CN109957567B

CN109957567B - siRNA molecule for inhibiting PCSK9 gene expression and application thereof

Info

Publication number: CN109957567B
Application number: CN201711431616.4A
Authority: CN
Inventors: 张必良; 杨秀群; 王玮
Original assignee: Agna Biopharmaceutical Co ltd
Current assignee: Agna Biopharmaceutical Co ltd
Priority date: 2017-12-26
Filing date: 2017-12-26
Publication date: 2022-09-23
Anticipated expiration: 2037-12-26
Also published as: CN109957567A

Abstract

The invention relates to an siRNA molecule for inhibiting PCSK9 gene expression and a pharmaceutical composition thereof, and a method for reducing the expression level of PCSK9 gene by using the siRNA molecule or the pharmaceutical composition thereof. The siRNA molecules can be used for treating and/or preventing PCSK9 gene mediated diseases, including cardiovascular diseases and neoplastic diseases.

Description

siRNA molecule for inhibiting PCSK9 gene expression and application thereof

Technical Field

The invention relates to the field of biomedicine. Specifically, the invention relates to siRNA molecules for inhibiting PCSK9 gene expression by an RNA interference technology and application thereof.

Background

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA-induced, highly efficient and specific degradation of homologous mrnas during evolution. RNAi is widely present in natural species. The first RNAi phenomenon was discovered in nematodes (Caenorhabditis elegans, C.elegans) by Andrew Fire and Craig Mello et al in 1998. Tuschl and Phil Sharp et al have demonstrated in 2001 that RNAi is also present in mammals. After that, a series of progress has been made in studies on the mechanism of RNAi, gene function, clinical application, and the like. RNAi plays a key role in a variety of body protection mechanisms, such as protection against viral infection, prevention of transposon jumping, etc. (Hutv-gner et al, 2001; Elbashir et al, 2001; Zamore, 2001). Products developed based on RNAi mechanism are promising candidate drugs.

Small interfering RNAs (sirnas) are capable of exerting an RNA interference effect. Elbashir et al, 2001 found that siRNAs inhibited specific gene silencing in mammalian cells. Studies have shown that sirnas specifically bind to and degrade target mrnas with complementary sequences. The long-fragment double-stranded RNA is cleaved into short-fragment RNA by Dicer enzyme. siRNA molecules consist of two strands, where the strand that binds to the target mRNA is called the antisense or guide strand, and the other strand is called the sense or passenger strand. Researches show that the siRNA chemically synthesized in vitro can also play an RNA interference role after entering cells, and effectively reduce the immune response caused by long-chain RNA. Therefore, siRNA becomes a major tool for RNAi.

Subtilisin Proprotein convertase 9 (protein convertase subtilisin/kexitype 9, PCSK9) is a member of the subtilisin serine protease family, which is involved in regulating the levels of Low Density Lipoprotein Receptor (LDLR) proteins. The liver is the major site for expression of PCSK 9. Other important sites for PCSK9 expression include the pancreas, kidney, and intestine. Low Density Lipoprotein Receptor (LDLR) prevents atherosclerosis and hypercholesterolemia by clearing Low Density Lipoprotein (LDL) from the blood. Overexpression studies have shown that PCSK9 can control the levels of LDLR. Meanwhile, research finds that: the blood cholesterol levels decreased following PCSK9 gene knock-out in mice, and showed increased sensitivity to statins in lowering blood cholesterol. The above studies show that inhibitors of PCSK9 may be beneficial for the reduction of LDL-C (low density lipoprotein-cholesterol) concentrations in the blood, and for the treatment of PCSK 9-mediated diseases.

At present, inhibitors targeting PCSK9 have been reported and are used for treating blood lipid diseases, but other inhibitors aiming at the target point still need to be developed, so that the inhibitors have better curative effect, specificity, stability, targeting property or tolerance and the like.

Disclosure of Invention

The application provides a siRNA molecule for inhibiting PCSK9 gene expression, a kit and a pharmaceutical composition thereof, and a method and application of the molecule, the kit or the pharmaceutical composition in inhibiting or reducing PCSK9 gene expression or treating PCSK9 gene-mediated diseases or symptoms.

Specifically, the present application relates to the invention described in the following items.

[1] An siRNA molecule for inhibiting the expression of PCSK9 gene, which comprises a sense strand and an antisense strand complementary to form a double strand,

wherein the sense strand and/or antisense strand comprises or consists of 15-27 nucleotides and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 consecutive nucleotides of SEQ ID No. 1;

and also,

wherein at least one nucleotide in the siRNA molecule is modified.

[2] The siRNA molecule according to item [1], wherein the sense strand of said siRNA molecule comprises the nucleotide sequence of SEQ ID NO 1 or the nucleotide sequence of SEQ ID NO 2; the antisense strand of the siRNA molecule comprises the nucleotide sequence of SEQ ID NO. 3.

[3] The siRNA molecule according to item [1] or [2], wherein the modification comprises Locked Nucleic Acid (LNA), Unlocked Nucleic Acid (UNA), 2 '-methoxyethyl, 2' -O-alkyl, 2 '-O-methyl, 2' -O-allyl, 2 '-C-allyl, 2' -fluoro, 2 '-deoxy, 2' -hydroxy, phosphate backbone, DNA, fluorescent probe, ligand modification or a combination thereof, preferably 2 '-O-methyl, DNA, 2' -fluoro, thio modified phosphate backbone or a combination thereof.

[4] The siRNA molecule according to item [3], wherein the sense strand and the antisense strand are selected from the group consisting of: chains 1 and 2; chains 3 and 5; chains 3 and 6; chains 3 and 7; chains 3 and 8; chains 9 and 4; chains 9 and 5; chains 9 and 6; chains 9 and 7; and chains 9 and 8.

[5] The siRNA molecule of item [3], wherein said ligand modification is performed at the 3 'end, 5' end or in the middle of the sequence of the siRNA molecule;

wherein the ligand moiety is Xm, wherein X is the same or different ligand, X is selected from the group consisting of cholesterol, biotin, vitamin, galactose derivatives or analogues, lactose derivatives or analogues, N-acetylgalactosamine derivatives or analogues, N-acetylglucosamine derivatives or analogues, and any combination thereof, and m is the number of ligands, preferably, m is any one of integers from 1 to 5, more preferably, m is any one of integers from 2 to 4, and most preferably, m is 3.

[6] The siRNA molecule according to item [5], wherein X has the structure Z:

wherein, CH in the structure of Z ₂ The values of n for the groups are independently selected from 1 to 15; preferably, the value of n in the Z structure is 3 or 8;

more preferably, when m is 2, 3 or 4, the ligand moiety is (Z) ₂ 、(Z) ₃ Or (Z) ₄ Most preferably, (Z) ₂ 、(Z) ₃ Or (Z) ₄ The values of n in (1) are equal. .

[7] The siRNA molecule of item [4], further comprising a ligand and/or a fluorescent modification, the ligand modification moiety being Xm, wherein X is the same or different ligand, X is selected from the group consisting of cholesterol, biotin, vitamin, galactose derivative or analog, lactose derivative or analog, N-acetylgalactosamine derivative or analog, N-acetylglucosamine derivative or analog, and any combination thereof, m is the number of ligands, preferably, m is any one of 1 to 5, more preferably, m is any one of 2 to 4, most preferably, m is 3.

[8] The siRNA molecule according to item [7], wherein the sense strand and the antisense strand are selected from the group consisting of: chains 13 and 8; chains 17 and 8; chains 19 and 8; chains 20 and 8; chains 13 and 10; chains 17 and 10; chains 19 and 10; chains 20 and 10; chains 14 and 10; chains 18 and 10; chains 21 and 10; chains 22 and 10.

[9] The siRNA molecule according to item [7], having the structure:

A:GACGAUGCCUGCCUCUACU-(X)m；

fAmGfUfAfG(s) dA(s) dG(s) dGfCfAfG(s) dG(s) dC(s) dAfCmGfUfC(s) mC; or

B:mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-(X)m；

fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC；

Wherein the structure of X is Z:

m has a value of 2 or 3 or 4;

independently, CH in each Z ₂ The value of n of the group is selected from 1 to 15;

preferably, when m is 2, 3 or 4, the ligand moieties are each (Z) ₂ 、(Z) ₃ Or (Z) ₄ And (Z) ₂ 、(Z) ₃ Or (Z) ₄ The values of n in (2) are equal.

[10] The siRNA molecule according to item [9], wherein n is 3 or 8.

[11] The siRNA molecule according to any one of items [1] to [10], wherein said siRNA molecule inhibits the expression of PCSK9 gene in human or monkey.

[12] A pharmaceutical composition comprising the siRNA molecule of any one of items [1] to [11] and a pharmaceutically acceptable additional component.

[13] A method of inhibiting or reducing the level of PCSK9 gene expression in a cell in vivo or in vitro comprising introducing into the cell the siRNA molecule of any one of items [1] to [11], or the pharmaceutical composition of item [12], such that PCSK9 gene expression level is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%.

[14] Use of an siRNA molecule according to any one of items [1] to [11] or a pharmaceutical composition according to item [12] for the manufacture of a medicament for inhibiting or reducing the level of expression of a cellular PCSK9 gene in vivo or in vitro, or for the manufacture of a medicament for treating a disease or condition mediated by the PCSK9 gene in a subject.

[15] The use according to item [14], wherein the disease or condition mediated by the PCSK9 gene comprises a cardiovascular disease or a neoplastic disease, preferably, the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia, and the neoplastic disease is selected from melanoma, hepatocellular carcinoma, and metastatic liver cancer.

[16] A kit comprising the siRNA molecule according to any one of items [1] to [11 ].

[17] A method of treating a disease or condition mediated by the PCSK9 gene in a subject, comprising administering to the subject an siRNA molecule of any one of items [1] to [11], or a pharmaceutical composition of item [12 ].

[18] The use of item [17], wherein the disease or condition mediated by the PCSK9 gene comprises a cardiovascular disease or a neoplastic disease, preferably, the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia.

[19] Use of an siRNA molecule according to any one of items [1] to [11] or a pharmaceutical composition according to item [12] for the manufacture of a medicament for inhibiting or reducing the level of expression of the PCSK9 gene in a cell in vivo or in vitro.

[20] The siRNA molecule of any one of items [1] to [11] or the pharmaceutical composition of item [12], for use in inhibiting or reducing the level of expression of the PCSK9 gene in a cell in vivo or in vitro.

Embodiments of the present invention will be described in detail below with reference to the drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for illustrating the present invention and are not to be construed as limiting the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the accompanying drawings and the following detailed description of the preferred embodiments.

Drawings

FIGS. 1A-C show binding curves of GalNAc-siRNA of the present invention to a receptor.

Figure 2 shows ex vivo organ imaging performed 6 hours post-euthanasia after dosing.

Figure 3 shows ex vivo organ imaging performed 6 hours post-euthanasia after dosing.

Sequence information

Information on the sequences to which the present invention relates is provided in the following table:

the basic sequence (unmodified) is as follows:

sequence No. (SEQ ID NO:)
		1	GACGAUGCCUGCCUCUACUUU (sense chain)
2	GACGAUGCCUGCCUCUACU (sense chain)
		3	AGUAGAGGCAGGCAUCGUCCC (antisense strand)

The individual strands and their composition in each siRNA molecule referred to in this application are as follows:

note:

"G", "C", "A", "T" and "U" generally represent nucleotides having guanine, cytosine, adenine, thymine and uracil as bases, respectively.

Modification: d ═ DNA; m ═ 2' -O-methyl; f ═ 2' -fluoro; (s) ═ PS backbone (i.e., thio-modified phosphate backbone); l ═ L type ligands; s ═ S type ligand; cy5 ═ fluorescent label Cy 5.

Detailed Description

Hereinafter, embodiments of the present invention will be described in more detail.

The invention provides an siRNA molecule that inhibits the expression of the PCSK9 gene, comprising a sense strand and an antisense strand that are complementary to form a double strand, the sense strand and/or antisense strand comprising or consisting of 15-27 nucleotides, and the antisense strand being complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides of SEQ ID No. 1, and wherein at least one nucleotide in the siRNA molecule is modified.

As used herein, the term "antisense strand" refers to a strand of an siRNA that comprises a region that is completely or substantially complementary to a target sequence. As used herein, the term "complementary region" refers to a region of the antisense strand that is completely or substantially complementary to a target mRNA sequence. In the case where the complementary region is not fully complementary to the target sequence, the mismatch may be located in an internal or terminal region of the molecule. Typically, the most tolerated mismatches are in the terminal region, e.g., within 5, 4, 3, 2 or 1 nucleotides of the 5 'and/or 3' end. The portion of the antisense strand most sensitive to mismatches is referred to as the "seed region". For example, in an siRNA comprising 19nt strands, the 19 th position (counting from 5 'to 3') can tolerate some mismatches.

As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions, such as stringent conditions. For example, stringent conditions may include 400mM NaCl, 40mM PIPES pH 6.4, 1mM EDTA at 50 ℃ or 70 ℃ for 12-16 hours.

As used herein, the term "sense strand" refers to a strand of an siRNA that includes a region that is substantially complementary to a region that is the term antisense strand as defined herein.

The antisense and sense strands of the siRNA can be of the same or different lengths, as described herein and as known in the art.

The siRNA molecules promote sequence-specific degradation of PCSK9mRNA by RNAi effects, resulting in inhibition of PCSK gene expression or reduction of the level of PCSK9 gene expression, e.g., a 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5% reduction in the level of PCSK9 gene expression.

At least 70%, 80%, 90%, 95%, or 100% of the nucleotides of each strand of the siRNA molecule are ribonucleotides, but may also comprise one or more non-ribonucleotides, such as deoxyribonucleotides.

In some embodiments, at least one nucleotide in the siRNA molecules of the invention is modified. While many modifications can be attempted to improve the performance of siRNA, these attempts are often difficult to elucidate both mediating RNA interference and having increased stability in serum (e.g., having increased resistance to nucleases and/or extended duration). The modified siRNA of the present invention has high stability while maintaining high inhibitory activity.

Modifications suitable for the present invention may be selected from the group comprising: locked Nucleic Acids (LNA), Unlocked Nucleic Acids (UNA), 2 '-methoxyethyl, 2' -O-alkyl, 2 '-O-methyl, 2' -O-allyl, 2 '-C-allyl, 2' -fluoro, 2 '-deoxy, 2' -hydroxy, phosphate backbone, fluorescent probes, ligand modifications, or combinations thereof. Preferred modifications are 2' -O-alkyl such as 2' -O-methyl, DNA, 2' -fluoro, thio-modified phosphate backbone and combinations thereof.

In a specific embodiment of the present invention, preferred modifications include: (1) antisense strand: the first nucleotide at the 5 'end is a 2' -fluoro modification, the second nucleotide is a 2 '-O-methyl modification, the middle region is fNfN(s) dN(s) dNfN(s) dN repeat, the 3' end has a 5'(s) mN) 3' overhang, the nucleotides between the overhang and the middle region are modified with 2 '-O-methyl or 2' -fluoro, and have at most 2 consecutive 2 '-fluoro or 2' -O-methyl modifications. (2) No modification of the sense strand, or all nucleotides of the sense strand are modified: the nucleotide of 12nt at the 5' end is modified by mNNmNFNfNfNmNNmNNfNfN, and the nucleotide of 3nt at the 3' end is modified by 2' -O-methyl; the intermediate nucleotide is modified with 2 '-O-methyl or 2' -fluoro and has at most 2 consecutive 2 '-fluoro or 2' -O-methyl modifications. In some embodiments, the siRNA molecules provided herein are selected from RBP9-005-P1G1, RBP9-005-P2G2, RBP9-005-P2G3, RBP9-005-P2G4, RBP9-005-P2G5, RBP9-005-P2G6, RBP9-005-P3G2, RBP9-005-P3G3, RBP9-005-P3G4, RBP9-005-P3G5, and RBP9-005-P3G6 shown in Table 5.

In some embodiments, the chemically modified siRNA molecule is preferably RBP9-005-P2G6 or RBP9-005-P3G 6.

In some embodiments, ligand modification can be at the 3 'end, the 5' end, or in the middle of the sequence of the siRNA molecule. In some embodiments, the ligand may be a moiety that is taken up by the host cell. Ligands suitable for the present invention include cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, or combinations thereof. Preferably, the ligand modification is a modification of an N-acetylgalactosamine derivative or analog.

Ligand modification can improve the cellular uptake, intracellular targeting, half-life, or drug metabolism or kinetics of the siRNA molecule. In some embodiments, the ligand-modified siRNA has enhanced affinity or cellular uptake for a selected target (e.g., a particular tissue type, cell type, organelle, etc.), preferably hepatocytes, as compared to an siRNA that is not modified with a ligand. Preferred ligands do not interfere with the activity of the siRNA.

In some embodiments, the siRNA of the invention may comprise one or more ligand modifications, preferably comprising 1-5, 2-4 or 3 ligand modifications, preferably N-acetylgalactosamine derivatives/analogs.

In some embodiments, the structure of the N-acetylgalactosamine derivative ligand modifying moiety is Z:

in some embodiments, the ligand-modified siRNA molecule is selected from any one of the siRNA molecules P2G6-03L, P2G6-03S, P3G6-03L and P3G6-03S shown in Table 8 and P2G6-13L, P2G6-13S, P3G6-13L and P3G6-13S shown in Table 10.

In some embodiments, the ligand-modified siRNA molecule has the structure:

GACGAUGCCUGCCUCUACU-ZZZ；

fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC

(s) mC; or

mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-ZZZ；

fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC

(s)mC(s)mC；

Wherein the ZZZ structure is linked to the 3' terminal nucleotide of the sense strand of the siRNA through a phosphodiester linkage, and each Z is linked to an adjacent Z through a phosphodiester linkage; wherein the ZZZ structure linked to siRNA is as follows:

each Z being CH ₂ The values of n for the groups are independently selected from 1 to 15; preferably, n in the ZZZ structure is equal.

In one embodiment, n in the ZZZ structure is both 3. When n is 3, Z can be represented by L.

In one embodiment, n in the ZZZ structure is both 8. When n is 8, Z can be represented by S. Each strand of the siRNA molecules of the invention can have 0% to 100% modified nucleotides, such as 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% or more modified nucleotides in each strand. The modification may be in the overhang region or the double-stranded region. The modifications of the invention can be used to improve in vitro or in vivo characteristics of siRNA molecules, such as stability, biodistribution, inhibitory activity, and the like. The modifications of the present invention may be used in combination.

Each strand of the siRNA molecules of the invention has a pendant or blunt end. Either or both of the antisense or sense strands may be pendulous or dangling at their 5 'and/or 3' ends. The pendent end can have 1-8 overhangs, preferably 2, 3, 4, 5, or 6 overhangs, wherein the overhangs are any selected from U, A, G, C, T, dT.

In some embodiments, the siRNA molecules of the invention inhibit PCSK9 gene expression in humans or monkeys.

In some embodiments, the present invention also provides a vector that inhibits PCSK9 gene expression in a cell, which expresses at least one strand of an siRNA molecule of the invention. As used herein, the term "vector" refers to a nucleic acid molecule capable of amplifying or expressing another nucleic acid to which it is linked.

In some embodiments, the invention also provides a kit comprising an siRNA molecule or vector of the invention.

In some embodiments, the invention also provides a pharmaceutical composition comprising an siRNA molecule or vector of the invention and a pharmaceutically acceptable additional component. In one embodiment, the composition of the invention comprises a pharmacologically effective amount of the siRNA molecule or vector of the invention and a pharmaceutically acceptable additional component. As used herein, the term "effective amount" refers to an amount of the siRNA molecule effective to produce the desired pharmacological therapeutic effect. "other components" include water, saline, dextrose, buffers (e.g., PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, preservatives, or any combination thereof.

In some embodiments, the present invention also provides a method of inhibiting or reducing the level of PCSK9 gene expression in a cell in vivo or in vitro, comprising introducing into the cell an siRNA molecule, vector, kit or pharmaceutical composition of the invention such that PCSK9 gene expression level is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, at least 5%. As used herein, the term "introduced" refers to facilitating uptake or absorption into a cell, which may occur through non-assisted diffusion or active cellular processes, or through auxiliary reagents or devices. When introduced into cells in vivo, the siRNA can be injected into the target tissue or administered systemically. Introduction into cells in vitro can be by methods known in the art, such as electroporation.

The cell is preferably a mammalian cell, e.g., a primate cell, such as a human cell, expressing PCSK 9. Preferably, the PCSK9 gene is expressed at high levels in the target cell. More preferably, the cell is derived from brain, salivary gland, heart, spleen, lung, liver, kidney, intestinal tract or tumor. More preferably, the cell is a liver cancer cell or a cervical cancer cell. Even more preferably the cell is selected from HepG2 and HeLa cells.

In the in vitro method, the cellular final concentration of the siRNA molecule is 0.1-1000nM, preferably 10-500nM, 25-300nM, or 50-100 nM.

Detection of the level of the target gene, target RNA or target protein can be used to predict or assess the activity, efficacy or therapeutic outcome of the siRNA. Detection of the target gene, target RNA or target protein level can be performed using methods known in the art.

In some embodiments, the present invention provides an in vivo method comprising alleviating or treating a disease or condition mediated by the PCSK gene in a subject, including cardiovascular disease, dyslipidemia; cardiovascular disease may include atherosclerotic cardiovascular disease, and dyslipidemia may include elevated serum cholesterol and/or triglyceride levels, elevated low density lipoprotein cholesterol, or elevated apolipoprotein b (apob). Preferably the disease or condition is hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia. The subject may be a mammal, preferably a human.

As used herein, the term "hypercholesterolemia" refers to a condition characterized by elevated serum cholesterol. The term "hyperlipidemia" refers to a condition characterized by elevated serum lipids. The term "non-familial hypercholesterolemia" refers to a condition characterized by elevated cholesterol that is not caused by a single genetic gene mutation. The term "polygenic hypercholesterolemia" refers to a condition characterized by elevated cholesterol caused by the influence of multiple genetic factors. The term "Familial Hypercholesterolemia (FH)" refers to an autosomal dominant metabolic disorder characterized by mutations in the LDL-receptor (LDL-R), significantly elevated LDL-C and premature onset of atherosclerosis (prematurity onset). The term "homozygous familial hypercholesterolemia" or "HoFH" refers to a condition characterized by mutations in the maternal and paternal LDL-R genes. The term "heterozygous familial hypercholesterolemia (heterozygosity) or" HoFH "refers to a condition characterized by a mutation in the maternal or paternal LDL-R gene.

The PCSK gene-mediated disease or condition may be caused by PCSK9 gene overexpression, PCSK9 protein overproduction, and may be modulated by down-regulation of PCSK9 gene expression. As used herein, the term "treatment" refers to the alleviation, alleviation or cure of a disease or condition mediated by the PCSK9 gene, such as a reduction in blood lipid levels, including a reduction in serum LDL, LDL-C levels. In some embodiments, the level or concentration of serum LDL, serum LDL-C is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, or 90%.

In vivo methods, the pharmaceutical composition may be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, arterial, peritoneal, or subcutaneous injection. Modes of administration include, but are not limited to, single administration or multiple administrations. The administration dose may range from 0.1mg/kg to 100mg/kg, 0.5mg/kg to 50mg/kg, 2.5mg/kg to 20mg/kg, 5mg/kg to 15mg/kg, preferably 3mg/kg, 10mg/kg, 33mg/kg, more preferably 10mg/kg, most preferably 33 mg/kg.

In another aspect, the invention also provides a method of combination therapy comprising co-administration of one or more sirnas of the invention or a pharmaceutical composition comprising the same with one or more other therapeutic agents or in combination with other methods of treatment. Other therapeutic agents may include agents known to prevent, ameliorate or treat lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia, e.g., cholesterol absorption inhibitors, lipid lowering agents, analgesics, anti-inflammatory agents, antineoplastic agents, and the like. Other treatment methods include radiation therapy, immunotherapy, hormonal therapy, surgical therapy, and the like.

The siRNA molecules of the present invention produce a number of beneficial effects: 1. the modified siRNA molecules have high stability and high inhibitory activity; 2. the ligand-modified siRNA molecule has better liver targeting property and the capability of promoting endocytosis of cells while keeping higher inhibitory activity and stability, and can reduce the influence on other tissues or organs and reduce the using amount of the siRNA molecule, thereby achieving the purposes of reducing toxicity and reducing cost; 3. the ligand-modified siRNA molecules can enter target cells and target tissues without transfection reagents, and the negative effects of the transfection reagents, such as cell or tissue toxicity, are reduced. Thus, the ligand-modified siRNA molecules of the present invention provide the possibility of targeted therapy.

Abbreviations, acronyms and numbering descriptions

Rel (relative exprseeion level): relative mRNA expression levels.

GalNAc: n-acetylgalactosamine.

Modification: n ═ RNA; dN ═ DNA; mN ═ 2' -O-methyl modification; fN-2' -fluoro modification; (s) ═ PS backbone (i.e., 5' -thio modified phosphate backbone).

For short: RBP9-005-P3G6 may be abbreviated as P3G6, and so on.

Numbering: the first position after the broken line of P3G6 represents whether a fluorescent label exists (0 represents 'none', 1 represents 'present'), the second position represents the number of the ligands, and the third position represents the type of the ligands, for example, P3G6-13L represents that P3G6 is subjected to fluorescent label and ligand modification of 3L; and so on.

Examples

Example 1PCSK9-siRNA Activity screening

siRNA design

According to the human PCSK9mRNA sequence, a plurality of pairs of PCSK 9-siRNAs are designed by selecting different sites, all single siRNAs are designed to target all transcripts of target genes (such as shown in Table 1), and the plurality of pairs of siRNAs have the lowest homology with all other non-target gene sequences through sequence similarity software. Sequence design methods are referenced to Elbashir et al.2002; paddison et al.2002; reynoldset al.2004; the method of Ui-Tei et al 2004 et al.

TABLE 1 target genes

Target genes	Species (II)	Gene ID	NM_ID
				PCSK9	Homo sapiens (human)	255738	NM_174936.3

SiRNA synthesis

The oligonucleotides containing 2' -hydroxyl ribonucleotides of the invention were all synthesized according to the theoretical yield of 1 umol. 1umol general solid phase support CPG or 3 '-cholesterol modified CPG (purchased from Chemtenes), 2' -O-TBDMS RNA phosphoramidite protected monomer, DNA monomer, 2 '-methoxy monomer and 2' -fluoro monomer (purchased from Sigma Aldrich) are weighed and dissolved in anhydrous acetonitrile solution to reach a concentration of 0.2M. For the phosphate backbone thio-modified oligonucleotides, 0.2M PADS solution was used as the thioreagent. 5-ethylthio-1H-tetrazole (purchased from Chemgenes) acetonitrile solution is prepared as an activating agent (0.25M), 0.02M iodine pyridine/water solution is prepared as an oxidizing agent, and 3% trichloroacetic acid dichloromethane solution is prepared as a deprotection reagent, and the deprotection reagent is placed at a reagent designated position corresponding to an ABI 394 model DNA/RNA automatic synthesizer. The synthesis program was set up and the indicated oligonucleotide base sequences were entered. After checking for errors, the cycle oligonucleotide synthesis is started. The coupling time of each step is 6 minutes, and the coupling time of the galactose ligand corresponding to the L and S monomers is 10-20 minutes. After automatic circulation, the oligonucleotide solid phase synthesis is completed. The CPG was blown dry with dry nitrogen, transferred to a 5ml EP tube, and 2ml ammonia/ethanol solution (3/1) was added and heated at 55 ℃ for 16-18 hours. Centrifuging at 10000rpm for 10min, collecting supernatant, and draining off concentrated ammonia water/ethanol to obtain white colloidal solid. The solid was dissolved in 200. mu.l of 1M TBAFTHF and shaken at room temperature for 20 hours. Then 0.5ml of 1M Tris-HCl buffer (pH 7.4) was added, shaken at room temperature for 15 minutes, and placed in a centrifugal pump to 1/2 in volume, and THF was removed. The resulting solution was extracted 2 times with 0.5ml chloroform, 1ml of 0.1M TEAA loading was added, the mixed solution was poured into a solid phase extraction column, and excess salt was removed from the solution. The concentration of the obtained oligonucleotide was measured by a micro ultraviolet spectrophotometer (KO 5500). Mass spectrometric detection analysis was performed on an Oligo HTCSLC-MS system (Novatia). Nucleic acid molecular weights were calculated by normalization after the primary scan using Promass software.

The invention only contains deoxyribonucleotide or 2' -methoxyl or 2' -fluorine or LNA or 2' -MOE modified oligonucleotide according to the theoretical yield of 1umol synthesis specification. 1umol standard general solid support CPG or 3' -cholesterol modified CPG (purchased from Chemmenes), DNA monomer, 2' -methoxy monomer, and 2' -fluoro monomer (purchased from Sigma Aldrich) were weighed and dissolved in anhydrous acetonitrile solution to a concentration of 0.2M. For the phosphate backbone thio-modified oligonucleotides, 0.2M PADS solution was used as the thioreagent. 5-ethylthio-1H-tetrazole (purchased from Chemgenes) acetonitrile solution is prepared as an activating agent (0.25M), 0.02M iodine pyridine/water solution is prepared as an oxidizing agent, and 3% trichloroacetic acid dichloromethane solution is prepared as a deprotection reagent, and the deprotection reagent is placed at a reagent designated position corresponding to an ABI 394 model DNA/RNA automatic synthesizer. The synthesis program was set up and the indicated oligonucleotide base sequences were entered. After checking, the cycle oligonucleotide synthesis is started. The coupling time of each step is 6 minutes, and the coupling time of the corresponding monomer of the galactose ligand is 6-10 minutes. After automatic circulation, the oligonucleotide solid phase synthesis is completed. The CPG was blown dry with dry nitrogen, transferred to a 5ml EP tube, and 2ml of aqueous ammonia was added and heated at 55 ℃ for 16-18 hours. Centrifuging at 10000rpm for 10min to obtain supernatant, and draining off concentrated ammonia water/ethanol to obtain white or yellow colloidal solid. 1ml of 0.1M TEAA loading solution was added, and the mixed solution was poured into a solid phase extraction column to remove excess salt from the solution. The concentration of the obtained oligonucleotide was measured by a micro ultraviolet spectrophotometer (KO 5500). Mass spectrometric detection analysis was performed on an Oligo HTCS LC-MS system (Novatia). Nucleic acid molecular weights were calculated by normalization after the primary scan using Promass software.

PCSK9-siRNA transfection of different cells

All cells were from ATCC, but could also be from other sources publicly available; other reagents are commercially available.

TABLE 2 cell names and classes

Cells were cultured in DMEM medium containing 10% fetal bovine serum in 5% CO ₂ And culturing in a constant temperature incubator at 37 ℃. Transfection with transfection reagent was performed when the cells were in logarithmic growth phase and in good condition (70% confluence). Adjusting the cell concentration to 1X 10 ⁶ mL, 6 well plates were loaded with mL cell solution and 5 μ LriboFect transfection reagent per well. Standing at room temperature for 5min, adding 5 μ L100 nsiRNA, and standing at 37 deg.C with 5% CO ₂ And (5) incubating for 48 h.

For each cell plating, in addition to the test groups, the following control groups were set: NC is negative control (irrelevant siRNA), Mock is transfection reagent control group, untreated control group (UT group, no siRNA). There were 3 replicates in both the test and control groups.

Real-time quantitative PCR analysis of target mRNA levels

1. Cells were lysed 48h after transfection and total cellular RNA was extracted by Trizol.

2. The Reverse Transcription mix Reverse Transcription kit was used for Reverse Transcription (Ruibo Biotech, Inc., Guangzhou).

3. Fluorescent quantitative PCR:

the beta-actin gene is used as an internal reference gene, and Real-time fluorescent quantitative PCR reaction is carried out by using a Real-time PCR kit SYBR Premix (2 x). The PCR reaction was performed using a CFX96 fluorescent quantitative PCR instrument from Bio-Rad, USA. The primers used were:

TABLE 3 primers

4. Data analysis

After the PCR reaction was completed, the Ct error for 9 replicates (3 transfection replicates, 3 qPCR replicates per sample) of one sample was. + -. 0.5. Relative quantification was performed using CFX 2.1. Table 4 shows the average of the expression levels of the target genes relative to the NC group (the relative expression level of mRNA of the NC group is 1). The results of the real-time quantitative PCR detection of the preferred siRNA are shown in the following table.

TABLE 4 real-time quantitative PCR detection results

PCSK9siRNA screening in HepG2 and HeLa finds that the siRNA molecule with higher activity in HeLa and HePG2 cells, namely RBP 9-005.

Example 2PCSK9-siRNA optimization

RBP9-005 was optimized for different modifications, and the steps of synthesis, transfection, and quantitative PCR detection were the same as in example 1. The transfected cells were HeLa and HePG2 cells, and the results are shown in Table 5 (REL-H: the relative expression level of PCSK9mRNA in HeLa cells; REL-2: the relative expression level of PCSK9mRNA in HePG2 cells). Table 5 shows the average of the expression levels of the target genes relative to the NC group (the relative mRNA expression level of the NC group is 1). Wherein NC is irrelevant siRNA negative control group, Mock is transfection reagent control group, and UT is untreated cell control group.

TABLE 5RBP9-005 optimization

The results show that the chemically modified RBP9-005-P2G6 and RBP9-005-P3G6 have higher inhibitory activity in HeLa and HePG2 cells.

Example 3GalNAc-siRNA cell targeting assay

Preparation of ligand modified siRNA

1. Synthesis of galactose-modified monomer L

(1) Synthesis of Compound 1

In a 1L round-bottomed flask, delta-valerolactone (100g, 1mol), sodium hydroxide (40g, 1mol) and 400mL of deionized water were mixed and reacted at 70 ℃ for 6 hours, and the reaction was monitored by TCL for completion. The reaction solution was spin-dried, and 200ml of toluene was added thereto to obtain 140g of a white solid.

(2) Synthesis of Compound 2

In a 1L round bottom flask, compound 1(140g, 1mol), anhydrous acetone 500mL, benzyl bromide (205.2g, 1.2mol), and the catalyst tetrabutylammonium bromide (16.2g, 0.05mol) were added and heated to reflux. The reaction was monitored by TLC and was complete after 24 h. The reaction mixture was cooled to room temperature, and acetone was removed under reduced pressure. The residue was dissolved in 500mL of ethyl acetate and washed with 200mL of saturated sodium hydrogensulfate, 200mL of saturated sodium hydrogencarbonate and 200mL of saturated brine in this order. The organic phase was dried over anhydrous sodium sulfate, concentrated, and separated by a silica gel column (petroleum ether: ethyl acetate V: V ═ 1: 1) to give 175g of a transparent oily liquid in a yield of 84%.

(3) Synthesis of Compound 3

In a 1L round bottom flask, D-galactose hydrochloride (100g, 0.46mol) and 450mL of anhydrous pyridine were added, and 325mL of acetic anhydride, triethylamine (64.5mL, 0.46mol) and DMAP (2g,0.016mol) were slowly added while cooling on ice. The reaction was carried out overnight at room temperature, and a large amount of solid was precipitated. Suction filtration is carried out, and the filter cake is rinsed with 200mL of 0.5N HCl solution, thus obtaining 162.5g of white solid with 90% yield. ¹ H NMR(400MHz,DMSO-d6)δ：7.88(d,J＝9.2Hz,1H),5.63(d,J＝8.8Hz,1H),5.26(d,J＝3.1Hz,1H),5.05(d,J＝11.3,3.3Hz,1H),4.36(m,4H),2.11(s,3H),2.03(s,3H),1.98(s,3H),1.90(s,3H),1.78(s,3H).

(4) Synthesis of Compound 4

A250 mL round bottom flask was charged with compound 3(10g,25.7mmol) and 100mL of anhydrous dichloromethane. After stirring for 10min trimethylsilyl trifluoromethanesulfonate (7mL,38.7mmol) was added. The reaction was then allowed to react overnight at room temperature, and the reaction was slowly poured into an aqueous solution (200mL) of sodium bicarbonate (7g,79.5mmol) and stirred for 0.5 h. The organic phase was separated and dried over anhydrous sodium sulfate. Concentration under reduced pressure gave 7.78g of a pale yellow colloid in 92% yield.

(5) Synthesis of Compound 5

In a 100mL round-bottom flask, compound 4(5g,15.2mmol) and compound 2(3.8g,18.25mmol) were dissolved in 50mL of anhydrous 1, 2-dichloroethane, and after stirring for 10 minutes trimethylsilyl trifluoromethanesulfonate (0.55mL,3mmol) was added. Often timesThe reaction was carried out overnight at room temperature. The reaction solution was extracted with dichloromethane. The obtained organic phase was washed twice with 50mL of saturated sodium bicarbonate, dried over anhydrous sodium sulfate, then concentrated under reduced pressure, and separated by a silica gel column (petroleum ether: ethyl acetate V: V ═ 3: 2) to obtain 6.94g of a transparent oily liquid, the yield being 85%. ¹ HNMR(400MHz,DMSO-d6)δ：7.69(d,J＝9.3Hz,1H),7.33–7.16(m,5H),5.28(d,J＝5.3Hz,1H),4.95(s,2H),4.93(q,J＝4.2Hz,1H),4.40(d,J＝8.6Hz,1H),4.00–3.86(m,3H),3.73–3.56(m,2H),3.36–3.21(m,1H),2.53(t,J＝8.2Hz,2H),2.11(s,3H),1.89(s,3H),1.83(s,3H),1.65(s,3H),1.59–1.36(m,4H).MS(ESI),m/z:560.2([M+Na] ⁺ ).

(6) Synthesis of Compound 6

In a 50mL round-bottomed flask, compound 5(3.3g,6.1mmmol), Pd/C (0.33g, 10%) were dissolved in 5mL of methanol and 20mL of ethyl acetate, followed by introduction of a hydrogen balloon and reaction at room temperature overnight. The reaction solution was filtered through celite, and then the celite was rinsed with methanol. The filtrate was concentrated under reduced pressure and spin-dried to give 2.8g of a white solid with a yield of 95.5%. ¹ HNMR(400MHz,DMSO-d6)δ：11.98(s,1H),7.79(d,J＝8.9Hz,1H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15–3.97(m,3H),3.89–3.79(m,1H),3.80–3.69(m,1H),3.46–3.36(m,1H),2.22-2.14(t,J＝7.2Hz,2H),2.15(s,3H),2.00(s,3H),1.95(s,3H),1.87(s,3H),1.59–1.42(m,4H).MS(ESI),m/z:470.5([M+Na] ⁺ ).

(7) Synthesis of Compound 7

The synthesis of the compound is described in Choi J Y et al. White solid, yield 89%. MS (ESI), M/z 248.2([ M + Na ]] ⁺ )。

(8) Synthesis of Compound 8

The compound 2 is synthesized by referring to the document of US 2011/0077389A 1. White solid, yield 56%. ¹ HNMR(400MHz,DMSO-d6)δ：7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27–7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.16(s,2H),4.63–4.58(m,1H),4.05–3.97(m,1H),3.74(s,6H),3.04–2.99(m,2H),2.95–2.90(m,2H).MS(ESI),m/z:416.3([M+Na] ⁺ ).

(9) Synthesis of Compound 9

To a 250mL round bottom flask, compound 6(10g, 22.35mmol), 1-ethyl- (3-dimethylaminopropyl) carbonyldiimine hydrochloride (edc. hcl) (5.14g, 26.82mmol), N-hydroxysuccinimide (2.83g, 24.59mmol) and dichloromethane 100mL were added. After stirring the reaction at room temperature for 0.5h, Compound 8(8.79g, 22.35mmol) was added. The reaction was monitored by TLC and after 4h the reaction was complete. The reaction mixture was washed with 50mL of saturated sodium bicarbonate and 50mL of saturated brine in this order, and the organic phase was dried over anhydrous sodium sulfate, then concentrated, and separated by a silica gel column (dichloromethane: methanol V: 20: 1) to obtain 15.8g of a white solid with a yield of 86%. MS (ESI), M/z 845.2([ M + Na ]] ⁺ ).

(10) Synthesis of Compound L monomer

To a 250mL two-necked flask, compound 1(5g,6.08mmol), nitrogen blanket, 100mL of anhydrous acetonitrile, bis (diisopropylamino) (2-cyanoethoxy) phosphine (3.66g,12.16mmol) and a solution of thioethyltetrazole in acetonitrile (2.5M) (1.22mL,3.04mmol) were added slowly dropwise with stirring. The reaction time is 0.5 h. The reaction was monitored by TLC and after 0.5h the reaction was complete. The acetonitrile was removed by concentration under reduced pressure. The concentrate was dissolved by adding 100mL of methylene chloride, and then washed with 100mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated and separated by silica gel column (petroleum ether: ethyl acetate V: V ═ 1: 3) to give 5.16g of white solid in 83% yield. ¹ H NMR(400MHz,DMSO-d6)δ：7.84-7.79(d,J＝8.9Hz,1H),7.65-7.60(d,J＝8.9Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15-3.97(m,3H),4.05-3.96(m,1H),3.84-3.80(m,2H),3.89-3.79(m,1H),3.74(s,6H),3.71-3.69(m,1H),3.46-3.36(m,1H)，3.04-2.99(m,2H),2.95-2.90(m,2H)，2.88-2.84(m,2H),2.59-2.54(m,2H),2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.77(s,12H)，1.59-1.42(m,4H).MS(ESI),m/z:1045.5([M+Na] ⁺ ).

2. Galactose S monomer synthesis

(1) Synthesis of Compound 10

To a 100mL round bottom flask, compound 4(5g,15.2mmol) and 10-undecenol (3.1g,18.24mmol) dissolved in 50mL anhydrous dichloromethane were added. After stirring for 10min trimethylsilyl trifluoromethanesulfonate (0.55mL,3.0mmol) was added. The reaction was carried out overnight at room temperature. The reaction solution was extracted with dichloromethane. The resulting organic phase was washed twice with 50mL of saturated sodium bicarbonate, then dried over anhydrous sodium sulfate, concentrated under reduced pressure, and separated by a silica gel column (petroleum ether: ethyl acetate V: V ═ 3: 2) to obtain 6.59g of a white solid with a yield of 87%. ¹ HNMR(400MHz,DMSO-d6)δ：7.82(d,J＝3.3Hz,1H),5.86-5.73(m,1H),5.22(s,1H),5.02-4.9(m,3H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:522.4([M+Na] ⁺ ).

(2) Synthesis of Compound 11

A100 mL round-bottom flask was charged with Compound 10(4g,8.02mmol), dichloromethane 50mL, acetonitrile 50mL, and deionized water 70 mL. Adding NaIO in portions ₄ (6.86g,32.1 mmol). Reacting for 48h at normal temperature. The TCL monitors the reaction for completion. To the reaction solution, 100mL of deionized water was added, followed by extraction three times with methylene chloride (50 mL. times.3). The organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure and dried by rotary drying to give 4.1g of a pale brown gum-like product in 99% yield. ¹ HNMR(400MHz,DMSO-d6)δ：11.99(s,1H),7.82(d,J＝3.3Hz,1H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:540.26([M+Na] ⁺ ).

(3) Synthesis of Compound 12

Reference compound 1 was synthesized as a white solid in 85.6% yield. MS (ESI), M/z 915.5([ M + Na ]] ⁺ ).

(4) Synthesis of Compound S

Reference compound L was synthesized as a white solid in 82.1% yield.

¹ HNMR(400MHz,DMSO-d6)δ：7.82-7.78(d,J＝7.3Hz,1H),7.69-7.63(d,J＝7.3Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27–7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),4.05–3.97(m,1H),3.9-3.88(m,1H),3.84–3.80(m,2H),3.74(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.04–2.99(m,2H),2.95–2.90(m,2H)，2.88–2.84(m,2H),2.61–2.55(m,2H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:1115.2([M+Na] ⁺ ).

3. GalNac-siRNA Synthesis

See example 1.

Second, isolation of mouse Primary hepatocytes

Mice were anesthetized and skin and muscle layers were cut to expose the liver. The perfusion catheter is inserted into the portal vein, and the inferior vena cava is cut to open a small opening to prepare for liver perfusion. Perfusate Solution I (Hank's, 0.5mM EGTA, pH 8) and perfusate Solution II (Low glucose DMEM, 100U/mL Type IV, pH 7.4) were preheated at 40 ℃. Perfusion Solution I at 37 ℃ was perfused into the liver along the portal vein cannula at a flow rate of 7mL/min for 5min until the liver turned off-white. The liver was then perfused with 37 ℃ perfusion Solution II at a flow rate of 7mL/min for 7 min. After perfusion was complete, the liver was removed and placed in Solution III (10% FBS in DMEM with low glucose, 4 ℃) to stop digestion, the liver envelope was scratched with forceps, and the hepatocytes were released by gentle shaking. The hepatocytes were filtered through a 70um cell filter, centrifuged at 50g for 2min and the supernatant discarded. The cells were resuspended in solutionIV (40% percoll low glucose DMEM, 4 ℃) and then centrifuged at 100g for 2min and the supernatant discarded. The cells were resuspended in 2% FBS in low glucose DMEM and ready for use. Trypan blue staining identifies cell viability.

Thirdly, determining GalNAc binding curve and Kd value

Freshly isolated mouse primary hepatocytes were plated in 96-well plates at 2X 10 ⁴ One/well, 100 ul/well. GalNAc-siRNA was added to each well. Final concentration is respectively set for each GalNAc-siRNAThe degrees were 0.9nM, 8.3nM, 25nM, 50nM, 100nM, 150 nM. After incubation for 2h at 4 ℃ 50g were centrifuged for 2min and the supernatant was discarded. 10ug/ml PI resuspended cells, stained for 10min and centrifuged at 50g for 2 min. Cells were washed with pre-cooled PBS and centrifuged at 50g for 2min before discarding the supernatant. Resuspend cells with PBS. The mean fluorescence intensity MFI of live cells was determined by flow cytometry and non-linear fit and Kd value calculation were performed using GraphPad Prism 5 software. The data in tables 6A-C and FIGS. 1A-C show that ligand-modified GalNAc-siRNA achieved delivery to hepatocytes by promoting in vitro endocytosis/uptake of hepatocytes without the addition of transfection reagents. Meanwhile, GalNAc-siRNA with different GalNac structures has certain difference in the endocytosis and the receptor binding capacity. The GalNAc-siRNA of 3S, 4S and 3L, 4S structure has better affinity with the liver cell according to the judgment of Bmax and Kd value.

TABLE 6A. Kd and Bmax values for each experimental group

TABLE 6B Kd and Bmax values for each experimental group

TABLE 6C Kd and Bmax values for each experimental group

TABLE 7 GalNAc-siRNA sequence Structure for Targeted assays

Note: the 1 after the broken line in P2G6-10 indicates that the modification is performed by the fluorescent label, and the 0 after the broken line indicates that the modification is not performed by the targeting ligand; 1 after the broken line in P2G6-13L represents that the target ligand is modified into 3L (LLL) after the broken line, and 3L after the broken line represents that the target ligand is modified into 3L; and so on for other labels.

Example 4 in vitro efficacy testing of GalNAc-siRNA

Referring to the procedure of example 1, mRNA expression levels in HePG2 cells were measured. The final concentration of GalNAc-siRNA transfection was 50 nM. The results are shown in Table 8.

TABLE 8 GalNAc-siRNA inhibitory Activity in vitro

TABLE 9 GalNAc-siRNA sequence structure for validity detection

Note: 0 after the broken line in P2G6-03L indicates that the fluorescent labeling modification is not carried out; the 3L after the broken line represents the modification of the targeting ligand to 3L (LLL), and so on.

Example 5 in vivo liver Targeted assay

In the test, 24 male SPF-grade Balb/c-nu mice (purchased from Beijing Wintonlifa laboratory animals Co., Ltd.) with the age of 6-7 weeks are adopted. Mice were randomly divided into 7 groups including blank control group, P2G6-10 group, P3G6-10 group, P2G6-13L group, P2G6-13S group, P3G6-13L group, P3G6-13S group. The number of animals in each group was 2, 3, 4. Mice were administered tail vein injection at a dose of about 10mg/kg (experimental design see table 10). Before administration, 15min, 30min, 1h, 2h, 4h, 6h after administration all animals were imaged in vivo, including white light and X-ray imaging. After 6 hours euthanasia after dosing, brains, salivary glands, heart, spleen, lung, liver, kidney and intestine were removed for ex vivo organ imaging (fig. 2 and 3) analysis.

TABLE 10 design of liver targeting experiments

Ex vivo imaging analysis was performed and the results are shown in tables 11-12. The results show that the fluorescence intensity of the livers of the P2G6-13L, P2G6-13S, P3G6-13L and P3G6-13S groups is significantly improved compared with that of the negative control group (NC) 6 hours after the administration (see the fluorescence intensity ratio results of Table 12), which indicates that the livers of the P2G6-13L, P2G6-13S, P3G6-13L and P3G6-13S groups have significantly higher targeting effect.

TABLE 11 statistical results of isolated organ fluorescence intensity values after background subtraction (× 10) ⁸ ps/mm ² )

TABLE 12 fluorescence intensity ratio results

Organ(s)	Salivary gland	Liver disease	Kidney (A)	Intestinal tract
					P2G6-13L/P2G6-10	0.95	2.89	0.74	0.98
P2G6-13S/P2G6-10	0.75	4.52	0.88	1.15
					P3G6-13L/P3G6-10	0.99	2.22	1.40	1.20
P3G6-13S/P3G6-10	1.15	3.07	1.00	1.31

Example 6 GalNAc-siRNA in vivo efficacy test

The test adopts SPF male, C57BL/6 mice (Beijing Wintonlithan laboratory animals Co., Ltd.) of 6-8 weeks old, and randomly groups. The tail vein of the C57/Bl6 mouse is administrated, the liver of the mouse is taken on the 3 rd day and the 7 th day respectively, the liver is frozen at the temperature of-80 ℃, and the PCSK9mRNA level of the liver tissue is checked. Mice were bled on days 3, 7, 14, 21 and 30 (0.25 ml blood was collected by bleeding the posterior segment of the eyeball and submitted for examination within 1 hour after bleeding) to examine the LDL-c, Tc and TG levels in the blood. During the experiment, no signs of death or moribundity were seen in all animals. No obvious abnormalities were observed in all animals upon clinical observation.

Detection of mouse liver PCSK9 gene mRNA expression level

28 mice, randomly divided into 7 groups of 4 animals, and the animals grouped and dosed as shown in Table 13. And (3) grinding the liver tissues of the frozen mice by a full-automatic grinder. The Trizol method is used for extracting total RNA in mouse liver tissues, and the RNA purity and concentration are determined through K5500, so that the requirements of subsequent qPCR experiments are met. The mRNA expression level of the PCSK9 gene was measured using the qRT-PCR Starter Kit (Ruibo Biotech, Guangzhou). In the qPCR experiment, 3 multiple wells are arranged on each sample, 18s RNA is used as an internal reference, and the relative expression quantity of PCSK9 gene mRNA in the sample is calculated by adopting a 2-delta Ct method. The vehicle group is a control group. The difference of the relative expression amount of PCSK9 gene mRNA among groups was analyzed by Excel software.

TABLE 13 animal grouping table

The results showed (table 14) that the expression level of PCSK9mRNA was reduced in liver tissues of mice in the administered group C and the administered group D, compared to the vehicle control group, from 3 days to 7 days after administration, and there was a certain dose dependence. The target drugs C and D are effective and stable, and can down-regulate the expression level of PCSK9 gene mRNA in mouse liver tissues.

TABLE 14.3 days-7 days QPCR quantification of samples

Second, biochemical index detection of mouse serum

112 mice, randomly divided into 7 groups of 16 animals each, and the animals were grouped and dosed as in Table 13. 200 mu L of blood is taken, centrifuged at 4000rpm to take supernatant, and a biochemical analyzer (Mirrier BS-490 biochemical analyzer) is used for detecting the level of each biochemical index in the blood serum.

The results are shown in tables 15 to 19.

TABLE 15 Biochemical index statistical table of animal blood after 3 days of administration

TABLE 16 statistical table of blood biochemical indexes of animals administered for 7 days

TABLE 17 statistical table of animal blood biochemical indexes after 14 days of administration

TABLE 18 statistical table of blood biochemical indexes of animals after 21 days of administration

TABLE 19 statistical table of blood biochemical indexes of animals administered for 30 days

The results showed (tables 15-19) that both administration groups C and D reduced the expression of LDL-C, TC, and TG in the animals 3-30 days after administration, and the inhibition of the expression of LDL-C, TC, and TG was gradually increased with the increase of the dose; partial doses (e.g., medium dose and high dose groups) had more pronounced hypolipidemic effects. Therefore, the siRNA molecule for inhibiting the expression of the PCSK9 gene, represented by target drugs C and D, has the obvious effect of reducing blood fat, and can be used for treating diseases or symptoms connected by the PCSK9 gene, such as cardiovascular diseases or neoplastic diseases.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Reference to the literature

Hutvágner G,Mclachlan J,Pasquinelli A E,et al.A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7small temporal RNA[J].Science,2001,293(5531):834-8.

Elbashir S M,Harborth J,Lendeckel W,et al.Duplexes of 21-nucleotide RNAs mediate RNAinterference in cultured mammalian cells.[J].Nature,2001,411(24):494-8.

Choi J Y,Borch R F.Highly efficient synthesis of enantiomerically enriched 2-hydroxymethylaziridines by enzymatic desymmetrization[J].Cheminform,2010,38(18):215-8.

Zamore P D.RNAinterference:listening to the sound of silence[J].Nature Structural Biology,2001,8(9):746-50.

Sequence listing

<110> Yangzhou Ribo Biotech Co., Ltd

<120> siRNA molecule for inhibiting PCSK9 gene expression and application thereof

<130> IDC170150

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> RNA

<213> Artificial sequence

<400> 1

gacgaugccu gccucuacuu u 21

<210> 2

<211> 19

<212> RNA

<213> Artificial sequence

<400> 2

gacgaugccu gccucuacu 19

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<400> 3

aguagaggca ggcaucgucc c 21

Claims

1. An siRNA molecule for inhibiting the expression of a PCSK9 gene, which comprises a sense strand and an antisense strand which are complementary to form a double strand,

the structure is as follows:

A:GACGAUGCCUGCCUCUACU-(X)m；

fAmGfUfAfG(s) dA(s) dG(s) dGfCfAfG(s) dG(s) dC(s) dAfCmGfUfC(s) mC; or

B:mGmAmCfGfAfUmGmCmCfUfGfCfCmUfCfUmAmCmU-(X)m；

fAmGfUfAfG(s)dA(s)dG(s)dGfCfAfG(s)dG(s)dC(s)dAfUfCmGfUfC(s)mC(s)mC；

Wherein the structure of X is Z:

Z，

m has a value of 3;

CH in each Z ₂ The value of n of the group is 3 or 8.

2. The siRNA molecule of claim 1, which inhibits PCSK9 gene expression in humans and monkeys.

3. A pharmaceutical composition comprising the siRNA molecule of claim 1 and a pharmaceutically acceptable additional component.

4. Use of the siRNA molecule of claim 1 or the pharmaceutical composition of claim 3 in the manufacture of a medicament for inhibiting or reducing the level of expression of a cellular PCSK9 gene in vivo or in vitro, or for the manufacture of a medicament for treating a disease or condition mediated by a PCSK9 gene in a subject.

5. The use of claim 4, wherein the disease or condition mediated by the PCSK9 gene comprises a cardiovascular disease or a neoplastic disease.

6. The use according to claim 5, wherein the cardiovascular disease is selected from hyperlipidemia, hypercholesterolemia, non-familial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, or heterozygous familial hypercholesterolemia.

7. The use according to claim 5, wherein the neoplastic disease is selected from melanoma, hepatocellular carcinoma and metastatic liver cancer.