CN109988714A

CN109988714A - A kind of novel trichoderma and its application

Info

Publication number: CN109988714A
Application number: CN201711477699.0A
Authority: CN
Inventors: 许丽红; 刘艳萍; 王华明
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2017-12-29
Filing date: 2017-12-29
Publication date: 2019-07-09
Anticipated expiration: 2037-12-29
Also published as: CN109988714B; WO2019128454A1

Abstract

The present invention relates to gene engineering technology field, a kind of novel trichoderma host and its application are specifically provided.The deposit number of the trichoderma is CCTCC NO:M2016796, can be used for that effective expression is one or more endogenous or foreign protein, significant effect.

Description

A kind of novel trichoderma and its application

Technical field

The present invention relates to gene engineering technology fields, and in particular to a kind of novel trichoderma expressive host and its outer in expression Application in source protein.

Background technique

With the development of technique for gene engineering, to 20th century middle and later periods people using genetic engineering method to microorganism into Transformation is gone, our this quasi-microorganism is referred to as that genetic engineering bacterium is also referred to as transgenic engineered bacteria.Since microorganism has conversion effect Rate is high, breeding is fast, be easy culture, therefore genetic engineering bacterium is widely used easily controllable feature, Research Prospects Also very wide.The building of genetic engineering bacterium includes the building of optimum expression carrier, the selection of Suitable host cells, conversion, sieve Choosing identification and genetic stability, which obtain plasmid, can stablize the processes such as heredity, high efficient expression transgenic engineered bacteria.

Enzyme can be applied to multiple fields as biocatalyst, and yield, yield, quality and the function of enzyme are that enzyme is applied to work Important determinant in industry.The high efficient expression of enzyme is related to Multiple factors: the cell growth characteristics of host, expression, born of the same parents Interior/extracellular expression mode, posttranslational modification, activated protein etc..In order to realize the high efficient expression of enzyme, the selection of expression of enzymes system is extremely It closes important.The recombinase successful expression in multiple hosts, such as Escherichia coli, bacillus, yeast, filamentous fungi.

In the system of expression recombinant protein, Escherichia coli are most clear since its hereditary capacity and physiology behavior solve Chu is widely used as expressive host.The gene engineering product currently having been commercialized is by Bacillus coli expression, most mostly Prominent advantage is simple process, yield is high, the period is short, production cost is low, and the level of expression alien gene product is much higher than it Its gene engineering expression system.But there is also apparent defects for the system, such as the protein given expression to lacks glycosylation, phosphoric acid The posttranslational modifications such as change, cause the protein of certain eukaryotic sources that can not work orderly；Height expression causes protein aggregation, Inclusion body is formed, causes expression product without activity；In addition, the endotoxin contained in expression product doped with Escherichia coli itself Or proteins toxic, it is restricted it in medical applications.

Bacillus is due to growth is rapid, condition of culture is simple, genetic background understanding is more visible by wide as expressive host General application.Bacillus has good fermentation basis and production technology, can grow into relatively simple culture medium Very high density.The cell wall composition of bacillus is simple, after secretory protein is across cell membrane, is just processed and directly release Into culture medium.In addition, will not be contaminated in the protein product of secreted from bacillus similar gram-negative bacteria cell wall at The substances such as the pyrogenicity lipopolysaccharides in point, so that the purifying of destination protein is relatively simple.In addition, most bacillus No pathogenicity possesses a set of efficient secretion signal skin and chaperone systems, imparts bacillus efficient secretion purpose The ability of albumen, and in most cases, it is natural that the recombinant protein of the eukaryotic source of secreted from bacillus can have it Conformation and bioactivity.

Yeast is a kind of unicellular low eukaryotic microorganisms, has the advantages that uniqueness as representation aids, yeast can compared with Growth in wide range；Expression product can carry out posttranslational modification；Secretion type expression can be carried out, it is pure conducive to the separation of albumen Change；High density fermentation can be carried out, the needs of industrialized production are adapted to；Strain is widely used in wine brewing and food work for a long time Industry, securely and reliably.Yeast expression system advantage is modification (as glycosylated), high heat tolerance, high-salt tolerance after protein translation Deng.Therefore, yeast especially obtains in terms of macromolecular eukaryotic gene research increasingly extensive as gene expression system Using.

Filamentous fungi expression system advantage is can high efficient expression macromolecular eukaryotic protein, superpower secretory protein ability, food Safety-type host etc..Trichoderma and aspergillus etc. are generally acknowledged safety in production bacterial strains, there is very mature batch fermentation technology and relatively strong The outer secretion capacity of protein extracellular, their conversion system and the expression of foreign gene has been attracted extensive attention.Trichoderma expression System is the system for exogenous gene expression emerging in recent years, it can overcome can not carry out spy in prokaryotic expression system Determine the defect of posttranslational modification, and there is the ability of higher secretion foreign protein than saccharomyces cerevisiae, so becoming production tool There is the important channel of the eukaryotic protein of bioactivity.

However, trichoderma itself can synthesize certain cellulase mostly, so giving expression to is mixing enzyme system, separate pure It is relatively difficult to change destination protein, therefore directly limits application of the trichoderma as cellulase expression host.In addition, numerous studies Show that there is no estimated height for expression quantity of the trichoderma to foreign protein.Therefore, novel expression system is developed, is found more, more The method of efficient expression foreign protein, is to need further research hotspot and difficult point.

Summary of the invention

The object of the present invention is to provide a kind of novel trichoderma reesei hosts, and are used for recombinant expression external source or endogenous base Cause, expressing quantity are significantly improved, and have a extensive future.

Present invention firstly provides a kind of trichoderma reeseis, are trichoderma reesei O11-8U (Trichoderma reesei O11- 8U), the China typical culture collection center of Wuhan, China Wuhan University, deposit number are preserved on December 15th, 2017 For CCTCC NO:M2017796.

Trichoderma reesei host of the invention can be used for that effective expression is one or more endogenous or foreign protein.

The albumen be selected from hemicellulase, peroxidase, protease, cellulase, zytase, lipase, Phosphatidase, esterase, cutinase, pectase, keratinase, reductase, oxidizing ferment, phenol oxidase, lipoxygenase, lignoenzyme, Amylopectase, tannase, pentosanase, malanase, 1,4 beta-glucanase, arabinosidase, hyaluronidase, chondroitin Any one or more of enzyme, laccase, amylase, glucoamylase.

The albumen is selected from acetylesterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carboxylic peptide Enzyme, catalase, cellulase, chitinase, renin, cutinase, deoxyribonuclease, epimerase, esterase, Alpha-galactosidase, beta galactosidase, alpha-glucanase, glucan lyase, endo-beta-glucanase, glucoamylase, Glucose oxidase, alpha-Glucosidase, β-glucosyl enzym, glucuronidase, hemicellulase, hexoxidase, hydrolase, Invertase, isomerase, laccase, lipase, lyases, mannosidase, oxidizing ferment, oxidoreducing enzyme, transelminase, fruit Glue acetylesterase, Pectin depolymerase, pectin methylesterase, pectin lyase, peroxidase, phenol oxidase, phytase, poly Galacturonic acid enzyme, protease, rhamnose galacturonic acid enzyme, ribalgilase, thaumatin, transferase, transhipment egg Any one or more of white, transglutaminase, zytase, hexoxidase.

Another aspect of the present invention provides a kind of trichoderma reesei recombinant bacterial strain, is the expression vector that will carry target gene It is transformed into what above-mentioned trichoderma reesei host cell obtained.

As the preferred of embodiment, the target gene is cellulose enzyme gene；

The cellulose enzyme gene, one kind nucleotide sequence are SEQ ID NO:5, and the amino acid sequence of coding is SEQ ID NO:6。

The cellulose enzyme gene, one kind nucleotide sequence are SEQ ID NO:7, and the amino acid sequence of coding is SEQ ID NO:8。

The expression vector is PC2G carrier as a kind of specific choice of embodiment.

Above-mentioned trichoderma reesei recombinant bacterial strain is for producing cellulase.

The present invention, can by mutagenic obtained mutant bacteria trichoderma reesei O11-8U using trichoderma reesei U11-4 as starting strain To be widely used in endogenous or heterologous gene recombinant expression as a kind of novel host cell.With mutant bacteria trichoderma reesei O11-8U is the recombinant bacterial strain energy high efficient expression cellulase NCE5 that constructing host cell obtains, and fermentation enzyme activity reaches 86U/ ML, protein content reach 0.62mg/ml, than the control strain obtained using starting strain trichoderma reesei U11-4 as constructing host cell 56.4% and 51.2% has been respectively increased；The trichoderma reesei O11-8U can also high efficient expression cellulase TT45, be with the bacterium The fermentation enzyme activity for the recombinant bacterial strain that host constructs reaches 60.89U/ml, and protein content reaches 0.59mg/ml, than to set out Bacterial strain is that 83.1% and 78.8%, significant effect has been respectively increased in the control strain that constructing host cell obtains.

Detailed description of the invention

Fig. 1: SDS-PAGE electrophoresis detection analysis chart；Wherein swimming lane 1 is the hair of control strain trichoderma reesei U11-4-NCE5 Ferment supernatant, swimming lane 2 are the fermented supernatant fluid of trichoderma reesei O11-8U-NCE5.Protein band at arrow meaning is fiber Plain enzyme NCE5.

Specific embodiment

Applicant is by the method for gene knockout, by the fiber in wild-type T. reesei (Trichoderma reesei) After tetra- gene knockouts of plain enzyme gene CBH1, CBH2, EG1 and EG2, one plant of trichoderma reesei for itself not secreting cellulase is obtained Bacterial strain is named as trichoderma reesei U (Trichoderma reesei U).

For applicant further by carrying out ultraviolet mutagenesis to trichoderma reesei U, screening obtains a plant mutant bacterium trichoderma reesei U11, hypha form tubbiness, mycelium is fine and close and branch is more, and the viscosity of zymocyte liquid can be made to significantly reduce, reach reduction and stir The purpose that speed improves dissolved oxygen again is mixed, the high density fermentation of bacterial strain is more advantageous to.Trichoderma reesei U11 can be used as a kind of novel place Chief cell is widely used in endogenous or heterologous gene recombinant expression.It is obtained using mutant bacteria trichoderma reesei U11 as constructing host cell To recombinant bacterial strain trichoderma reesei energy high efficient expression NCE5 and glucose turn glycoside enzyme gene, fermentation enzyme activity is up to 412U/ respectively 43.1% and 50.4% has been respectively increased than control strain in mL and 3550U/mL.In addition, applicant is also by carbohydrase, glucose Oxidizing ferment, pectase, amylase etc. recombinantly express in mutant bacteria host U11 respectively.With compare host's trichoderma reesei U phase Than mutant bacteria host U11 improves 40-60% to the expression quantity of said gene, achieves unexpected effect.

Applicant is on December 7th, 2016 by above-mentioned mutant bacteria trichoderma reesei U11 (Trichoderma reesei U11 it) is preserved in the China typical culture collection center of Wuhan, China Wuhan University, deposit number is CCTCC NO: M2016726。

The knockout of 1 cellobiohydrolase of embodiment (CEL74a) gene

The building of 1.1CEL74a gene knockout expression cassette

Firstly, extracting the total genomic dna of trichoderma reesei: trichoderma reesei being inoculated in PDA culture medium culture 7 days, is taken 400 μ l lysis buffers (60mM Tris-HCl, pH7.8,20mM Na- is added in 1.5mL centrifuge tube in 1cm × 1cm fungus block Ac, 1mM EDTA, 1.5%SDS), 2.5min is acutely shaken with bead grinder；200 μ l 10M are added in 65 DEG C of water-bath 20min Ammonium acetate solution mixes, and ice bath 10min, 12000rpm centrifugation 10 minutes, takes supernatant；It is primary that isometric phenol extraction is added, 12000rpm is centrifuged 2 minutes, takes supernatant；Isometric isopropanol precipitating is added 5 minutes, 12000rpm is centrifuged 5 minutes；70% ethyl alcohol It washes twice；Dry DNA is finally dissolved in ddH2O.

Using trichoderma reesei genomic DNA as template amplification trichoderma reesei Cel74a gene, (nucleotides sequence is classified as SEQ ID NO:1 upstream and downstream sequence), wherein primer sequence used in fragment upstream are as follows:

Cel74aEcoR1-5F:GTACGAATTCGTAATGGAGATGAGCTCACTTC

Cel74aXba1-5R:GTAC TCTAGATGCTAGAGTC TGTCTCGGAG

Primer sequence used in segments downstream are as follows:

Cel74aMlu1-3F:GTACACGCGTCTCCAACTCCCTATTGCAAATC、

Cel74aSph1-3R:GTACGCATGCGAACACCCGCGACGGGTTGAACT；

By the gene upstream and downstream with Phusion archaeal dna polymerase (Thermo scientific) from trichoderma reesei genome It amplifies and in DNA.PCR amplification condition is 95 DEG C of 4min；94℃ 30S；55 DEG C of 40S, 72 DEG C of 1min 30 circulations；72 ℃ 7min.Pcr amplification product is recycled using gel reclaims kit.

Aspergillus niger pyrG label is used when knocking out box building, uses the above method to extract aspergillus niger genome as template, uses Following primer amplification pyrG segment, the segment after amplification connect pMD18T carrier after glue recycles.

PyrG F:CGCCGTCGTG TCTCGTCTCC

PyrG R:GCCGCTGGTCAATGTTATCTGGTAT

Carrier is ligated and transformed into Escherichia coli, and picking positive transformant is sequenced, and the plasmid after sequencing is named as pyrG4-pMD18T。

PyrG4-pMD18T plasmid and Cel74a upstream region of gene segment are carried out with restriction enzyme EcoR I, Xba I double Digestion, the segment after digestion are purified with PCR purification kit.Segment and target gene fragment T4 ligase after purification It is attached.Connection product is transformed into Trans5 α Escherichia coli (Transgen), is selected with ampicillin.It is true Definitely really, (Invitrogen) is sequenced to several clones.Positive transformant plasmid is extracted after sequencing, names pMD18T- pyrG4-5F。

Digestion is carried out to downstream PCR product after purification with restriction enzyme Mlu1I and SphI (Fermentas) simultaneously Digestion is carried out with plasmid pMD18T-pyrG4-5F plasmid.Digestion products are purified using gel purification kit, and use T4DNA Ligase (Fermentas) connects above-mentioned two digestion products.Connection product is transformed into Trans5 α Escherichia coli (Transgen), it is selected with ampicillin.It is accurate to ensure, (Invitrogen) is sequenced to several clones.

Use amount reagent preparation box (Axygen) plasmid purification from sequencing result correct escherichia coli cloning in plasmid. 1 gene knockout plasmid of gained is Δ Cel74a-pMD18T.

1.2 conversions and screening

1.2.1 prepared by protoplast

Inoculation trichoderma reesei U11 (CCTCC NO:M2016726) mycelia on PDA plate in growing 7 days；Cut diameter about The bacterium colony of 2cm is placed in the fluid nutrient medium of about 100ml YEG+U (0.5% yeast powder, 1% glucose, 1% uridine), 30 DEG C, 200rpm shaken cultivation is stayed overnight；Mycelia is collected by filtration in multilayer gauze；Mycelia is placed in and fills 20ml cracking enzyme solution (Sigma L1412 it) digests 2 hours；Enzymolysis liquid is taken out, 0.7M NaCl solution is added, jiggles, is filtered in three layers of sterilizing lens wiping paper, Filtrate is collected, 3000rpm is centrifuged 10min；Supernatant is abandoned, 10-20ml STC liquid (20% sucrose, 50mM Tris-Cl, 50mM are added CaCl₂) suspend, 3000rpm is centrifuged 10min；Add appropriate STC suspend packing (150 μ l/ pipe, 10⁸A/ml).

1.2.2 conversion and verifying

It takes 10 μ g Δ Cel74a-pMD18T Plasmid DNA to be added in 200 μ l protoplasts, is subsequently added into 50 μ l 25% PEG is mixed gently, and is stored at room temperature 20min；Then add 2ml 25%PEG again, mix gently, be stored at room temperature 5min, 4m is added 1.2M sorbierite, is placed at room temperature for.45-55 DEG C of upper layer Semi-solid cell culture is cooled to after protoplast is added to 50ml or so fusing Base (0.1%MgSO₄, 1%KH₂PO4,0.6% (NH₄)₂SO₄, 1% glucose, 18.3% sorbierite, 0.35% agarose), gently Subfoundation culture medium flat plate (2% glucose, 0.5% (NH4) are poured into after light mixing₂SO₄, 1.5%KH₂PO₄, 0.06% MgSO₄, 0.06%CaCl₂, 1.5% agar), 30 DEG C of dark culturing a couple of days to transformants are grown.

Extracting transformant genomic DNA according to 1.1 the method for embodiment is template, utilizes genome internal primer (Cel74a-Fs:TATTCCGCTCCACAGACTCGGGCA；Expand with Cel74a-Ra:ATTCTGCTTC TGGCAGACAT ACGG) Increase Cel74a gene and verifies transformant.PCR amplification condition is 95 DEG C of 4min；94℃30S；59 DEG C of 40S, 72 DEG C 1min 30 are followed Ring；72℃7min.

The transformant not expanded to Cel74a gene be utilized respectively genome C EL74A-F and pyrGR and pyrGF and CEL74A-R two carries out cross validation to primer.PCR amplification condition is 95 DEG C of 4min；94℃ 30S；59 DEG C of 40S, 72 DEG C of 3min 30 circulations；72℃7min.

Two pairs of primer sequences are as follows:

CEL74A-F:AAGTAGTGAGCGCAGCCAACATAC

CEL74A-R:GATTGTGAGAAGCAGGTTGT TGCTG

Two pairs of cross primers can expand the target fragment to 4k or so, it was demonstrated that CEL74A gene is in trichoderma reesei U11 It knocks out successfully.Strain Designation after knockout is trichoderma reesei U11-1 (Trichoderma reesei U11-1) by applicant.

Using above-mentioned same method, applicant by trichoderma reesei U11 EG III (nucleotides sequence is classified as SEQ ID NO: 2), XYN III (nucleotides sequence is classified as SEQ ID NO:3), 3 genes of BGL (nucleotides sequence is classified as SEQ ID NO:4) also successively into Knockout is gone.

Applicant will knock out CEL74A, and the trichoderma reesei U11 Strain Designation of EG III, XYN III and BGL4 gene is inner Family name's trichoderma U11-4 (Trichoderma reesei U11-4).

2 ultraviolet mutagenesis of embodiment and screening

Applicant with trichoderma reesei U11-4 be bacterium germination, further screened by ultraviolet mutagenesis bacterium colony become smaller, mycelia branch The mutant bacteria increased.

Trichoderma reesei U11-4 is inoculated in fresh PDA plate, 30 DEG C are cultivated 5-7 days.Bleach to bacterium colony surface, generates When a large amount of spores, the sterile water elution of 5ml is drawn, spore liquid is obtained, is resuspended after centrifugation with sterile water, is counted with blood counting chamber, Making spore concentration is about 5 × 10⁷A/ml.It takes a rotor to be put into the sterile petri dish of 90mm, the spore that 10ml has diluted is added Sub- suspension, stirring makes spore liquid be in uniform state on magnetic stirring apparatus.It is 9w's with power in aseptic superclean bench Ultraviolet lamp is irradiated in the top of vertical range 20cm, irradiates 60s, 90s, 120s, 150s, 180s respectively.By the spore after irradiation Liquid dilutes 10000 times, takes wherein 100ul even spread PDA plate, counts after 30 DEG C of culture 2-3d, not by ultraviolet irradiation Spore liquid is control, calculates lethality.The results show that the lethality of trichoderma reesei spore is 90% when ultraviolet irradiation 120s, because This chooses the irradiation time and carries out subsequent Mutagenesis experiments.

Mutagenesis screening: taking a rotor to be put into the sterile petri dish of 90mm, and it is (dense that the spore suspension that 10ml has diluted is added Degree is 5 × 10⁷A/ml).Stirring makes spore liquid be in uniform state on magnetic stirring apparatus.In aseptic superclean bench, use The ultraviolet lamp that power is 9w is irradiated in the top of vertical range 20cm, is irradiated 120s, is then placed 30min under dark condition. Spore suspension is diluted 10000 times, take wherein 100ul be spread evenly across PDA plate, 30 DEG C of culture 2-3d, while to go out bacterium germination Trichoderma reesei U11-4 is control group, is coated with PDA plate, 30 DEG C of culture 2-3d using same method.

Applicant is coated with 130 PDA plates altogether, and each plate grows about 50 bacterium colonies.By observing colonial morphology, and It is compared with bacterium germination trichoderma reesei U11-4 out, picks out colonial morphology and occur mutant 177 obviously made a variation, connect respectively It plants to PDA secondary screening plate (each plate is uniformly inoculated with 12 mutant), 30 DEG C of culture 2-3d.

Finally, applicant, which screens to obtain 29 plants of colonial morphologies, obviously becomes smaller, and mycelium is fine and close and the more Richter scales wood of branch Mould mutant bacteria.These mutant bacterias have mycelium tubbiness in amplification fermentation process, and dissolved oxygen level is high, and it is excellent that fermentation liquid viscosity is low etc. Point.

The uracil auxotrophy of 3 trichoderma reesei expression host of embodiment screens

5- fluororotic acid can induce thallus missing uridylate route of synthesis in orotidine monophosphate transferase or Orotidine monophosphate decarboxylase, to make 5- fluororotic acid that can not form toxic substance 5 FU 5 fluorouracil nucleotide, to produce The resistance to 5- fluororotic acid has been given birth to, pyrimidine nucleotide nutrition can be supplemented by adding uracil into culture medium, Therefore it can contain 5- fluororotic acid and uracil using the uracil auxotrophy bacterial strain of 5- fluororotic acid induced synthesis Culture medium in grow；And wild-type strain can not contain 5- fluororotic acid because not having the resistance to 5- fluororotic acid It is grown under condition of culture.Therefore 5- fluororotic acid is commonly used to screen the mutant strain of uracil-deficient.

The Tween-20 that the spore concentration for 29 plants of trichoderma reesei mutant bacterias that embodiment 2 is screened respectively is 0.1% is molten Liquid is diluted to about 1 × 10⁷A/mL；Then spore suspension is spread evenly across containing 1.5g/mL 5- fluororotic acid and 1.87g/ Basic solid medium (2% glucose, the 0.5% (NH of mL uridine (Uridine)₄)₂SO₄, 1.5%KH₂PO₄, 0.06%MgSO₄, 0.06%CaCl₂, 1.5% agar) and on plate, each plate coating about 1 × 10⁶A spore is protected from light 30 DEG C of trainings Support 7d or more.The results show that there is the bacterium colony of different number to grow on the plate of every kind of mutant bacteria, illustrate that these bacterium colonies are possible to It is the uracil-deficient bacterial strain of corresponding mutant bacteria.

It picks them separately above-mentioned every kind of mutant bacteria and corresponds to the bacterium colony grown on plate, each bacterium colony is respectively coated on basic training It supports base plate and the minimal medium plate containing 1.87g/mL Uridine is verified.Real uracil-deficient bacterial strain It can only be grown on the minimal medium plate containing Uridine, and the nothing on the minimal medium plate for lack Uridine Method growth.Finally, applicant in example 2 by ultraviolet mutagenesis obtain 29 plants of trichoderma reesei mutant bacterias in, every plant mutant Bacterium all correspondences screen the relatively best uracil-deficient bacterial strain of 1 plant of growth conditions, totally 29 plants, are respectively designated as trichoderma reesei O11-1U, O11-2U, O11-3U, O11-4U ... ..., O11-29U.

It is respectively that it is basic with liquid in order to further determine the stability of above-mentioned 29 plants of uracil-deficient mutant strains Culture medium (2% glucose, 0.5% (NH₄)₂SO₄, 1.5%KH₂PO₄, 0.06%MgSO₄, 0.06%CaCl₂) shaken cultivation 7 It, can observe it grow, and be repeated 3 times test.Experimental result shows that 29 plants of uracil-deficient mutant strains are lacking It can not be grown in the liquid minimal medium of Uridine.4 neutral cellulase gene NCE5 of embodiment is mutated in trichoderma reesei Expression in bacterium

In order to verify mutant bacteria trichoderma reesei O11-1U, O11-2U, O11-3U, O11-4U ... ..., O11-29U is to target The expression efficiency of gene, applicant's selection will derive from neutral cellulase gene NCE5 (its nucleotide sequence of trichoderma reesei For SEQ ID NO:5, encoding amino acid sequence is SEQ ID NO:6) respectively in bacterium germination trichoderma reesei U11-4 out and above-mentioned mutation It is expressed in bacterial strain.

4.1 extract trichoderma reesei total genomic dna

Trichoderma reesei inoculation Shake flask medium is incubated overnight, appropriate thallus is taken to be placed in centrifuge tube, 13000 rpm centrifugation 5min abandons supernatant；400 μ l extraction buffers (100mM TrisHCl, 100mM EDTA, 250mM NaCl, 1%SDS) is added； Then plus 100mg quartz sand or bead, instrument is made in pearl acutely vibrate 2min or so；It is added after 65 DEG C of water-bath 20min of water-bath 200 μ l 10M NH4AC ice bath 10min；13000rpm centrifugation 10min takes supernatant, and the dehydrated alcohol of 2 times of volumes is then added ,- 20 DEG C of placement 30min；13000rpm is centrifuged 10min and abandons supernatant, with 70% ethanol washing 2 times；It dries, suitable quantity of water dissolution is added It is saved in -20 DEG C.4.2 gene cloning

Using the genome DNA extracted in 4.1 as template, primer anl-F and anl-R are utilized (TCTAGAGGAGCGGCAGTCCGGCAGCGGCC and AGTTAGTTAG CACTCAAGGG A) carries out PCR amplification.PCR amplification item Part is 95 DEG C of 4min；94 DEG C of 30S, 59 DEG C of 40S, 72 DEG C of 1min 30 circulations；72℃7min.It is returned using gel reclaims kit Receive pcr amplification product.

4.3 sequencing analysis

The amplified production recycled in 4.2 is connected to PC2G carrier, obtain cloning vector NCE5-PC2G plasmid and is sent to north The big cara gene in capital carries out sequencing analysis.Sequencing result, the nucleotides sequence of amplified production are classified as SEQ ID NO:5, Encoding amino acid sequence is SEQ ID NO:6.The result of multiple clones proves that there is no expanding mistake.

4.4 conversions and screening

4.4.1 prepared by protoplast

The trichoderma reesei mutant O11-1U mycelia that inoculation embodiment 3 obtains on PDA plate in growing 7 days；Cut diameter The bacterium colony of about 3cm is placed in the fluid nutrient medium of about 60mlYEG (0.5% yeast powder, 1% glucose, 0.1%Uridine), 30 DEG C, 200rpm shaken cultivation stay overnight；Mycelia is collected by filtration in multilayer gauze；Mycelia is placed in and fills 20ml cracking enzyme solution (Sigma L1412 it) digests 2 hours；Enzymolysis liquid is taken out, 0.7 M NaCl solution is added, jiggles, in three layers of sterilizing lens wiping paper mistake Filter, collects filtrate, and 3000rpm is centrifuged 10min；Abandon supernatant, add 10-20ml STC liquid (20% sucrose, 50mM Tris-Cl, 50mM CaCl₂) suspend, 3000rpm is centrifuged 10min；Add appropriate STC suspend packing (200 μ l/ pipe, 10⁸A/ml).

4.4.2 conversion and verifying

It takes 10 μ g NCE5-PC2G DNA to be added in 200 μ l protoplasts, is subsequently added into 50 μ l 25%PEG and gently mixes It is even, it is stored at room temperature 25min；Then divide 2-3 times and add 2ml 25%PEG again, mix gently, be stored at room temperature 25min, protoplast 45-55 DEG C of upper layer semisolid culturemedium (0.1%MgSO is cooled to after being added to 50ml or so fusing₄, 1%KH₂PO4,0.6% (NH₄)₂SO₄, 1% glucose, 18.3% sorbierite, 0.35% agarose), it is flat that subfoundation culture medium is poured into after mixing gently Plate (2% glucose, 0.5% (NH4)₂SO₄, 1.5%KH₂PO₄, 0.06%MgSO₄, 0.06%CaCl₂, 1.5% agar), 30 DEG C dark culturing a couple of days to transformant is grown.By shake flask fermentation, the highest positive transformant of cellulase expression amount is selected, is ordered Entitled trichoderma reesei O11-1U-NCE5.

Using above-mentioned same method, respectively with trichoderma reesei mutant strain O11-2U, O11-3U, O11-4U ... ..., O11-29U is host cell, and building obtains the trichoderma reesei recombinant bacterial strain of recombinant expression neutral cellulase NCE5, corresponding choosing The highest positive transformant of expression quantity out is respectively designated as trichoderma reesei O11-2U-NCE5, O11-3U-NCE5, O11-4U- NCE5 ..., O11-29U-NCE5.

Meanwhile using starting strain trichoderma reesei U11-4 as control host, using above-mentioned same method, building obtains weight The trichoderma reesei recombinant bacterial strain of group expression neutral cellulase NCE5, correspondence are selected the highest positive transformant of expression quantity, are named For trichoderma reesei U11-4-NCE5, as control strain.

4.5 fermentation verifyings

By the control strain trichoderma reesei U11-4-NCE5 of above-mentioned building, and with mutant strain O11-1U, O11-2U, O11-3U ... ..., O11-29U are recombinant bacterial strain the trichoderma reesei O11-1U-NCE5, O11-2U- that constructing host cell obtains NCE5, O11-3U-NCE5 ..., O11-29U-NCE5 be inoculated in respectively Shake flask medium (glucose 10g/L, liquid sugar 10g/L, Corn pulp 15g/L, ammonium sulfate 9g/L, magnesium sulfate 5-10g/L, potassium dihydrogen phosphate 20g/L diammonium hydrogen phosphate 4g/L) 30 DEG C, After 200rpm shaking table culture 48h, temperature control is 25 DEG C, is fermented 3 days.Fermented supernatant fluid is taken to measure cellulose therein respectively Enzyme enzyme activity.

(1) enzyme activity determination method

It is fine from the methylol that concentration is 5mg/ml per minute under conditions of 50 DEG C, pH value are 4.8 (neutrality is pH6.0) Tieing up enzyme amount required for 1 μm of ol reduced sugar of degradation release in plain sodium solution is an enzyme activity unit U, and reduced sugar is with glucose etc. Amount.

Take three test tubes that 0.5mL CMC substrate is respectively added, 50 DEG C of water-baths preheat 5min together with enzyme solution to be measured.First, 0.5mL prepare liquid, and timing are respectively added in two test tubes, reacts 15min in 50 DEG C of water-baths.Respectively add in three test tubes after having reacted Enter 1.5mLDNS reagent, and always adds the enzyme solution to be measured of 0.5mL in third branch test tube.After taking out and shaking up three test tubes, boiling 5min is reacted in water-bath.It is rapidly cooled to room temperature, it is fixed to 5.0mL with water.It is to impinging upon 540nm wavelength with third branch test tube test solution Under the conditions of survey the absorbance of the first and second test tube test solution, absorbance is advisable between 0.25-0.35.The suction of enzyme solution reaction solution to be measured The absolute value of the difference of luminosity and horizontal control enzyme solution reaction solution absorbance is no more than 0.015.

Enzyme activity X=(magnitudes/180/15/0.5 such as glucose) × n

Wherein: X --- enzyme activity unit, IU/g (mL)；

180 --- glucose is converted into micromole from microgram；

15 --- the reaction time of prepare liquid and substrate；

0.5 --- the enzyme liquid amount to be measured of reaction is added；

N --- extension rate；

(2) enzyme activity determination result

The control strain trichoderma reesei U11-4- constructed using going out bacterium germination trichoderma reesei U11-4 as control host NCE5, fermented supernatant fluid enzyme activity are 55U/mL, protein content 0.41mg/ml, and with mutant strain O11-1U, O11-2U, O11-3U ... ..., O11-29U are recombinant bacterial strain the trichoderma reesei O11-1U-NCE5, O11-2U- that constructing host cell obtains NCE5, O11-3U-NCE5 ..., O11-29U-NCE5, fermentation enzyme activity is about 71~86U/mL, and protein content is about 0.55- 0.62mg/ml illustrates cellulose enzyme gene NCE5 in bacterium germination trichoderma reesei U11-4 out and mutant strain O11-1U, O11- 2U, O11-3U ... ... obtain effective expression in O11-29U, and the expression quantity in mutant bacteria is apparently higher than out bacterium germination.Its In, the recombinant bacterial strain trichoderma reesei O11-8U-NCE5 obtained using mutant bacteria O11-8U as constructing host cell ferments enzyme activity highest, For 86U/mL, protein content is up to 0.62mg/ml, improves 56.4% and 51.2% than control strain, achieves unexpected Technical effect.

By control strain trichoderma reesei U11-4-NCE5 and the weight obtained using mutant strain O11-8U as constructing host cell Group strain Trichoderma reesei O11-8U-NCE5 fermented supernatant fluid carries out SDS-PAGE electrophoresis detection, as a result as shown in Figure 1, with compareing Bacterial strain is compared, and the expression quantity of destination protein NCE5 (at arrow meaning) is significantly improved in trichoderma reesei O11-8U-NCE5.

Applicant is on December 15th, 2017 by above-mentioned mutant bacteria trichoderma reesei O11-8U (Trichoderma reesei O11-8U it) is preserved in the China typical culture collection center of Wuhan, China Wuhan University, deposit number is CCTCC NO: M2017796。

Expression of the 5 cellulase TT45 of embodiment in trichoderma reesei O11-8U

4 the method for reference implementation example extracts trichoderma reesei genome, carries out PCR amplification by following primer, obtains fiber Plain enzyme TT45 genetic fragment (its nucleotides sequence is classified as SEQ ID NO:7, and amino acid sequence is SEQ ID NO:8).

TT45-KpnI-F:CGGGGTACCATGCGATCTACCCCGGTCC

TT45-MluI-R:CGACGCGTTCAGAGGCACTGAGAGTAGTAG

Cellulase TT45 genetic fragment is connected to PC2G carrier, obtains recombinant vector；Then recombinant vector is converted Enter host cell trichoderma reesei O11-8U, building obtains the trichoderma reesei recombinant bacterial strain of recombinant expression cellulase TT45, selects The highest positive transformant of expression quantity is named as trichoderma reesei O11-8U-TT45 (Trichoderma reesei O11-8U- TT45)。

Meanwhile using starting strain trichoderma reesei U11-4 as control host, using above-mentioned same method, building obtains weight The trichoderma reesei recombinant bacterial strain of group expression cellulase TT45, correspondence selects the highest positive transformant of expression quantity, in being named as Family name trichoderma U11-4-TT45, as control strain.

The trichoderma reesei O11-8U-TT45 of above-mentioned building and control bacterium trichoderma reesei U11-4-TT45 are inoculated in shake respectively Bottle culture medium (glucose 10g/L, liquid sugar 10g/L, corn pulp 15g/L, ammonium sulfate 9g/L, magnesium sulfate 5-10g/L, biphosphate Potassium 20g/L diammonium hydrogen phosphate 4g/L) 30 DEG C, after 200rpm shaking table culture 48h, temperature control is 25 DEG C, is fermented 3 days.It takes respectively Fermented supernatant fluid measures cellulose enzyme activity (enzyme activity determination method reference implementation example 4.5) therein.

Enzyme activity determination is as the result is shown: the fermentation enzyme activity of control bacterium trichoderma reesei U11-4-TT45 is 33.26U/ml, and albumen contains Amount is 0.33mg/ml, and the fermentation enzyme activity of trichoderma reesei O11-8U-TT45 is up to 60.89U/ml, and protein content is up to 0.59mg/ml improves 83.1% and 78.8%, significant effect than control bacterium.The result is also indicated that with mutant strain Richter scale The expression quantity that trichoderma O11-8U is the recombinant bacterial strain cellulase TT45 that constructing host cell obtains is significantly larger than to go out bacterium germination Trichoderma reesei U11-4 is the recombinant bacterial strain that constructing host cell obtains.

In addition, applicant is also by glucuroide, dextranase, pectase, catalase etc. respectively in mutant bacteria place It is recombinantly expressed in main O11-8U.Compared with starting strain host's trichoderma reesei U11-4, mutant bacteria host O11-8U is to above-mentioned The expression quantity of gene improves 30% or more, significant effect.

To sum up, the present invention passes through mutagenic obtained mutant bacteria trichoderma reesei O11- using trichoderma reesei U11-4 as starting strain 8U (Trichoderma reesei O11-8U) can be used as a kind of novel host cell, be widely used in endogenous or heterologous base The recombinant expression of cause is conducive to the yield for improving albumen, reduces production cost.

Sequence table

<110>Qingdao Weilan Biology Group Co., Ltd.

<120>a kind of novel trichoderma and its application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2517

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

atgaaggtct ctcgagtcct tgcccttgtc ctgggggccg tcatccctgc ccatgctgcc 60

ttttcatgga agaacgtcaa gctcggcggc ggcggcggct tcgtccccgg catcatcttc 120

catcccaaga caaaaggcgt agcatatgca cgaacagata ttggcgggct gtaccgcctc 180

aacgccgacg actcatggac cgccgtcacg gatgggattg ctgataatgc cggctggcac 240

aactggggca tcgacgctgt tgcgcttgat ccgcaggacg atcaaaaggt gtatgccgca 300

gtcggcatgt atacgaacag ctgggatccg agtaatggag ccatcattcg ctcgtcagac 360

cgcggcgcaa cgtggtcctt caccaacttg cccttcaaag tcgggggtaa catgccagga 420

cgcggagccg gagagcgtct ggctgtcgat ccggccaact ccaacatcat ctactttggt 480

gctcgctcag gaaacggcct ctggaagtct acggacggcg gcgtgacctt ttccaaggtc 540

tcgtcgttca cggcaactgg gacgtacatc ccagacccga gtgattccaa cggctacaac 600

agcgacaagc aaggactcat gtgggttacg ttcgactcaa ccagcagcac gaccggggga 660

gccacgtctc gtatctttgt tggcacggct gataacatca ctgcttcagt ctatgtgagc 720

acgaatgccg gctccacgtg gagtgctgta ccggggcagc cagggaaata ctttcctcac 780

aaggcgaaac tgcagccagc agagaaggcc ttgtatctga cctattccga tggcacaggg 840

ccgtatgatg gcacacttgg ctcagtgtgg aggtacgaca ttgcaggggg aacttggaaa 900

gacatcaccc ctgtctctgg atcagatcta tactttggct ttggcggcct tggcctcgat 960

ttgcaaaagc caggaaccct tgttgttgct tctttgaact cttggtggcc agatgctcag 1020

ctgtttcggt cgaccgactc tgggacaaca tggagcccga tctgggcgtg ggcgagctat 1080

ccgactgaga cctattacta cagcatctca actcccaaag caccgtggat caagaacaac 1140

tttatcgatg tgacgagcga gtcaccgtcc gatggtctca tcaagcgcct cggctggatg 1200

attgagtctc tcgagattga cccaaccgac agcaaccact ggctctacgg caccggaatg 1260

acaatctttg gcggccacga tctcaccaac tgggacacgc gccacaatgt gtcaatccaa 1320

tcactggcag acggcatcga ggaattctcc gtccaggacc tggcctctgc acccggcgga 1380

agcgagctat tggccgcagt cggagacgac aacggcttca cctttgccag cagaaacgac 1440

ctcgggacat cgccgcagac ggtctgggca acgcccacat gggccacctc gacgagcgtc 1500

gactacgccg ggaactcggt caagagcgtc gtccgcgtcg gcaacaccgc cggcacgcaa 1560

caggtggcca tctcgtccga cggcggcgcg acgtggagca tcgactacgc ggccgacacg 1620

tccatgaacg gcggcacggt ggcctattcg gccgacggcg acacgatcct ctggtcgacc 1680

gcctcgtccg gcgtgcagcg ctcgcagttc cagggcagct ttgcctccgt ctcgagcctg 1740

cccgcgggcg ccgtcatcgc ctcggacaag aagaccaaca gcgtcttcta cgccggctcc 1800

ggatcgacct tttacgtcag caaggacacc ggcagcagct tcacgcgcgg gcccaagctg 1860

ggcagcgcag ggacgatccg ggatatcgct gctcacccga ccaccgcggg cacgttgtat 1920

gtctcgaccg acgtcggcat attccgctcc acagactcgg gcacgacctt tggccaagtc 1980

tccaccgccc tgaccaacac ctaccagatc gccctgggtg tgggctcagg ctcgaactgg 2040

aacctgtatg ccttcggcac cggcccgtca ggggctcgcc tctacgccag tggagacagc 2100

ggcgcctcct ggacggacat ccagggctcc cagggcttcg gctccatcga cagcaccaag 2160

gtcgccggca gcggcagcac cgccgggcaa gtctacgtgg gcaccaacgg ccggggcgtc 2220

ttttacgctc agggaaccgt cggcggcggc acgggcggga cttcctcgtc gaccaagcag 2280

agcagcagca gtacctcttc cgccagctcg agcaccacgc tgaggtcgag cgttgtatcc 2340

acgacccggg cttcgacggt gacttcgtcg aggaccagct cggccgccgg tcccacgggg 2400

tcaggggtcg ccggtcatta tgctcagtgc ggagggattg ggtggacggg gccgacgcag 2460

tgtgtggcgc cgtatgtctg ccagaagcag aatgattatt actaccagtg tgtgtga 2517

<210> 2

<211> 705

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atgaagttcc ttcaagtcct ccctgccctc ataccggccg ccctggccca aaccagctgt 60

gaccagtggg caaccttcac tggcaacggc tacacagtca gcaacaacct ttggggagca 120

tcagccggct ctggatttgg ctgcgtgacg gcggtatcgc tcagcggcgg ggcctcctgg 180

cacgcagact ggcagtggtc cggcggccag aacaacgtca agtcgtacca gaactctcag 240

attgccattc cccagaagag gaccgtcaac agcatcagca gcatgcccac cactgccagc 300

tggagctaca gcgggagcaa catccgcgct aatgttgcgt atgacttgtt caccgcagcc 360

aacccgaatc atgtcacgta ctcgggagac tacgaactca tgatctggct tggcaaatac 420

ggcgatattg ggccgattgg gtcctcacag ggaacagtca acgtcggtgg ccagagctgg 480

acgctctact atggctacaa cggagccatg caagtctatt cctttgtggc ccagaccaac 540

actaccaact acagcggaga tgtcaagaac ttcttcaatt atctccgaga caataaagga 600

tacaacgctg caggccaata tgttcttagc taccaatttg gtaccgagcc cttcacgggc 660

agtggaactc tgaacgtcgc atcctggacc gcatctatca actaa 705

<210> 3

<211> 1044

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atgaaagcaa acgtcatctt gtgcctcctg gcccccctgg tcgccgctct ccccaccgaa 60

accatccacc tcgaccccga gctcgccgct ctccgcgcca acctcaccga gcgaacagcc 120

gacctctggg accgccaagc ctctcaaagc atcgaccagc tcatcaagag aaaaggcaag 180

ctctactttg gcaccgccac cgaccgcggc ctcctccaac gggaaaagaa cgcggccatc 240

atccaggcag acctcggcca ggtgacgccg gagaacagca tgaagtggca gtcgctcgag 300

aacaaccaag gccagctgaa ctggggagac gccgactatc tcgtcaactt tgcccagcaa 360

aacggcaagt cgatacgcgg ccacactctg atctggcact cgcagctgcc tgcgtgggtg 420

aacaatatca acaacgcgga tactctgcgg caagtcatcc gcacccatgt ctctactgtg 480

gttgggcggt acaagggcaa gattcgtgct tgggacgtgg tcaatgaaat cttcaacgag 540

gatggaacgc tgcgctcttc agtcttttcc aggctcctcg gcgaggagtt tgtctcgatt 600

gcctttcgtg ctgctcgaga tgctgaccct tctgcccgtc tttacatcaa cgactacaat 660

ctcgaccgcg ccaactatgg caaggtcaac gggttgaaga cttacgtctc caagtggatc 720

tctcaaggag ttcccattga cggtattgga agccagtccc atctcagcgg cggcggaggc 780

tctggtacgc tgggtgcgct ccagcagctg gcaacggtac ccgtcaccga gctggccatt 840

accgagctgg acattcaggg ggcaccgacg acggattaca cccaagttgt tcaagcatgc 900

ctgagcgtct ccaagtgcgt cggcatcacc gtgtggggca tcagtgacaa ggactcgtgg 960

cgtgccagca ccaaccctct tctgtttgac gcaaacttca accccaagcc ggcatataac 1020

agcattgttg gcatcttaca atag 1044

<210> 4

<211> 2235

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atgcgttacc gaacagcagc tgcgctggca cttgccactg ggccctttgc tagggcagac 60

agtcactcaa catcgggggc ctcggctgag gcagttgtac ctcctgcagg gactccatgg 120

ggaaccgcgt acgacaaggc gaaggccgca ttggcaaagc tcaatctcca agataaggtc 180

ggcatcgtga gcggtgtcgg ctggaacggc ggtccttgcg ttggaaacac atctccggcc 240

tccaagatca gctatccatc gctatgcctt caagacggac ccctcggtgt tcgatactcg 300

acaggcagca cagcctttac gccgggcgtt caagcggcct cgacgtggga tgtcaatttg 360

atccgcgaac gtggacagtt catcggtgag gaggtgaagg cctcggggat tcatgtcata 420

cttggtcctg tggctgggcc gctgggaaag actccgcagg gcggtcgcaa ctgggagggc 480

ttcggtgtcg atccatatct cacgggcatt gccatgggtc aaaccatcaa cggcatccag 540

tcggtaggcg tgcaggcgac agcgaagcac tatatcctca acgagcagga gctcaatcga 600

gaaaccattt cgagcaaccc agatgaccga actctccatg agctgtatac ttggccattt 660

gccgacgcgg ttcaggccaa tgtcgcttct gtcatgtgct cgtacaacaa ggtcaatacc 720

acctgggcct gcgaggatca gtacacgctg cagactgtgc tgaaagacca gctggggttc 780

ccaggctatg tcatgacgga ctggaacgca cagcacacga ctgtccaaag cgcgaattct 840

gggcttgaca tgtcaatgcc tggcacagac ttcaacggta acaatcggct ctggggtcca 900

gctctcacca atgcggtaaa tagcaatcag gtccccacga gcagagtcga cgatatggtg 960

actcgtatcc tcgccgcatg gtacttgaca ggccaggacc aggcaggcta tccgtcgttc 1020

aacatcagca gaaatgttca aggaaaccac aagaccaatg tcagggcaat tgccagggac 1080

ggcatcgttc tgctcaagaa tgacgccaac atcctgccgc tcaagaagcc cgctagcatt 1140

gccgtcgttg gatctgccgc aatcattggt aaccacgcca gaaactcgcc ctcgtgcaac 1200

gacaaaggct gcgacgacgg ggccttgggc atgggttggg gttccggcgc cgtcaactat 1260

ccgtacttcg tcgcgcccta cgatgccatc aataccagag cgtcttcgca gggcacccag 1320

gttaccttga gcaacaccga caacacgtcc tcaggcgcat ctgcagcaag aggaaaggac 1380

gtcgccatcg tcttcatcac cgccgactcg ggtgaaggct acatcaccgt ggagggcaac 1440

gcgggcgatc gcaacaacct ggatccgtgg cacaacggca atgccctggt ccaggcggtg 1500

gccggtgcca acagcaacgt cattgttgtt gtccactccg ttggcgccat cattctggag 1560

cagattcttg ctcttccgca ggtcaaggcc gttgtctggg cgggtcttcc ttctcaggag 1620

agcggcaatg cgctcgtcga cgtgctgtgg ggagatgtca gcccttctgg caagctggtg 1680

tacaccattg cgaagagccc caatgactat aacactcgca tcgtttccgg cggcagtgac 1740

agcttcagcg agggactgtt catcgactat aagcacttcg acgacgccaa tatcacgccg 1800

cggtacgagt tcggctatgg actgtcttac accaagttca actactcacg cctctccgtc 1860

ttgtcgaccg ccaagtctgg tcctgcgact ggggccgttg tgccgggagg cccgagtgat 1920

ctgttccaga atgtcgcgac agtcaccgtt gacatcgcaa actctggcca agtgactggt 1980

gccgaggtag cccagctgta catcacctac ccatcttcag cacccaggac ccctccgaag 2040

cagctgcgag gctttgccaa gctgaacctc acgcctggtc agagcggaac agcaacgttc 2100

aacatccgac gacgagatct cagctactgg gacacggctt cgcagaaatg ggtggtgccg 2160

tcggggtcgt ttggcatcag cgtgggagcg agcagccggg atatcaggct gacgagcact 2220

ctgtcggtag cgtag 2235

<210> 5

<211> 673

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atgcagctcc ccctgaccac gctcctcacc ctcctccccg ccctcgcggc ggcccagtcc 60

ggcagcggcc gcaccacgcg ctactgggac tgctgcaagc gtcgtgcgcg tggcccggca 120

agggcccggc gcccgtgcgg acgtgcgacc ggtgggacac ccgctgttcg acggcggcaa 180

cacgcgcagc gggtgcgacg cgggcggcgg cgcctacagt gctcggacca gagcccgtgg 240

gcggtcagcg acgacctggc gtacggctgg gcggccgcaa cattgccggc tccaacgaga 300

ggcagtggtg ctgcgcctgc tacgagctga ccttcacagc gggccggtgg cgggcaagag 360

gatgattgtg caggcgagca atacgggagg cgattgggga acaaccactt tgatattgct 420

atgcccggcg gtggcgtcgg tatcttcaac gcctcaccga ccagtacggc gcgcccccca 480

acgggtgggg ccagcgctac ggcggcatca gccacgccac gagtgcgacg ccttccccga 540

gaagctcaag cccggctgct actggcgctt tgctggtgcg tttccctctt tcctcctctc 600

tcactgtctt tgccccctgg aacagggcag agatgggaag aagttgtgtt ttttttccct 660

tgagtgctaa cta 673

<210> 6

<211> 227

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 6

Met Gln Leu Pro Leu Thr Thr Leu Leu Thr Leu Leu Pro Ala Leu Ala

1 5 10 15

Ala Ala Gln Ser Gly Ser Gly Arg Thr Thr Arg Tyr Trp Asp Cys Cys

20 25 30

Lys Pro Ser Cys Ala Trp Pro Gly Lys Gly Pro Ala Pro Val Arg Thr

35 40 45

Cys Asp Arg Trp Asp Asn Pro Leu Phe Asp Gly Gly Asn Thr Arg Ser

50 55 60

Gly Cys Asp Ala Gly Gly Gly Ala Tyr Met Cys Ser Asp Gln Ser Pro

65 70 75 80

Trp Ala Val Ser Asp Asp Leu Ala Tyr Gly Trp Ala Ala Val Asn Ile

85 90 95

Ala Gly Ser Asn Glu Arg Gln Trp Cys Cys Ala Cys Tyr Glu Leu Thr

100 105 110

Phe Thr Ser Gly Pro Val Ala Gly Lys Arg Met Ile Val Gln Ala Ser

115 120 125

Asn Thr Gly Gly Asp Leu Gly Asn Asn His Phe Asp Ile Ala Met Pro

130 135 140

Gly Gly Gly Val Gly Ile Phe Asn Ala Cys Thr Asp Gln Tyr Gly Ala

145 150 155 160

Pro Pro Asn Gly Trp Gly Gln Arg Tyr Gly Gly Ile Ser Gln Arg His

165 170 175

Glu Cys Asp Ala Phe Pro Glu Lys Leu Lys Pro Gly Cys Tyr Trp Arg

180 185 190

Phe Asp Trp Cys Val Ser Leu Phe Pro Pro Leu Ser Leu Ser Leu Pro

195 200 205

Pro Gly Thr Gly Gln Thr Met Gly Arg Ser Cys Val Phe Phe Pro Leu

210 215 220

Ser Ala Asn

225

<210> 7

<211> 900

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

atgcgctcta ctcccgttct tcgcacaacc ctggccgctg cacttcctct ggtcgcctcc 60

gcggccagtg gcagtggcca gtccacgaga tactgggact gctgcaagcc gtcgtgcgct 120

tggcccggga aggccgccgt cagccaaccg gtctacgcgt gcgatgccaa cttccagcgc 180

ctgtccgact tcaatgtcca gtcgggctgc aacggcggct cggcctactc ctgcgccgac 240

cagactccct gggcggtgaa cgacaatctc gcctacggct tcgccgcgac gagcatcgcc 300

ggcgggtccg aatcctcgtg gtgctgcgcc tgctacgcgc tcaccttcac ttccggtccc 360

gtcgccggca agacaatggt ggtgcagtca acgagcactg gcggcgacct gggaagtaac 420

cagttcgata tcgccatgcc cggcggcggc gtgggcatct tcaacggctg cagctcgcag 480

ttcggcggcc tccccggcgc tcaatacggc ggcatttcgt cgcgcgacca gtgcgattcc 540

ttccccgcgc cgctcaagcc cggctgccag tggcggtttg actggttcca gaacgccgac 600

aacccgacgt tcacgttcca gcaggtgcag tgccccgccg agatcgttgc ccgctccggc 660

tgcaagcgca acgacgactc cagcttcccc gtcttcaccc ccccaagcgg tggcaacggt 720

ggcaccggga cgcccacgtc gactgcgcct gggtcgggcc agacgtctcc cggcggcggc 780

agtggctgca cgtctcagaa gtgggctcag tgcggtggca tcggcttcag cggatgcacc 840

acctgtgtct ctggcaccac ctgccagaag ttgaacgact actactcgca gtgcctctaa 900

<210> 8

<211> 299

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 8

Met Arg Ser Thr Pro Val Leu Arg Thr Thr Leu Ala Ala Ala Leu Pro

1 5 10 15

Leu Val Ala Ser Ala Ala Ser Gly Ser Gly Gln Ser Thr Arg Tyr Trp

20 25 30

Asp Cys Cys Lys Pro Ser Cys Ala Trp Pro Gly Lys Ala Ala Val Ser

35 40 45

Gln Pro Val Tyr Ala Cys Asp Ala Asn Phe Gln Arg Leu Ser Asp Phe

50 55 60

Asn Val Gln Ser Gly Cys Asn Gly Gly Ser Ala Tyr Ser Cys Ala Asp

65 70 75 80

Gln Thr Pro Trp Ala Val Asn Asp Asn Leu Ala Tyr Gly Phe Ala Ala

85 90 95

Thr Ser Ile Ala Gly Gly Ser Glu Ser Ser Trp Cys Cys Ala Cys Tyr

100 105 110

Ala Leu Thr Phe Thr Ser Gly Pro Val Ala Gly Lys Thr Met Val Val

115 120 125

Gln Ser Thr Ser Thr Gly Gly Asp Leu Gly Ser Asn Gln Phe Asp Ile

130 135 140

Ala Met Pro Gly Gly Gly Val Gly Ile Phe Asn Gly Cys Ser Ser Gln

145 150 155 160

Phe Gly Gly Leu Pro Gly Ala Gln Tyr Gly Gly Ile Ser Ser Arg Asp

165 170 175

Gln Cys Asp Ser Phe Pro Ala Pro Leu Lys Pro Gly Cys Gln Trp Arg

180 185 190

Phe Asp Trp Phe Gln Asn Ala Asp Asn Pro Thr Phe Thr Phe Gln Gln

195 200 205

Val Gln Cys Pro Ala Glu Ile Val Ala Arg Ser Gly Cys Lys Arg Asn

210 215 220

Asp Asp Ser Ser Phe Pro Val Phe Thr Pro Pro Ser Gly Gly Asn Gly

225 230 235 240

Gly Thr Gly Thr Pro Thr Ser Thr Ala Pro Gly Ser Gly Gln Thr Ser

245 250 255

Pro Gly Gly Gly Ser Gly Cys Thr Ser Gln Lys Trp Ala Gln Cys Gly

260 265 270

Gly Ile Gly Phe Ser Gly Cys Thr Thr Cys Val Ser Gly Thr Thr Cys

275 280 285

Gln Lys Leu Asn Asp Tyr Tyr Ser Gln Cys Leu

290 295

Claims

1. a kind of trichoderma reesei, which is characterized in that the deposit number of the trichoderma reesei is CCTCC NO:M2016796.

2. trichoderma reesei described in claim 1 is expressing the application in one or more endogenous or foreign protein.

3. application as claimed in claim 2, which is characterized in that the albumen is hemicellulase, peroxidase, albumen Enzyme, cellulase, zytase, lipase, phosphatidase, esterase, cutinase, pectase, keratinase, reductase, oxidizing ferment, Phenol oxidase, lipoxygenase, lignoenzyme, amylopectase, tannase, pentosanase, malanase, 1,4 beta-glucanase, Ah Draw any one or more of primary glycosidase, hyaluronidase, chondroitinase, laccase, amylase, glucoamylase.

4. application as claimed in claim 2, which is characterized in that the albumen be acetylesterase, aminopeptidase, amylase, Ah Draw primary carbohydrase, arabinofuranosidase, carboxypeptidase, catalase, cellulase, chitinase, renin, cutinase, Deoxyribonuclease, epimerase, esterase, alpha-galactosidase, beta galactosidase, alpha-glucanase, glucan are split Solve enzyme, endo-beta-glucanase, glucoamylase, glucose oxidase, alpha-Glucosidase, β-glucosyl enzym, glucuronic acid glucosides Enzyme, hemicellulase, hexoxidase, hydrolase, invertase, isomerase, laccase, lipase, lyases, mannosidase, Oxidizing ferment, oxidoreducing enzyme, transelminase, pectin acetyl esterases, Pectin depolymerase, pectin methylesterase, pectin lyase Enzyme, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, rhamnose galacturonic acid enzyme, ribose Nuclease, thaumatin, transferase, transport protein, transglutaminase, zytase, any in hexoxidase Kind is several.

5. a kind of trichoderma reesei recombinant bacterial strain, which is characterized in that the recombinant bacterial strain is the expression that will carry target gene Carrier is transformed into what building in trichoderma reesei described in claim 1 obtained.

6. trichoderma reesei recombinant bacterial strain as claimed in claim 5, which is characterized in that the target gene is cellulase base Cause.

7. trichoderma reesei recombinant bacterial strain as claimed in claim 6, which is characterized in that the nucleotide of the cellulose enzyme gene Sequence is SEQ ID NO:5 or SEQ ID NO:7.

8. trichoderma reesei recombinant bacterial strain as claimed in claim 5, which is characterized in that the expression vector is eukaryotic expression load Body.

9. trichoderma reesei recombinant bacterial strain as claimed in claim 5, which is characterized in that the expression vector is PC2G carrier.

10. application of the trichoderma reesei recombinant bacterial strain described in claim 5 in production cellulase.