CN109988854A

CN109988854A - For detecting oligonucleotide combinatorial, method and the kit of pathogenic Bao Te bacillus

Info

Publication number: CN109988854A
Application number: CN201910388786.1A
Authority: CN
Inventors: 戴立忠; 邓中平; 范文洲; 纪博知; 赖之洲; 汤睿
Original assignee: Sansure Biotech Inc
Current assignee: Sansure Biotech Inc
Priority date: 2019-05-10
Filing date: 2019-05-10
Publication date: 2019-07-09

Abstract

The present invention relates to molecules field of biological detection, more particularly to Bao Te bacillus detection field.The present invention provides a kind of purposes of oligonucleotide combinatorial in the kit of preparation detection Bao Te bacillus, it can specifically detect one of pertussis Bao Te bacillus, parapertussis Bao Te bacillus, Huo Shi Bao Te bacillus and bronchus sepsis Bao Te bacillus or more, at the same time, the present invention also provides the oligonucleotide combinatorial, the kit comprising the oligonucleotide combinatorial and the methods for identifying Bao Te bacillus.

Description

Oligonucleotide combination, method and kit for detecting pathogenic bordetella

Technical Field

The invention belongs to the field of molecular biological detection, and more particularly belongs to the field of identification of bordetella.

Background

The bordetella is gram-negative coccobacillus without spores, some strains have flagella, smooth strains have capsules, and the bordetella is obligate aerobic bacteria, the optimal growth temperature is 35-37 ℃, the optimal pH is 6.8-7.0, and the nutrition requirement is higher.

The bauxites includes 7 strains, namely, bordetella pertussis (b.pertussis), bordetella parapertussis (b.parapertussis), bordetella bronchiseptica (b.branchiseptica), bordetella avium (b.avium), bordetella euphoria (b.hinzii), bordetella holsteri (b.holmesis) and bordetella atratum (b.trematum). The Bordetella pertussis can cause severe acute respiratory infectious disease pertussis (pertussis), has strong infectivity, is generally susceptible to people, is especially common to infants, and is one of main infectious diseases seriously threatening human health; bordetella parapertussis is similar to symptoms caused by Bordetella pertussis, but is relatively mild; the bordetella hollisae is a disease which can cause septicemia, myocarditis and respiratory diseases, and is particularly easy to infect patients with immunodeficiency (such as patients with immune insufficiency and AIDS). However, the bordetella bronchiseptica generally infects animals, but in few cases it can also infect humans, and sepsis, meningitis, pneumonia, etc. are caused after infection, and are easily confused with other symptoms of bacterial infection, so that detection of the bordetella bronchiseptica is easily missed clinically.

Currently, bacteriology, serology and PCR technology are mainly used for detecting the Bordetella. The bacteriological detection experiment period is too long, the sensitivity is low and is only 15% -30%, and the method is not easy to standardize; therefore, it is only suitable for early diagnosis of the disease course and far from meeting clinical requirements. The serological detection sensitivity is not high, certain false positive exists, the operation is more complicated, and the requirement on operators is higher.

PCR detection, particularly fluorescent quantitative PCR detection, is a nucleic acid detection technology which is developed rapidly in recent years, and has the advantages of good specificity, high sensitivity and short experimental period. Chinese patent publication CN 109153699a discloses a method for detecting bordetella pertussis, bordetella parapertussis, and bordetella hollisae by three pairs of primers. Since three pairs of primers are required, the operation of detection is more complicated and the detection cost is inevitably increased. In addition, U.S. patent publication No. 2010/0221715a1 also discloses a composition for detecting bordetella pertussis, bordetella parapertussis, and bordetella hollisa, including two pairs of primers, capable of detecting the presence of bordetella pertussis, bordetella parapertussis, and bordetella hollisa, but not other bordetella, such as bordetella bronchiseptica.

Therefore, there is a strong need in the art for highly sensitive reagents that detect as many bordetella as possible using as few primers as possible.

Disclosure of Invention

In view of this, in a first aspect, the present invention provides a use of an oligonucleotide combination for the preparation of a kit for detecting bordetella pertussis, which is one or more selected from the group consisting of bordetella pertussis, bordetella parapertussis, bordetella hollisae, and bordetella bronchiseptica, the oligonucleotide combination comprising:

a first upstream primer, a first downstream primer, a first probe, a second upstream primer, a second downstream primer, and a second probe.

In one embodiment, the first upstream primer has the sequence shown in SEQ ID NO. 1, the first downstream primer has the sequence shown in SEQ ID NO. 2, the first probe has the sequence shown in SEQ ID NO. 3, the second upstream primer has the sequence shown in SEQ ID NO. 4, the second downstream primer has the sequence shown in SEQ ID NO. 5, and the second probe has the sequence shown in SEQ ID NO. 6.

In another embodiment, the first upstream primer has the sequence shown in SEQ ID NO. 10, the first downstream primer has the sequence shown in SEQ ID NO. 11, the first probe has the sequence shown in SEQ ID NO. 12, the second upstream primer has the sequence shown in SEQ ID NO. 4, the second downstream primer has the sequence shown in SEQ ID NO. 13, and the second probe has the sequence shown in SEQ ID NO. 6.

By using the oligonucleotide combination, one or more of Bordetella pertussis, Bordetella bronchiseptica, Bordetella parapertussis and Bordetella hoponensis existing in a sample can be simultaneously detected, so that whether a subject is infected with Bordetella pertussis, Bordetella bronchiseptica, Bordetella parapertussis or Bordetella hoponensis and whether composite infection exists can be judged.

Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica are the accepted 3 kinds of bacteria in the genus Bordetella that are considered to be harmful to human beings; in addition, recently published documents show: bauer holsterium causes similar symptoms to those of bordetella pertussis. Therefore, if the 4 kinds of bordetella can be detected simultaneously, the coverage area is wider, and detection omission is not easy to occur; at the same time, the method also means that the common bordetella infecting the human is comprehensively detected. On the other hand, the oligonucleotide set for detection of the present invention may include only two sets of primer and probe sets, thereby making the operation easier and saving the cost.

In a preferred embodiment, the oligonucleotide combination of the present invention further comprises: oligonucleotide combinations for detection as internal standard. Specifically, the oligonucleotide combination used for internal standard detection may include an internal standard upstream primer, an internal standard downstream primer and an internal standard probe.

In one embodiment, the internal standard upstream primer has a sequence shown in SEQ ID NO. 7, the internal standard downstream primer has a sequence shown in SEQ ID NO. 8, and the internal standard probe has a sequence shown in SEQ ID NO. 9.

In another embodiment, the internal standard upstream primer has the sequence shown in SEQ ID NO. 14, the internal standard downstream primer has the sequence shown in SEQ ID NO. 15, and the internal standard probe has the sequence shown in SEQ ID NO. 16.

That is, the oligonucleotide combination of the present invention may further comprise an internal standard primer as well as an internal standard probe. It can be used in combination with other primers and probes in the oligonucleotide combination of the invention without affecting each other. The use of the internal standard primer and the probe can judge whether the detection is effective or not, and further ensure the detection accuracy of the oligonucleotide combination.

In the present invention, the oligonucleotide combination may carry a fluorescent reporter and quencher for real-time fluorescent PCR detection.

In some embodiments, the fluorescent reporter groups on the first and second probes in the oligonucleotide combinations of the invention may be selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3, and JOE without interfering with each other. Preferably, the fluorescent reporter group of the first probe and the fluorescent reporter group of the second probe are FAM, and the fluorescent reporter group of the internal standard probe is HEX.

In some embodiments, the fluorescence quenching groups on the first probe and the second probe in the oligonucleotide combinations of the invention may be selected from BHQ0, BHQ1, BHQ2, BHQ3, MGB- λ, Dabcyl- λ, TAMRA without interfering with each other. Preferably, the fluorescence quenching group of the first probe, the second probe and the internal standard probe is BHQ 1.

In a second aspect, the present invention also provides an oligonucleotide combination comprising:

a first upstream primer: 5'-TGGTGCGCTACGAGCATCA-3' (SEQ ID NO:1),

first downstream primer: 5'-GGATGTCGGTGAAGGCCAC-3' (SEQ ID NO:2),

a first probe: 5'-ACCGACGCGATACCGTTGAGGGG-3' (SEQ ID NO:3),

a second upstream primer: 5'-CCGCTGCTGACGGTCTATGT-3' (SEQ ID NO:4),

a second downstream primer: 5'-GCAAGACAAGCCTGGAACCAC-3' (SEQ ID NO:5), and

a second probe: 5'-CTGCGTGACGAACTCAAACGGCTCT-3' (SEQ ID NO: 6);

or,

a first upstream primer: 5'-CTGCTGCACATCGACATCAAGA-3' (SEQ ID NO:10),

first downstream primer: 5'-CAACGGTATCGCGTCGGTT-3' (SEQ ID NO:11),

a first probe: 5'-CTGGGACGTATCCAGCGCCCT-3' (SEQ ID NO:12),

a second upstream primer: 5'-CCGCTGCTGACGGTCTATGT-3' (SEQ ID NO:4),

a second downstream primer: 5'-CCGCTTGATGACCTTGATAGTG-3' (SEQ ID NO:13), and

a second probe: 5'-CTGCGTGACGAACTCAAACGGCTCT-3' (SEQ ID NO: 6).

In a preferred embodiment, the oligonucleotide combination further comprises:

an internal standard upstream primer: 5'-GACTCTCTCTGCCTATTGGTCTATT-3' (SEQ ID NO:7),

internal standard downstream primer: 5'-CCCATAACAGCATCAGGAGTG-3' (SEQ ID NO:8), and

internal standard probe: 5'-CAGATCCCCAAAGGACTCAAAGAACC-3' (SEQ ID NO: 9);

or,

an internal standard upstream primer: 5'-GTCAACGGATTTGGTCGTAT-3' (SEQ ID NO:14),

internal standard downstream primer: 5'-TCCATTGATGACAAGCTTCC-3' (SEQ ID NO:15), and

internal standard probe: 5'-CACCAGGGCTGCTTTTAACTCTGGTAAAGT-3' (SEQ ID NO: 16).

In a third aspect, the present invention provides a kit comprising a combination of oligonucleotides as described above.

Further, the kit may also include reagents required for DNA extraction, other reagents for real-time fluorescent PCR amplification, such as Mg²⁺At least one of dNTPs, DNA polymerase, PCR buffer, etc.

In a fourth aspect, the invention also provides the application of the kit in detecting the bordetella.

In one embodiment, the bordetella is one or more selected from the group consisting of bordetella pertussis, bordetella parapertussis, bordetella hollisae, and bordetella bronchiseptica.

In a fifth aspect, the present invention provides a method for detecting bordetella, the method comprising the steps of:

1) extracting DNA of a sample to be detected;

2) carrying out fluorescent quantitative PCR detection on the DNA obtained in the step 1) by using the oligonucleotide combination or the kit of the invention;

3) and (6) analyzing the result.

In the present invention, the sample for detection may be a respiratory nasopharyngeal swab sample, a pharyngeal swab, a sputum sample, an alveolar lavage fluid, or the like, but is not limited thereto.

In a specific embodiment, in said step 3), Ct value is used as a determination criterion. Samples with a detection channel Ct value of 38 or less and an internal standard channel positive (Ct value of 40 or less) were reported as infected with one or more bacteria of Bordetella pertussis, Bordetella bronchiseptica, Bordetella hollisae, and Bordetella parapertussis.

In a specific embodiment, the combination of oligonucleotides in step 2) has the following concentrations: 0.1-1 μ M of a first forward primer, a first downstream primer, a first probe, a second forward primer, a second downstream primer, and a second probe; 0.1-0.5 μ M of an internal standard primer; 0.02-0.2. mu.M internal standard probe. Preferably, the oligonucleotide combinations in step 2) have the following concentrations: 0.5. mu.M of a first forward primer, a first downstream primer, a first probe, a second forward primer, a second downstream primer and a second probe; 0.25 μ M of an internal standard primer; 0.1. mu.M of internal standard probe.

Further, the step 2) also comprises the following components and concentrations:

in a specific embodiment, the fluorescent quantitative PCR reaction in step 2) is as follows:

the invention has the beneficial effects that: the kit can simultaneously detect four bacteria of Bordetella pertussis, Bordetella bronchiseptica, Bordetella parapertussis and Bordetella hollisae by only combining two primers and probes, and has more convenient operation and lower cost; meanwhile, the invention has high sensitivity and does not generate cross reaction with nucleic acid of non-target bacteria.

In addition, suspected Botrytis infection usually has symptoms of cough and increased white blood cells, so that the test is usually treated by antibiotics before the test, and the oligonucleotide combination of the invention is not influenced by the antibiotics in the sample and can be accurately tested.

Drawings

FIG. 1 shows the results of amplifying a sample to be tested using the oligonucleotide combinations shown in Table 1;

FIG. 2 is a sequence alignment chart of a sample with a positive detection result;

FIG. 3 shows the sensitivity results of amplification of samples using the oligonucleotide combinations in Table 1;

FIG. 4 shows the specificity of amplification of samples using the oligonucleotide combinations of Table 1;

FIG. 5 is a control panel of the interference-free experiment using the oligonucleotide combinations in Table 1 (no interference addition);

FIG. 6 is a graph of anti-interference experiments using the oligonucleotide combinations in Table 1 (interferents added);

FIG. 7 shows the results of a control experiment using a portion of the oligonucleotides of Table 9 in place of the oligonucleotides of Table 1;

FIG. 8 shows the results of amplifying a sample to be tested using the oligonucleotide combinations shown in Table 2;

FIG. 9 shows the specificity results of amplification of samples using the oligonucleotide combinations of Table 2;

FIG. 10 is a graph of sensitivity results for samples amplified using the oligonucleotide combinations of Table 2;

FIG. 11 is a graph of anti-interference experiments using the oligonucleotide combinations in Table 2 (interferents added);

FIG. 12 is a control panel of interference-free experiments using the oligonucleotide combinations in Table 2 (no interference addition).

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Example 1 primers and probes used in the present invention

Primers and fluorescent probes were designed for specific gene sequences (repetitive insertion sequences IS481 and IS1001) of bordetella pertussis, bordetella bronchiseptica, bordetella parapertussis, and bordetella hollisa, and specific sequences of the primers and probes are shown in tables 1 and 2 below.

TABLE 1

TABLE 2

Wherein, F and R are a forward primer pair and a reverse primer pair of the amplification primer, IC-F and IC-R are an internal standard primer pair, and P is a detection probe.

Example 2 detection procedure

1. Preparation of reagents:

1.1, taking out each component in the kit, standing at room temperature, balancing the temperature to room temperature, and uniformly mixing for later use;

1.2, according to the number of samples to be detected, negative control, positive control and quantitative reference products, taking PCR reaction liquid and enzyme mixed liquid in corresponding amount according to the proportion (38 mu L/part of PCR reaction liquid and 2 mu L/part of enzyme mixed liquid), fully and uniformly mixing to obtain PCR mixed liquid, centrifuging at 2000rpm for 10 seconds, and keeping out of the sun at 4 ℃ for standby.

2. Sample, quality control, quantitative reference treatment and sample application (in the sample treatment zone)

2.1 pretreatment of samples and quality control products

2.1.1, sample to be tested: adding 1ml of sterile normal saline into a sample collecting pipe, fully oscillating and uniformly mixing, pouring all liquid (sample eluent) into a 1.5ml of sterilized centrifuge tube (a cotton swab is squeezed by the wall of the centrifuge tube and then discarded), sucking 20-50 mu l of the liquid into another 1.5ml of sterilized centrifuge tube after instantaneous centrifugation, adding 20-50 mu l of a nucleic acid releasing agent, and fully and uniformly mixing the liquid to be used as a sample to be detected for later use.

2.1.2, respectively taking 20-50 mul of negative control and positive control, and uniformly mixing with 20-50 mul of nucleic acid releasing agent for later use.

2.2 adding sample (negative control, positive control and sample to be detected synchronous processing)

2.2.1, adding the processed sample to be detected, the negative control and the positive control into each PCR reaction tube by 4-10 mul respectively.

2.2.2, standing for 10 minutes at room temperature, and respectively adding 40 mu l of the prepared PCR-mix into reaction tubes of the sample to be detected, the negative control, the positive control and the quantitative reference substance.

3. Fluorescent PCR reaction (carried out on a fluorescent quantitative PCR amplification apparatus)

1) And (3) placing the PCR reaction tube into a sample groove of an amplification instrument, and setting the name of the sample to be detected and the concentration of the quantitative reference substance according to the corresponding sequence.

2) Fluorescence detection channel selection: selecting FAM channel (report: FAM, Quencher: None) to detect Bordetella pertussis, Bordetella bronchiseptica, Bordetella hollisae, Bordetella parapertussis DNA; selecting HEX or VIC channel (Reporter: VIC, Quencher: None) internal standard for detection; the Reference fluorescence (Passive Reference) was set at ROX.

3) The fluorescent quantitative PCR reaction conditions are as follows:

example 3 analysis of Experimental results

After the PCR amplification reaction is finished, the instrument automatically stores the results, 24 samples are tested in the experiment, 14 of the samples are positive, the experiment result of amplification by using the primers shown in Table 1 is shown in FIG. 1, and the experiment result of amplification by using the primers shown in Table 2 is shown in FIG. 8. In order to verify the accuracy of the result, the positive samples are sent to be sequenced, the sequencing results of 14 sequences obtained by sequencing are all positive and are consistent with the positive results detected by the detection method, the sequencing results are shown in fig. 2 (wherein the first sequence is a reference sequence, and the last fourteen sequences are the sequencing results of the positive samples), all the samples which are detected to be positive can be seen, the sequencing results are all positive, the samples which are detected to be negative can be seen, and the sequencing results are also indicated to be negative. The automatic analysis can be performed by using the software of the instrument (or the initial value, the final value and the threshold line value of the base line can be manually adjusted for analysis), and then the Ct value and the fixed value result of the sample are recorded. The intersection of the amplification curve and the threshold line is called Ct (cyclethreshold, which refers to the number of cycles that the fluorescence signal in the PCR reaction tube has undergone when it reaches a set threshold); for the sample with the FAM Ct value of the measurement channel less than or equal to 38, the sample is reported to be infected by one or more bacteria in Bordetella pertussis, Bordetella bronchiseptica, Bordetella hollisae and Bordetella parapertussis; when the FAM Ct value of the detection channel is more than 38 or no display is carried out, the internal standard is detected to be positive (the Ct value is less than or equal to 40), and the result is reported to be negative to the Botrytis DNA. If the Ct value of the internal standard is greater than 38 or is not shown, the detection result of the sample is invalid, the reason should be searched and eliminated, and the sample is subjected to repeated tests. For samples with a Ct value >38, the internal standard was detected as positive (Ct value ≤ 40) and reported to be below the lower detection limit. If the Ct value of the internal standard is greater than 40 or is not shown, the detection result of the sample is invalid, the reason should be searched and eliminated, and the sample is subjected to repeated tests. And each experiment should meet the following requirements in quality control, and the experimental result is reliable.

Quality control:

1) negative control: the FAM detection channel has no fluorescent signal increase and no obvious S-shaped amplification curve;

2) positive control: FAM and HEX detection channels have obvious S-shaped amplification curves, and the detection Ct value is less than 35;

3) the above requirements need to be met simultaneously in the same experiment, otherwise, the experiment is invalid and needs to be carried out again.

Example 4 sensitivity detection and analysis

Selecting 9 sample DNAs which are detected to be positive in the above example 3, diluting the sample DNAs to be 100, 200, 400, 4000 and 40000 copies/mL respectively, taking 5 μ L of each gradient as an amplification template, amplifying and detecting the sample DNAs according to the method described in the example 2 by using the oligonucleotide combination described in the table 1 in the example 1, performing three-batch experiments on each gradient, wherein the result is shown in the table 3-1, and detecting the sample DNAs with 400 copies/mL for 20 times repeatedly, and verifying that the lowest detection limit of the kit is shown in the figure 3; the oligonucleotide combinations described in Table 2 were amplified and retested as described in example 2, three batches of experiments were performed for each gradient, the results are shown in tables 3-2, and the assay was repeated 20 times at 400 copies/mL, verifying that the lowest detection limit results of the kit are shown in FIG. 9.

The result shows that the method has high sensitivity, and the detection concentration can be as low as 400 copies/mL.

TABLE 3-1

Concentration (copy/mL)	Three-batch detection	Detection rate
			4.00E+04	9/9	100％
4.00E+03	9/9	100％
			4.00E+02	9/9	100％
2.00E+02	3/9	33.33％
			1.00E+02	4/9	44.44％

TABLE 3-2

Concentration (copy/mL)	Three-batch detection	Detection rate
			4.00E+04	9/9	100％
4.00E+03	9/9	100％
			4.00E+02	9/9	100％
2.00E+02	4/9	44.44％
			1.00E+02	2/9	22.22％

Example 5 specificity detection and analysis

The DNA of respiratory syncytial virus, respiratory adenovirus, influenza A virus, influenza B virus, mycoplasma pneumoniae and chlamydia pneumoniae is selected as a template, the oligonucleotide combinations of the table 1 and the table 2 of the example 1 are adopted, the selected DNA is respectively amplified according to the amplification process shown in the example 3, and then the detection is carried out, and the result is shown in the figure 4 and the figure 10, and the oligonucleotide combination of the example 1 can not amplify a band, thereby proving that the oligonucleotide combination of the example 1 can specifically amplify the corresponding mycobacteria.

Example 6 antibiotic interference detection

Azithromycin, penicillin sodium, clarithromycin, cefmenoxime hydrochloride, erythromycin and compound sulfamethoxazole tablets with the concentrations shown in the following table 4 are added into a sample, the oligonucleotide combination shown in the table 1 in the example 1 is used for amplification detection, the results are shown in the table 6 and the figure 6, meanwhile, the same sample without the medicine is subjected to amplification detection under the same conditions for comparison, the results are shown in the table 5 and the figure 5, and the experimental results show that the amplification curve and the Ct value have no significant difference, which shows that the medicine cannot influence the oligonucleotide combination of the invention.

TABLE 4

Numbering	Interfering substances	Concentration of
			1	Azithromycin	50mg/L
2	Penicillin sodium	250mg/L
			3	Clarithromycin	40μg/mL
4	Cefmenoxime hydrochloride	250mg/L
			5	Erythromycin	40μg/mL
6	Compound sulfamethoxazole tablet	250mg/L

The reagent is used for detecting a control sample in the same instrument, the detection is repeated for 24 times, the Ct value of the detection result is counted, and a 95% confidence interval (Mean +/-1.96 SD) is calculated, and the statistics of the detection result are shown in the following table 5:

TABLE 5 results of sample detection without added interfering substances

The interference samples were tested on the same SLAN 96P instrument, each sample was tested 3 times, the mean value was counted, the difference in Ct values from the control samples was calculated, and the test results are shown in Table 6 below:

TABLE 6

Azithromycin, penicillin sodium, clarithromycin, cefmenoxime hydrochloride, erythromycin and compound sulfamethoxazole tablets with the concentrations shown in the table 4 are added into the sample, the oligonucleotide combination shown in the table 2 in the example 1 is used for amplification detection, the results are shown in the table 8 and the figure 11, the same sample without the medicine is subjected to amplification detection under the same conditions for comparison, the results are shown in the table 7 and the figure 12, and the experimental result shows that the amplification curve and the Ct value have no significant difference, which shows that the medicine cannot influence the oligonucleotide combination of the invention.

The reagent is used for detecting a control sample in the same instrument, the detection is repeated for 24 times, the Ct value of the detection result is counted, and a 95% confidence interval (Mean +/-1.96 SD) is calculated, and the statistics of the detection result are shown in the following table 7:

TABLE 7 results of sample detection without added interfering substances

The interference samples were tested on the same ABI7500 instrument, each sample was tested 3 times, the mean value was counted, the difference in Ct value from the control sample was calculated, and the test results are shown in Table 8 below:

TABLE 8

Comparative example 1

In fact, in order to simultaneously realize effective detection of four kinds of bordetella pertussis, bordetella bronchiseptica, bordetella parapertussis, and bordetella hollisa, a large number of primers and probes were designed in the development process of the present invention, some of which are exemplarily listed in table 9.

TABLE 9

Primers or probes	Sequence (5'→ 3')
		IS481-F3(SEQ ID NO:17)	ATGCCCGATTGACCTTCCT
IS481-R3(SEQ ID NO:18)	AGCGGCCCAGCCATTT
		IS481-P3(SEQ ID NO:19)	CGTCGACTCGAAATGGTCCAGCA
IS481-F4(SEQ ID NO:20)	GCCATGAGCTGGGCATCA
		IS481-R4(SEQ ID NO:21)	GGCATCGGCTCGGTGTT
IS481-P4(SEQ ID NO:22)	CACCGCTTTACCCGACCTTACCG
		IS481-F5(SEQ ID NO:23)	GGCATCAAGCACCGCTTTAC
IS481-R5(SEQ ID NO:24)	GGCTCGGTGTTGGGAGTTCT
		IS481-P5(SEQ ID NO:25)	CGACCTTACCGCCCACAGACCAA
IS1001-F3(SEQ ID NO:4)	CCGCTGCTGACGGTCTATGT
		IS1001-R3(SEQ ID NO:26)	GTGGTTCCAGGCTTGTCTTGC
IS1001-F4(SEQ ID NO:4)	CCGCTGCTGACGGTCTATGT
		IS1001-R4(SEQ ID NO:27)	CGGCTATTCCGCTTTGCT
IS1001-F5(SEQ ID NO:28)	GCGGAGATCGTCTATGACTTGTT
		IS1001-R5(SEQ ID NO:26)	GTGGTTCCAGGCTTGTCTTGC

Similar design considerations as in example 1 were used for these primers and probes. However, the primers in Table 9 have unsatisfactory effect when replacing a part of the primers in tables 1 and 2, and have problems of missed detection, low sensitivity, poor curve and the like. For example, as shown in FIG. 7, in total 8 positive samples, only 5 positive samples could be detected after replacing the corresponding primers in Table 1 or 2 with the primers IS481-F3/R3/P3 and IS1001-F3/R3 in Table 9.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> Hunan Shengxiang Biotechnology Ltd

<120> oligonucleotide combination, method and kit for detecting pathogenic Bordetella

<160>28

<170>PatentIn version 3.5

<210>1

<211>19

<212>DNA

<213> Artificial sequence

<400>1

tggtgcgcta cgagcatca 19

<210>2

<211>19

<212>DNA

<213> Artificial sequence

<400>2

ggatgtcggt gaaggccac 19

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

accgacgcga taccgttgag ggg 23

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

ccgctgctga cggtctatgt 20

<210>5

<211>21

<212>DNA

<213> Artificial sequence

<400>5

gcaagacaag cctggaacca c 21

<210>6

<211>25

<212>DNA

<213> Artificial sequence

<400>6

ctgcgtgacg aactcaaacg gctct 25

<210>7

<211>25

<212>DNA

<213> Artificial sequence

<400>7

gactctctct gcctattggt ctatt 25

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<400>8

cccataacag catcaggagt g 21

<210>9

<211>26

<212>DNA

<213> Artificial sequence

<400>9

cagatcccca aaggactcaa agaacc 26

<210>10

<211>22

<212>DNA

<213> Artificial sequence

<400>10

ctgctgcaca tcgacatcaa ga 22

<210>11

<211>19

<212>DNA

<213> Artificial sequence

<400>11

caacggtatc gcgtcggtt 19

<210>12

<211>21

<212>DNA

<213> Artificial sequence

<400>12

ctgggacgta tccagcgccc t 21

<210>13

<211>22

<212>DNA

<213> Artificial sequence

<400>13

ccgcttgatg accttgatag tg 22

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<400>14

gtcaacggat ttggtcgtat 20

<210>15

<211>20

<212>DNA

<213> Artificial sequence

<400>15

tccattgatg acaagcttcc 20

<210>16

<211>30

<212>DNA

<213> Artificial sequence

<400>16

caccagggct gcttttaact ctggtaaagt 30

<210>17

<211>19

<212>DNA

<213> Artificial sequence

<400>17

atgcccgatt gaccttcct 19

<210>18

<211>16

<212>DNA

<213> Artificial sequence

<400>18

agcggcccag ccattt 16

<210>19

<211>23

<212>DNA

<213> Artificial sequence

<400>19

cgtcgactcg aaatggtcca gca 23

<210>20

<211>18

<212>DNA

<213> Artificial sequence

<400>20

gccatgagct gggcatca 18

<210>21

<211>17

<212>DNA

<213> Artificial sequence

<400>21

ggcatcggct cggtgtt 17

<210>22

<211>23

<212>DNA

<213> Artificial sequence

<400>22

caccgcttta cccgacctta ccg 23

<210>23

<211>20

<212>DNA

<213> Artificial sequence

<400>23

ggcatcaagc accgctttac 20

<210>24

<211>20

<212>DNA

<213> Artificial sequence

<400>24

ggctcggtgt tgggagttct 20

<210>25

<211>23

<212>DNA

<213> Artificial sequence

<400>25

cgaccttacc gcccacagac caa 23

<210>26

<211>21

<212>DNA

<213> Artificial sequence

<400>26

gtggttccag gcttgtcttg c 21

<210>27

<211>18

<212>DNA

<213> Artificial sequence

<400>27

cggctattcc gctttgct 18

<210>28

<211>23

<212>DNA

<213> Artificial sequence

<400>28

gcggagatcg tctatgactt gtt 23

Claims

1. Use of a combination of oligonucleotides in the preparation of a kit for the detection of bordetella pertussis, one or more selected from the group consisting of bordetella pertussis, bordetella parapertussis, bordetella hollisae and bordetella bronchiseptica, said combination of oligonucleotides comprising: oligonucleotides represented by SEQ ID NOS 1 to 6.

2. The use of claim 1, wherein the combination of oligonucleotides further comprises:

oligonucleotides represented by SEQ ID NOS 7 to 9.

3. The use according to claim 1 or 2, wherein the fluorescent reporter groups of the oligonucleotide combinations are selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 and JOE without interfering with each other.

4. The use of claim 3, wherein the fluorescent reporter groups of SEQ ID NO 3 and 6 in the oligonucleotide combination are the same; preferably, the fluorescent reporter group of SEQ ID NO 3 and 6 is FAM and the fluorescent reporter group of SEQ ID NO 9 is HEX.

5. An oligonucleotide combination, said oligonucleotide combination comprising:

oligonucleotides represented by SEQ ID NOS 1 to 6.

6. The oligonucleotide combination of claim 5 wherein said oligonucleotide combination further comprises:

oligonucleotides represented by SEQ ID NOS 7 to 9.

7. A kit comprising the oligonucleotide combination of claim 5 or 6.

8. The kit according to claim 7, wherein the kit further comprises reagents required for DNA extraction, Mg²⁺At least one of dNTPs, DNA polymerase and PCR buffer.

9. A method for detecting bordetella, the method comprising the steps of:

1) extracting DNA of a sample to be detected;

2) performing fluorescent quantitative PCR on the DNA obtained in step 1) using the oligonucleotide combination of claim 5 or 6 or the kit of claim 7 or 8;

3) and (6) analyzing the result.

10. The method of claim 9, wherein the concentration of the combination of oligonucleotides in step 2) is represented by: