND APPLICATIONS THEREOF |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910272923.5A CN110004165A (en) | 2019-04-04 | 2019-04-04 | Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110004165A true CN110004165A (en) | 2019-07-12 |
Family
ID=67170045
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910272923.5A Pending CN110004165A (en) | 2019-04-04 | 2019-04-04 | Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110004165A (en) |
| AU (1) | AU2020100459A4 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504663A (en) * | 2018-06-01 | 2018-09-07 | 中国农业科学院郑州果树研究所 | Originally response factor Ppa011935m genes and its application of peach auxin |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504663A (en) * | 2018-06-01 | 2018-09-07 | 中国农业科学院郑州果树研究所 | Originally response factor Ppa011935m genes and its application of peach auxin |
-
2019
- 2019-04-04 CN CN201910272923.5A patent/CN110004165A/en active Pending
-
2020
- 2020-03-25 AU AU2020100459A patent/AU2020100459A4/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504663A (en) * | 2018-06-01 | 2018-09-07 | 中国农业科学院郑州果树研究所 | Originally response factor Ppa011935m genes and its application of peach auxin |
Non-Patent Citations (3)
| Title |
|---|
| ACCESSION NO: XM_007202007.2: "PREDICTED: Prunus persica IAA-amino acid hydrolase ILR1 (LOC18771403), mRNA", 《GENBANK》 * |
| YIFENG DING等: "Over-expression of Peach PpIAA19 in Tomato Alters Plant Growth,Parthenocarpy, and Fruit Shape", 《JOURNAL OF PLANT GROWTH REGULATION》 * |
| 曾文芳等: "桃Aux/IAA家族基因鉴定及在果实成熟过程中的表达分析", 《园艺学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504663A (en) * | 2018-06-01 | 2018-09-07 | 中国农业科学院郑州果树研究所 | Originally response factor Ppa011935m genes and its application of peach auxin |
| CN108504663B (en) * | 2018-06-01 | 2021-08-13 | 中国农业科学院郑州果树研究所 | Peach auxin primary response factor Ppa011935m gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2020100459A4 (en) | 2020-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107987141B (en) | Application of corn nuclear factor gene ZmNF-YA1 in plant stress resistance modification | |
| CN112812163B (en) | Application of transcription factor in rice breeding and rice breeding method | |
| US20240263188A1 (en) | Application of bfne gene in tomato plant architecture improvement and biological yield increase | |
| CN104903444B (en) | Highly yielding ability nucleic acid, the method for preparing the increased genetically modified plants of yield, the method for increasing the yield of plant are assigned to plant | |
| CN110004154A (en) | The application of tea tree CsJAZ1 gene | |
| CN114457106A (en) | Application of tomato gene SlCIPK7 in regulation and control of plant drought resistance | |
| CN117965567B (en) | Application of cotton GhRV gene in negative control of verticillium resistance | |
| CN109112140A (en) | Application of the OsSN28 gene in control rice high temperature resistant | |
| CN109608530B (en) | Soybean low-phosphorus response gene for promoting lateral root formation, protein and application thereof | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
| CN109748960A (en) | Regulate and control gene and its application of aluminum-resistant poison transcription factor STOP1 albumen | |
| CN109880830A (en) | Peach polypeptide hormone synthesizes gene PpRGF1 and its application | |
| CN110004165A (en) | Peach auxin amide hydrolysis enzyme gene PpIAAH1 and its application | |
| CN108504663A (en) | Originally response factor Ppa011935m genes and its application of peach auxin | |
| CN112852862B (en) | Application of arabidopsis small peptide signal molecule RGF7 gene | |
| CN114480417A (en) | Gene ZmSAG39 for regulating and controlling leaf senescence, encoding protein and application thereof | |
| CN113913456A (en) | Method for improving resistance of tomatoes to meloidogyne incognita | |
| CN109880831A (en) | Originally response factor PpIAA1 gene and its application of peach auxin | |
| US20170067071A1 (en) | Corn genes zmspl1 and zmspl2 and uses thereof | |
| CN109988229A (en) | Wax plum CpFT gene and its application | |
| CN115010796B (en) | Laiyte auxin output vector, and coding gene and application thereof | |
| WO2021040011A1 (en) | Fruit-bearing plant exhibiting high temperature resistance, high yield, and parthenocarpy | |
| CN106636130B (en) | Control BrVQ3-1 gene and its application of Chinese Cabbage | |
| CN105296533B (en) | Arabidopsis vitamin B1 synthase gene AtTHI1 plant growth and development and it is drought-resistant in application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190712 |