CN109957566B

CN109957566B - Modified oligonucleotides and compounds useful for synthesizing modified oligonucleotides

Info

Publication number: CN109957566B
Application number: CN201711431610.7A
Authority: CN
Inventors: 张必良; 王玮
Original assignee: Guangzhou Ribobio Co ltd
Current assignee: Guangzhou Ribobio Co ltd
Priority date: 2017-12-26
Filing date: 2017-12-26
Publication date: 2023-08-25
Anticipated expiration: 2037-12-26
Also published as: CN109957566A

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a modified oligonucleotide, a compound for synthesizing the modified oligonucleotide and a method for modifying the oligonucleotide. The invention also relates to the use of the modified oligonucleotides for preventing and/or treating liver-related diseases in a subject.

Description

Modified oligonucleotides and compounds useful for synthesizing modified oligonucleotides

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to a modified oligonucleotide, a compound for synthesizing the modified oligonucleotide and a method for modifying the oligonucleotide.

Background

The asialoglycoprotein receptor (asialoglycoprotein receptor, ASGPR) is an endocytic receptor of a heterogeneous oligomer, which is abundant in number, exists mainly on the cell membrane surface of hepatic parenchymal cells toward the sinus side, and has specificity for sugar. ASGPR is mainly distributed in liver parenchymal cells and other cells are low in content, so that ASGPR becomes an optimal receptor for liver targeted transport.

Glycoproteins terminating in either non-reducing galactose (Gal) or N-acetylgalactosamine (GalNAc) residues are recognized by ASGPR, with GalNAc binding to ASGPR at about 50-fold higher affinity than Gal (Iobst S T et al, J Biol Chem,1996,271 (12): 6686-6693). In vitro experiments show that clustered sugar residues can have much higher affinity than non-clustered sugar residues by occupying the binding site of the receptor at the same time, in the order: four antenna > three antenna > two antenna > single antenna galactoside (Lee Y C, et al, J Biol Chem,1983,258 (1): 199-202).

ASGPR receptor mediated liver targeting oligonucleotides are a new breakthrough in the field of nucleic acid innovative drug research. In 2012, the us Alnylam pharmaceutical company covalently links the triple antenna GalNAc structure studied by the former with small interfering RNAs (sirnas), achieving liver targeted delivery of sirnas in vivo. By applying the technology, researchers develop medicine development of diseases such as amyloid lesions, hemophilia, hypercholesteremia, hepatic porphyrin, hepatitis B and the like, and a plurality of candidate medicines are already in clinical researches (http:// www.alnylam.com/product-pipeline /). In 2014, ISIS pharmaceutical covalently linked triple-antennary GalNAc to antisense Nucleic acid to achieve liver-targeted drug delivery in animals, the activity of antisense Nucleic acid increased 10-fold after ligation (Prakash, T.P.et al, nucleic Acids Res.42, 8796-807.).

Disclosure of Invention

The present inventors have made intensive studies and creative efforts to obtain a compound with ASGPR ligands that can be used to modify oligonucleotides, thereby obtaining a modified oligonucleotide comprising conjugate groups.

Accordingly, in one aspect, the present application provides a compound comprising an oligonucleotide and a conjugate group of the formulaWherein PN is an oligonucleotide, Y is selected from an integer of 1-10, X is selected from an integer of 0-10, M _T Selected from the group consisting of conjugate groups represented by formulas (1), (2), (3) and (4), and when X is not 0, X M are each independently selected from the group consisting of conjugate groups represented by formulas (1 '), (2 ') and (3 '),

wherein A is _x The linker is a connecting arm, and Q is hydroxyl or a modifier.

In certain embodiments, in the conjugate groups of formulas (1) - (4), formulas (1 ') -formula (3'), A is _x Each independently is a ligand for the human asialoglycoprotein receptor (ASGPR).

In certain embodiments, in the conjugate groups of formulas (1) - (4), formulas (1 ') -formula (3'), A is _x Is galactose, galactoacetamido, galactose-containing polysaccharide, galactoacetamido-containing polysaccharide, galactose derivative (e.g. galactose ester) For example, galactose acetate) or an acetamido galactose derivative (for example, an ester of acetamido galactose, for example, acetamido galactose acetate). Optionally, A _x Each independently of the other, carrying a modifying group, e.g. carbonylalkyl or esteralkyl, said alkyl preferably being C _1-6 Alkyl or C _6-12 An alkyl group.

In certain embodiments, A _x Selected from:

in certain embodiments, in the conjugate groups of formulas (1) - (4), formulas (1 ') -formula (3'), the linker structure is each independently as shown in formula (i), formula (ii), formula (iii), formula (iv) or formula (v).

Wherein n is selected from integers between 1 and 10. In certain embodiments, n is 1 or 6.

Wherein n is ₁ And n ₂ Each independently selected from integers between 1 and 10. In certain embodiments, n ₁ 1. In certain embodiments, n ₂ 4. In certain embodiments, n ₁ Is 1 and n ₂ 4.

Wherein n is ₁ 、n ₂ 、n ₃ Each of which is a single pieceIndependently selected from integers between 1 and 10. In certain embodiments, n ₁ 1. In certain embodiments, n ₂ 3. In certain embodiments, n ₃ 4. In certain embodiments, n ₁ Is 1, n ₂ Is 3 and n ₃ 4.

Wherein n is selected from integers between 1 and 10. In certain embodiments, n is 1.

Wherein n is selected from integers between 1 and 10. In certain embodiments, n is 4.

In certain embodiments, in the conjugate group of formula (1) or formula (1'), A _x Each independently selected from A ₁ 、A ₂ 、A ₃ 、A ₁ ’、A ₂ ' or A ₃ The structure of the linker is shown as a formula (i). In certain embodiments, n is 1 or 6.

In certain embodiments, in the conjugate group of formula (1) or formula (1'), A _x Each independently selected from A ₁ Or A ₁ The structure of the linker is shown as a formula (ii). In certain embodiments, n ₁ 1, and n ₂ 4.

In certain embodiments, in the conjugate group of formula (1) or formula (1'), A _x Each independently selected from A ₁ Or A ₁ The structure of the linker is shown in a formula (iii). In certain embodiments, n ₁ Is 1, n ₂ Is 3, and n ₃ 4.

In certain embodiments, in the conjugate group of formula (1) or formula (1'), A _x Each independently selected from A ₁ Or A ₁ The structure of the linker is shown as a formula (iv). In certain embodiments, n is 1.

In certain embodiments, in the conjugate group of formula (2) or formula (2'), A _x Each independently selected from A ₁ 、A ₂ 、A ₃ 、A ₁ ’、A ₂ ' or A ₃ The structure of the linker is shown as a formula (i). In certain embodiments, n is 1 or 6.

In certain embodiments, in the conjugate group of formula (2) or formula (2'), ax is each independently selected from A ₁ Or A ₁ The structure of the linker is shown as a formula (ii). In certain embodiments, n ₁ 1, and n ₂ 4.

In certain embodiments, in the conjugate group of formula (3) or formula (3'), ax is each independently selected from the group consisting of A ₁ 、A ₂ 、A ₃ 、A ₁ ’、A ₂ ' or A ₃ The structure of the linker is shown as a formula (i). In certain embodiments, n is 1 or 6.

In certain embodiments, in the conjugate group of formula (4), A _x Is A ₁ Or A ₁ The structure of the linker is shown as a formula (v). In certain embodiments, n is 4.

In certain embodiments, in the conjugate groups of formulas (1) - (3), formulas (1 ') -formula (3'), Q is selected from: cholesterol and derivatives thereof, polyethylene glycol, fluorescent probes, biotin, polypeptides, vitamins and tissue targeting molecules.

In the present invention, the oligonucleotide may be a single-stranded oligonucleotide or a double-stranded oligonucleotide. Optionally, the oligonucleotides of the invention may comprise one or more modified nucleotides. In certain embodiments, the one or more modified nucleotides are each independently selected from the group consisting of: 2 '-methoxyethyl modified nucleotide, 2' -O-alkyl modified nucleotide (e.g., 2 '-O-methyl modified nucleotide), 2' -O-allyl modified nucleotide, 2 '-C-allyl modified nucleotide, 2' -fluoro modified nucleotide, 2 '-deoxy modified nucleotide, 2' -hydroxy modified nucleotide, locked nucleotide, hexitol nucleic acid (Hexitol nucleic acid, HNA), unlocking nucleic acid (unlocked nucleic acid, UNA). In certain embodiments, the modified nucleotide is selected from the group consisting of a 2 '-O-alkyl modified nucleotide, a 2' -fluoro modified nucleotide.

In certain embodiments, the oligonucleotide bears a terminal modification, preferably the terminal modification is selected from the group consisting of: cholesterol, polyethylene glycol, fluorescent probes, biotin, polypeptides, vitamins, tissue targeting molecules, and any combination thereof.

In certain embodiments, the phosphate-containing backbone of the oligonucleotide is modified, preferably the modification is a thio modification.

In certain embodiments, the oligonucleotide is an siRNA. In certain embodiments, the siRNA comprises a sense strand and an antisense strand that are complementary to form a double strand. In certain embodiments, the siRNA comprises a sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

In the modified oligonucleotides of the invention, the conjugate groups may be attached at different positions of the oligonucleotide.

In some embodiments of the present invention, in some embodiments,each independently ligating to the 3 'end, 5' end or sequence intermediate of either strand of the oligonucleotide. In certain embodiments, the->Is linked to the oligonucleotide by a phosphotriester linkage. In certain embodiments, M and M _T Or M and M are connected through a phosphotriester bond.

In certain embodiments, the oligonucleotide is a single stranded oligonucleotide. In certain embodiments, Y is 1, Ligating to the 3 'end or the 5' end of the oligonucleotide. In certain embodiments, Y is 2,2Each linked to the 3 'end and the 5' end of the oligonucleotide.

In certain embodiments, the oligonucleotide is a double-stranded oligonucleotide. In certain embodiments, Y is 1,ligating to the 3 'end or the 5' end of either strand of the oligonucleotide. In certain embodiments Y is 2,2 +.>Each linked to the 3 'end and the 5' end of the same strand in the oligonucleotide. In certain embodiments Y is 2,2 +.>Each linked to the 3' ends of both strands in the oligonucleotide. In certain embodiments Y is 2,2 +.>Each linked to the 5' ends of both strands in the oligonucleotide. In certain embodiments Y is 3,3 +.>In (a) two are each linked to the 3 'end and the 5' end of the same strand in the oligonucleotide, and the third is linked to the 3 'end or the 5' end of the other strand. In certain embodiments Y is 4,4 +.>Each of which is linked to the 3 'and 5' ends of both strands of the oligonucleotide.

In the modified oligonucleotides of the invention, M _T And M or M may have the same or different structures. In certain embodiments, X is other than 0, M _T Having the same A as at least one M _x And/or linker structures. In some embodiments of the present invention, in some embodiments,x is greater than 1, and X M have the same or different structures. In certain embodiments, Y is greater than 1, YHaving the same or different structures.

The modified oligonucleotides of the invention may comprise one or more ofAnd, M or MT structure, number of M or number of M can be +.>And adjusting.

In certain embodiments, Y is 1, x is 0, and the compound has one of the following characteristics:

(1)M _T the structure of (A) is shown as a formula (1) _x Is A ₁ ’、A ₂ ' or A ₃ The linker has a structure shown in formula (i), preferably, n is 1 or 6;

(2)M _T the structure of (A) is shown as a formula (1) _x Is A ₁ The linker has a structure shown in formula (ii), preferably n ₁ 1, and n ₂ 4;

(3)M _T the structure of (A) is shown as a formula (1) _x Is A ₁ The linker has a structure shown in formula (iii), preferably n ₁ Is 1, n ₂ Is 3, and n ₃ 4;

(4)M _T the structure of (A) is shown as a formula (1) _x Is A ₁ The linker has a structure shown in a formula (iv), and preferably n is 1;

(5)M _T the structure of (A) is shown as a formula (2) _x Is A ₁ ’、A ₂ ' or A ₃ The linker has a structure shown in formula (i), preferably, n is 1 or 6;

(6)M _T the structure of (A) is shown as a formula (2) _x Is A ₁ The linker has a structure shown in formula (ii), preferably n ₁ 1, and n ₂ 4;

(7)M _T the structure of (A) is shown as a formula (3) _x Is A ₁ ’、A ₂ ' or A ₃ The linker has a structure shown in formula (i), preferably, n is 1 or 6;

(8)M _T the structure of (A) is shown as a formula (4) _x Is A ₁ The structure of the linker is shown as a formula (v), and n is preferably 1;

(9)M _T the structure of (A) is shown as a formula (2) _x Is A ₁ The structure of the linker is shown as a formula (iii); preferably n ₁ Is 1, n ₂ Is 3, and n ₃ 4.

In certain embodiments, Y is 1, X is 1, 2 or 3, each M has the same structure when X is 2 or 3, and the compound has one of the following characteristics:

(1) M has a structure shown in formula (1'), A _x Is A ₁ The linker has a structure shown in formula (i), preferably, n is 1 or 6; m is M _T The structure of (A) is shown as a formula (1) _x Is A ₁ The linker has a structure shown in formula (i), preferably, n is 1 or 6;

(2) M has a structure shown in formula (1'), A _x Is A ₁ The linker has a structure shown in formula (ii), preferably n ₁ 1, and n ₂ 4; m is M _T The structure of (a) is shown as a formula (1), ax is A1', and the structure of the linker is shown as a formula (ii), preferably n ₁ 1, and n ₂ 4;

(3) M has a structure shown in formula (1'), A _x Is A ₁ The linker has a structure shown in formula (iii), preferably n ₁ Is 1, n ₂ Is 3, and n ₃ 4; m is M _T The structure of (a) is shown as a formula (1), ax is A1', the structure of the linker is shown as a formula (iii), and preferably n ₁ Is 1, n ₂ Is 3, and n ₃ 4;

(4) M has a structure shown in formula (2'), A _x Is A ₁ The linker has a structure shown in formula (i), preferably, n is 1 or 6; m is M _T The structure of (A) is shown as a formula (2) _x Is A ₁ ' linkerThe structure is shown in formula (i), preferably, n is 1 or 6;

(5) M has a structure shown in formula (1'), A _x Is A ₁ The linker has a structure shown in formula (ii), preferably n ₁ 1, and n ₂ 4; m is M _T The structure of (a) is shown as a formula (1), ax is A1', and the structure of the linker is shown as a formula (ii), preferably n ₁ 1, and n ₂ 4;

(6) M has a structure shown in formula (1'), A _x Is A ₃ The linker has a structure shown in formula (ii), preferably n ₁ 1, and n ₂ 4; m is M _T The structure of (a) is shown as a formula (1), ax is A3', and the structure of the linker is shown as a formula (ii), preferably n ₁ 1, and n ₂ 4.

In certain embodiments, Y is 1, X is 2, the two M's are identical in structure, as shown in formula (1'), A _x Is A ₁ The linker has a structure shown in a formula (iv), and preferably n is 1; MT has a structure shown in formula (4), A _x Is A ₁ The linker has a structure shown in formula (v), and preferably n is 4.

Exemplary compounds of the application include:

wherein n is ₁ 、n ₂ 、n ₃ And n is each independently selected from integers between 1 and 10.

In another aspect, the application provides compounds useful for modifying oligonucleotides that have a ligand and a chemical group that is reactive with the oligonucleotide chain, and a linker arm that links the ligand to the chemical group.

The present application therefore relates to a compound of the formula A _x -linker-R ₁ 、A _x -linker-R ₂ 、A _x -linker-R ₃ And A _x -linker-R ₄ Wherein A is a compound of formula (I) _x As ligand, linker as connecting arm,

R ₁ is that

R ₂ Is thatWherein m is ₁ And m ₂ Each independently selected from integers between 1 and 10,

R ₃ is that

R ₄ Is that

R ₁ 、R ₂ 、R ₃ In (2), Z is a protecting group for a hydroxyl group, preferably each Z is independently 4, 4-Dimethoxytrityl (DMTR) or 4-methoxytriphenylchloromethyl (MMT).

In certain embodiments, A _x Is a ligand of human asialoglycoprotein receptor (ASGPR).

In certain embodiments, A _x Is galactose, galactosamine, a galactose-containing polysaccharide, an galactosamine-containing polysaccharide, a galactose derivative (e.g. an ester of galactose, such as galactoacetate) or an galactosamine derivative (e.g. an ester of galactosamine, such as galactosamine acetate). Optionally, A _x Each independently of the other, carrying a modifying group, e.g. carbonylalkyl or esteralkyl, said alkyl preferably being C _1-6 Alkyl or C _6-12 An alkyl group.

In certain embodiments, A _x Selected from:

in certain embodiments, the linker has a structure according to formula (i), formula (ii), formula (iii), formula (iv) or formula (v):

wherein n is selected from integers between 1 and 10, preferably n is 1 or 6;

wherein n is ₁ And n ₂ Each independently selected from integers between 1 and 10, preferably n ₁ Is 1, preferably n ₂ 4;

wherein n is ₁ 、n ₂ 、n ₃ Each independently selected from integers between 1 and 10, preferably n ₁ Is 1, preferably n ₂ Is 3, preferably n ₃ 4;

wherein n is selected from integers between 1 and 10, preferably n is 1;

wherein n is selected from integers between 1 and 10, preferably n is 4.

For the general formula A _x -linker-R ₁ In certain embodiments, the compound has one of the following characteristics:

(1)A _x is A ₁ 、A ₂ Or A ₃ The linker has a structure shown in formula (i), preferably, n is 1 or 6;

(2)A _x is A ₁ The linker has a structure as shown in formula (ii), preferably n ₁ 1, and n ₂ 4;

(3)A _x is A ₁ The linker has a structure as shown in formula (iii), preferably n ₁ Is 1, n ₂ Is 3, and n ₃ 4;

(4)A _x is A ₁ The linker has a structure as shown in formula (iv), preferably n is 1.

In certain embodiments, the general formula is A _x -linker-R ₁ The compound of (2) is selected from:

wherein n is selected from integers between 1 and 10,

wherein n is ₁ And n ₂ Each independently selected from integers between 1 and 10,

wherein n is ₁ 、n ₂ 、n ₃ Each independently selected from integers between 1 and 10.

For the general formula A _x -linker-R ₂ In certain embodiments, the compound has one of the following characteristics:

(2)A _x is A ₁ The linker has a structure as shown in formula (ii), preferably n ₁ 1, and n ₂ 4.

In certain embodiments, the general formula is A _x -linker-R ₂ The compound of (2) is selected from:

wherein n, m ₁ 、m ₂ Each independently selected from integers between 1 and 10,

wherein n is ₁ 、n ₂ 、m ₁ 、m ₂ Each independently selected from integers between 1 and 10,

wherein n is ₁ 、n ₂ 、n ₃ 、m ₁ 、m ₂ Each independently selected from integers between 1 and 10.

For A as _x -linker-R ₃ In certain embodiments, A _x Is A ₁ 、A ₂ Or A ₃ The linker has a structure as shown in formula (i), preferably n is 1 or 6.

For A as _x -linker-R ₄ In certain embodiments, A _x Is A ₁ The linker has a structure as shown in formula (v), preferably n is 4.

In one aspect, the application provides a method of modifying an oligonucleotide comprising ligating one or more compounds (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10) to the oligonucleotide, each independently selected from the group consisting of compounds of formula A as defined above _x -linker-R ₁ 、A _x -linker-R ₂ 、A _x -linker-R ₃ Or A _x -linker-R ₄ Is a compound of (a). Preferably, in the method, the method is carried out by a method comprising the step ofChemical reaction takes place to effect the connection. In certain embodiments, the methods are used for solid phase synthesis.

The present application provides another method for modifying an oligonucleotide comprising the steps of:

step (1): providing an oligonucleotide and ligating a first compound selected from the group consisting of the compounds having the general formula A as defined above to the oligonucleotide to give an oligonucleotide comprising the conjugate M _x -linker-R ₁ 、A _x -linker-R ₂ Or A _x -linker-R ₃ Is a compound of formula (I),

step (2): attaching a second compound to the conjugate M formed in the previous step, said second compound being selected from the group consisting of compounds having the general formula A as defined above _x -linker-R ₁ 、A _x -linker-R ₂ 、A _x -linker-R ₃ Or A _x -linker-R ₄ Is a compound of (a).

Optionally, the method further comprises step (3): repeating step (2) one or more times (e.g., 2-9 times).

Optionally, the method further comprises step (4): repeating steps (1), (2) and (3) one or more times (e.g., 2-9 times).

Preferably, in the steps (1) and (2), the reaction is carried out by a first compound or a second compoundChemical reaction takes place to effect the connection.

The oligonucleotides used in any of the modification methods of the application may be single stranded oligonucleotides or double stranded oligonucleotides. Optionally, the oligonucleotide may comprise one or more modified nucleotides. In certain embodiments, the one or more modified nucleotides are each independently selected from the group consisting of: 2 '-methoxyethyl modified nucleotide, 2' -O-alkyl modified nucleotide (e.g., 2 '-O-methyl modified nucleotide), 2' -O-allyl modified nucleotide, 2 '-C-allyl modified nucleotide, 2' -fluoro modified nucleotide, 2 '-deoxy modified nucleotide, 2' -hydroxy modified nucleotide, locked nucleotide, HNA, UNA. In certain embodiments, the modified nucleotide is selected from the group consisting of a 2 '-O-alkyl modified nucleotide, a 2' -fluoro modified nucleotide.

The application also provides a compound of formula A as defined above _x -linker-R ₁ 、A _x -linker-R ₂ 、A _x -linker-R ₃ Or A _x -linker-R ₄ The use of a compound for modifying an oligonucleotide. The application also provides a kit comprising at least one compound selected from the group consisting of compounds of formula A as defined above _x -linker-R ₁ 、A _x -linker-R ₂ 、A _x -linker-R ₃ Or A _x -linker-R ₄ Is a compound of (a). In some implementationsIn embodiments, the kit further comprises reagents for synthesizing and/or modifying the oligonucleotides (e.g., solid supports, DNA monomers, RNA monomers, modifying monomers, activators, oxidants, deprotection reagents, buffers, and any combination thereof).

In one aspect, the application provides a pharmaceutical composition comprising a compound of the application comprising an oligonucleotide and a conjugate group, and optionally a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical composition is for use in preventing and/or treating a liver-related disorder in a subject.

The pharmaceutical composition of the application can be prepared into any pharmaceutically acceptable dosage form. In certain embodiments, the dosage form is selected from the group consisting of powders, tablets, granules, capsules, solutions, emulsions, suspensions, injections, sprays, aerosols, and foggers. In certain embodiments, the formulation may be administered to a patient or subject in need of prophylaxis and/or treatment in any suitable manner of administration, such as oral, parenteral, rectal, pulmonary or topical administration, and the like. When used for oral administration, the formulation may be an oral formulation, for example, an oral solid formulation such as a tablet, capsule, pill, granule, or the like; or oral liquid preparations such as oral solutions, oral suspensions, syrups, etc. The oral formulation may also contain suitable fillers, binders, disintegrants, lubricants, etc. When used for parenteral administration, the formulations may be in the form of injections, including injectable solutions, injectable sterile powders, and injectable concentrated solutions. For injection, conventional methods in the pharmaceutical field can be adopted for production. When an injection is formulated, the preparation may be formulated without adding an additive, or may be added with an appropriate additive according to the nature of the drug.

In one aspect, the application provides the use of a compound comprising an oligonucleotide and a conjugate group of the application for the prevention and/or treatment of a liver-related disease in a subject.

In one aspect, the application provides a method of preventing and/or treating a liver-related disorder in a subject comprising administering to a subject in need thereof an effective amount of a compound comprising an oligonucleotide and a conjugate group of the application.

In certain embodiments, the liver-related disorder is selected from the group consisting of: hereditary angioedema, familial tyrosinemia type I, alagille syndrome, alpha-1-antitrypsin deficiency, bile acid synthesis and metabolic defects, biliary tract occlusion, cystic fibrosis liver disease, idiopathic neonatal hepatitis, mitochondrial liver disease, progressive familial intrahepatic cholestasis, primary sclerosing cholangitis, transthyroxine amyloidosis, hemophilia, homozygous familial hypercholesterolemia, hyperlipidemia, steatohepatitis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), hyperglycemia, and diseases involving abnormally increased hepatic glucose production similar to type II diabetes, hepatitis, hepatic porphyrin.

In certain embodiments, the subject is a mammal, e.g., bovine, equine, ovine, porcine, canine, feline, rodent, primate; for example, the subject is a human.

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Moreover, the laboratory procedures referred to herein are all conventional procedures widely used in the respective arts. Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

As used herein, the term "oligonucleotide" refers to an oligomeric compound containing multiple linked chemically modified or unmodified nucleotides having a length of less than about 100 nucleotides (e.g., 1-20 nucleotides or 1-50 nucleotides). In certain embodiments, the oligonucleotide may include a non-nucleic acid conjugated group. In certain embodiments, the oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). In certain embodiments, the oligonucleotide is double-stranded or single-stranded. In certain embodiments, the oligonucleotide is an siRNA, a nucleic acid aptamer, or an antisense nucleic acid.

As used herein, the term "conjugate" or "conjugate group" means an atom or group of atoms that is bound to an oligonucleotide. In certain instances, the conjugate groups alter one or more properties of the oligonucleotides to which they are attached, including, but not limited to, pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.

As used herein, the term "receptor" refers to a biological macromolecule composed of glycoproteins or lipoproteins that reside within the cell membrane, cytoplasm, or nucleus, with the different receptors having specific structures and configurations. As used herein, the term "ligand" refers to a substance that has a recognition capacity for a receptor and is capable of binding thereto. In certain embodiments, the ligand is a ligand having affinity for an asialoglycoprotein receptor (asialoglycoprotein receptor, ASGPR). In certain embodiments, the ligand is a carbohydrate, such as a monosaccharide and a polysaccharide, including but not limited to: galactose, N-acetylgalactosamine, mannose, glucose, glucosamine and fucose.

As used herein, the term "polysaccharide" refers to a polymer formed from a plurality of monosaccharide groups joined by glycosidic linkages. In the present invention, polysaccharides include oligosaccharides and oligosaccharides. Generally, "oligosaccharide" refers to a polymer in which 2 to 10 monosaccharide groups are linked by glycosidic bonds, and "oligosaccharide" refers to a polymer in which 20 or less monosaccharide groups are linked by glycosidic bonds.

As used herein, the term "about" should be understood by those skilled in the art and will vary to some extent depending on the context in which it is used. If the meaning is not clear to a person skilled in the art depending on the context in which the term is used, then "about" means that the deviation is not more than plus or minus 10% of the particular value or range.

As used herein, the term "preventing" refers to preventing or delaying the onset of a disease.

As used herein, the term "treating" refers to curing or at least partially arresting the progression of a disease, or alleviating a symptom of a disease.

As used herein, the term "effective amount" refers to an amount effective to achieve the intended purpose. For example, a disease-preventing effective amount refers to an amount effective to prevent, prevent or delay the occurrence of a disease. Determination of such effective amounts is within the ability of those skilled in the art.

Advantageous effects of the invention

Compared with the prior art, the invention has the following beneficial effects:

compared with the relevant inventions of Alnylam pharmaceutical and ISIS pharmaceutical companies (US 20150119444A1, US20150119445A1, US20150126718A 1), the present invention has the following significant differences:

1. The chemical structures are different.The design structure of the two companies is that a multi-antenna ASGPR ligand is connected with the oligonucleotide at one time; the structure designed by the invention is that a single ASGPR ligand is coupled with the oligonucleotide for many times by solid-phase chemical synthesis of nucleic acid phosphoramidite, so as to realize multi-ligand modification. The advantage of multiple solid phase synthetic coupling of single ASGPR ligands is (1) shortened synthetic steps, easy to achieve scale-up production. The efficiency of the solid phase synthesis for connecting each ligand coupling reaction is more than 98%, the efficiency of the 3 ligand coupling reactions is more than 94%, the solid phase synthesis can be automatically completed by equipment, and the purification is not needed in the connection reaction. Compared with liquid phase synthesis, the method combines 3 ligands into a single molecule for connection, has higher efficiency and higher speed, and is easier for mass production. (2) the range of oligonucleotide modification is enlarged. GalNAc is reported to be separated from the center by the three antenna structures (lee et al, carbohydrates in Chemistry and Biology;4:549, 2000)Non-equidistant binding to ASGPR receptors is favored. GalNAc is equidistant from the center (17 atoms) in the triple antenna structure used by two companies due to the limitations of the preparation method. In the invention, each ASGPR ligand is independently connected with the oligonucleotide, so that the space distance of a central dominant body can be simply controlled, the number of the ligands is regulated, hundreds of combinations are formed, the variety of oligonucleotide modification is enlarged, and the method is favorable for finding the patent medicine molecules with higher activity. (3) expansion of ASGPR ligand types. On the basis of GalNAc, a series of novel ASGPR ligand substrates were prepared by reacting The screening of these new ligands would be advantageous for more innovative drug development of oligonucleotides.

2. The ligand is covalently linked to the oligonucleotide by a different method.The Alnylam pharmaceutical company adopts a method that a three-antenna GalNAc ligand is connected with a solid support, and the modified solid support is used for solid phase synthesis of the oligonucleotide, so that the ligand is connected at the 3' -end of the oligonucleotide. ISIS pharmaceutical attempts to link the triple-antennary GalNAc ligand to the 5 'end by a nucleic acid phosphoramidite solid phase synthesis method, but fails to link (Efficient Synthesis and Biological Evaluation of 5' -GalNAc) due to large steric hindrance, so a liquid phase triple-antennary GalNAc ligand and end amino-modified oligonucleotide liquid phase linking method is developed, which realizes a reaction time of 3 hours and a reaction efficiency of more than 95%. The method of the invention connects each ligand with the oligonucleotide independently, has small molecular steric hindrance and high connection efficiency.

3. The oligonucleotide sites may be modified and the combination varied. The terminal sites in the oligonucleotide drug molecules are usually modified with cholesterol, polyethylene glycol (PEG), etc., to improve pharmacokinetic properties. Tri-antennal GalNAc ligands designed by Alnylam and ISIS pharmaceutical companies are only used for terminal modification of oligonucleotide chains, occupy terminal modification sites, and reduce the types applicable to oligonucleotide modification. The novel compounds of the invention can modify any position of the oligonucleotide in solid phase synthesis, and other modifications are not affected by the terminal. The preparation of novel compounds in admixture with terminal cholesterol for the modification of oligonucleotides is described in the examples of the present invention.

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, however, it will be understood by those skilled in the art that the following drawings and examples are only for illustrating the present invention and are not limiting of the scope of the present invention. Various objects and advantageous aspects of the present invention will become apparent to those skilled in the art from the following detailed description of the preferred embodiments and the accompanying drawings.

Drawings

FIG. 1 shows GalNAc binding curves of respective samples in example 35.

Sequence information

Information on the sequences to which the present invention relates is provided in the following table:

SEQ ID NO (SEQ ID NO:)	Description of the invention
		1	Artificial sequence
2	Artificial sequence
		3	Artificial sequence
4	Artificial sequence

Sequence 1 (SEQ ID NO: 1): 19nt

CAGCAAGUGUGACAGUCAU

Sequence 2 (SEQ ID NO: 2): 25nt

AUGACUGUCACACUUGCUGGCCUGU

Sequence 3 (SEQ ID NO: 3): 19nt

CAGGCCAGCAAGUGUGACA

Sequence 4 (SEQ ID NO: 4): 21nt

UGUCACACUUGCTGGCCUGUC

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

EXAMPLE 1 Compound R' ₁ Synthesis of-H

Starting from serinol, reference (Choi J Y, borchRF. Highly efficient synthesis of enantiomerically enriched-hydroxymethylaziridines by enzymatic desymmetrization [ J ]]Organic letters,2007,9 (2): 215-218) to prepare Compound 1 and further Compound R' ₁ -H to give a white solid, overall yield of both steps 49%. ¹ HNMR(400MHz,DMSO-d6)δ：7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.16(s,2H),4.63-4.58(m,1H),4.05-3.97(m,1H),3.74(s,6H),3.04-2.99(m,2H),2.95-2.90(m,2H).MS(ESI),m/z:416.3([M+Na] ⁺ ).

EXAMPLE 2 Compound R' ₂ Synthesis of-H

Referring to the procedure of example 1, compound R 'was prepared' ₂ -H as a white solid in 55% yield. ¹ HNMR(400MHz,DMSO-d6)δ：7.42-7.37(d,J＝7.2Hz,2H),7.35-7.29(t,J＝6.9Hz,2H),7.28-7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H),5.17(s,1H),4.63-4.59(m,1H),3.74(s,6H),3.05-2.99(m,2H),2.96-2.90(m,2H)，2.88-2.81(m,4H).MS(ESI),m/z:430.3([M+Na] ⁺ ).

EXAMPLE 3 Compound R' ₃ Synthesis of-H

Preparation of Compound R 'by Using L-hydroxyproline methyl ester hydrochloride as a starting material and referring to the method of example 1' ₃ H, to give a white solid,the yield thereof was found to be 45%. ¹ HNMR(400MHz,DMSO-d6)δ：7.42-7.37(d,J＝7.2Hz,2H),7.35-7.29(t,J＝6.9Hz,2H),7.28-7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H),5.17(s,1H),4.63-4.59(m,1H),3.74(s,6H),3.05-2.99(m,3H),2.90-2.86(m,2H),2.77-2.71(m,1H),1.88-1.81(m,2H).MS(ESI),m/z:442.5([M+Na] ⁺ ).

EXAMPLE 4 Compound A ₁ -I ₁ Is synthesized by (a)

(1) Synthesis of Compound 3

Into a 1L round bottom flask was added delta-valerolactone (100 g,1 mol), sodium hydroxide (40 g,1 mol), deionized water (400 mL), and the mixture was mixed, reacted at 70℃for 6 hours, after completion of the TLC monitoring, the reaction mixture was dried by spin-drying, 200mL of toluene was added, and then dried by spin-drying to obtain a white solid (140 g).

(2) Synthesis of Compound 4

In a 1L round bottom flask, compound 3 (140 g,1 mol), 500mL of anhydrous acetone, benzyl bromide (205.2 g,1.2 mol), tetrabutylammonium bromide as catalyst (16.2 g,0.05 mol), heated under reflux, TLC monitored the reaction to completion, after 24 hours, the reaction solution was cooled to room temperature, acetone was removed under reduced pressure, the residue was dissolved in 500mL of ethyl acetate, washed successively with 200mL of saturated sodium hydrogen sulfate solution, 200mL of saturated sodium hydrogen carbonate solution and 200mL of saturated brine, the organic phase was dried over anhydrous sodium sulfate, concentrated, and separated by a silica gel column (petroleum ether: ethyl acetate V: V=1:1) to give 175g of a transparent oily liquid with a yield of 84%.

(3) Synthesis of Compound 5

Into a 1L round bottom flask was charged D-galactose hydrochloride (100 g,0.46 mol), anhydrous pyridine 450mL, acetic anhydride 325mL, triethylamine (64.5 mL,0.46 mol), DMAP (2 g,0.016 mol) slowly in ice bath. The reaction is carried out at normal temperature overnight, a large amount of solid is separated out, the solid is filtered by suction, and 200mL of 0.5N HCl solution is used for leaching the filter cake, so that 162.5g of white solid is obtained, and the yield is 90%. ¹ H NMR(400MHz,DMSO-d6)δ：7.88(d,J＝9.2Hz,1H),5.63(d,J＝8.8Hz,1H),5.26(d,J＝3.1Hz,1H),5.05(d,J＝11.3,3.3Hz,1H),4.36(m,4H),2.11(s,3H),2.03(s,3H),1.98(s,3H),1.90(s,3H),1.78(s,3H).

(4) Synthesis of Compound 6

In a 250mL round bottom flask, compound 5 (10 g,25.7 mmol) and 100mL of anhydrous dichloromethane were added, and after stirring for 10 min, trimethylsilyl triflate (7 mL,38.7 mmol) was added and reacted overnight at room temperature, the reaction solution was slowly poured into aqueous sodium bicarbonate (7 g,79.5 mmol) solution (200 mL) and stirred for 0.5 h, the organic phase separated, dried over anhydrous sodium sulfate and concentrated under reduced pressure to give a pale yellow colloid 7.78g, 92% yield.

(5) Synthesis of Compound 7

In a 100mL round bottom flask, compound 6 (5 g,15.2 mmol), compound 4 (3.8 g,18.25 mmol) were dissolved in 50mL of anhydrous 1, 2-dichloroethane, and after stirring for 10 min, trimethylsilyl triflate (0.55 mL,3 mmol) was added, the reaction was allowed to react overnight at normal temperature, the reaction solution was extracted with dichloromethane, the organic phase was washed twice with 50mL of saturated sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and separated over a silica gel column (petroleum ether: ethyl acetate V: V=3:2) to give a clear oily liquid, 6.94g, 85% yield. ¹ HNMR(400MHz,DMSO-d6)δ：7.69(d,J＝9.3Hz,1H),7.33–7.16(m,5H),5.28(d,J＝5.3Hz,1H),4.95(s,2H),4.93(q,J＝4.2Hz,1H),4.40(d,J＝8.6Hz,1H),4.00–3.86(m,3H),3.73–3.56(m,2H),3.36–3.21(m,1H),2.53(t,J＝8.2Hz,2H),2.11(s,3H),1.89(s,3H),1.83(s,3H),1.65(s,3H),1.59–1.36(m,4H).MS(ESI),m/z:560.2([M+Na] ⁺ ).

(6) Compound A ₁ -I ₁ Is synthesized by (a)

In a 50mL round bottom flask, compound 7 (3.3 g,6.1 mmol), pd/C (0.33 g, 10%) was dissolved in 5mL methanol and 20mL ethyl acetate, and the mixture was reacted overnight at room temperature with a hydrogen balloon. The reaction solution was filtered through celite, the celite was rinsed with methanol, and the filtrate was concentrated under reduced pressure and dried to give 2.8g of white solid with a yield of 95.5%. ¹ HNMR(400MHz,DMSO-d6)δ：11.98(s,1H),7.79-7.75(d,J＝8.9Hz,1H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.46-4.51(d,J＝7.2Hz,1H),4.15-4.07(m,3H),3.89-3.79(m,1H),3.80-3.69(m,1H),3.46-3.36(m,1H)，2.22-2.14(t，J＝7.2Hz，2H)，2.15(s，3H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H)，1.59-1.42(m，4H).MS(ESI),m/z:470.5([M+Na] ⁺ ).

EXAMPLE 5 Compound A ₁ -I ₂ Is synthesized by (a)

(1) Synthesis of Compound 8

In a 100mL round bottom flask, compound 6 (5 g,15.2 mmol), 10-undecenol (3.1 g,18.24 mmol) were dissolved in 50mL of anhydrous dichloromethane, and after stirring for 10 min, trimethylsilyl triflate (0.55 mL,3.0 mmol) was added, reacted overnight at normal temperature, the reaction solution was extracted with dichloromethane, the organic phase was washed twice with 50mL of saturated sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and separated over a silica gel column (petroleum ether: ethyl acetate V: V=3:2) to give 6.59g of white solid in 87% yield. ¹ HNMR(400MHz,DMSO-d6)δ：7.82(d,J＝3.3Hz,1H),5.86-5.73(m,1H),5.22(s,1H),5.02-4.9(m,3H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:522.4([M+Na] ⁺ ).

(2) Compound A ₁ -I ₂ Is synthesized by (a)

Into a 100mL round bottom flask, compound 8 (4 g,8.02 mmol), dichloromethane 50mL, acetonitrile 50mL, deionized water 70mL was added, and NaIO was added in portions ₄ (6.86 g,32.1 mmol), 48h at ambient temperature, TLC monitoring the reaction. The reaction solution was added with 100mL of deionized water, extracted with dichloromethane three times (50 mL. Times.3), the organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure and dried by spin-drying to give 4.1g of pale brown gummy product in 99% yield. ¹ HNMR(400MHz,DMSO-d6)δ：11.99(s,1H),7.82(d,J＝3.3Hz,1H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:540.26([M+Na] ⁺ ).

EXAMPLE 6 Compound A ₂ -I ₁ Is synthesized by (a)

(1) Synthesis of Compound 9

Compound 9, reference [2] hudson, c.s.; johnson, J.J.am.chem.Soc.1915,37, 1270-1275.

H NMR(400MHz,DMSO-d6)δ：5.20(s,2H),4.95(q,J＝4.2Hz,2H),4.51(d,J＝7.2Hz,1H),4.46(d,J＝7.2Hz,1H)，4.15–3.97(m,6H),3.89–3.79(m,2H),2.23(s,3H)，2.15(s,6H)，2.00(s,6H)，1.95(s,6H)，1.87(s,3H).MS(ESI),m/z:701.6([M+Na] ⁺ ).

(2) Synthesis of Compound 10

500mL round bottom flask, compound 9 (20 g,29.5 mmol), compound 4 (9.2 g,44.3 mmol) were dissolved in 200mL anhydrous dichloromethane and BF was added dropwise under ice-bath ₃ -OEt ₂ (14.8 mL) and kept in ice bath for 24h, and TLC monitored the reaction. The mixture was filtered through celite, and the filtrate was dissolved in 500mL of ethyl acetate and washed with 200mL of a saturated sodium bicarbonate solution and 200mL of a saturated brine in this order. The organic phase was dried over anhydrous magnesium sulfate, concentrated under reduced pressure, and separated by a silica gel column (petroleum ether: ethyl acetate V: v=3:2) to give 17.06g of a white solid in 70% yield. MS (ESI), M/z 849.26 ([ M+Na)] ⁺ ).

(3) Compound A ₂ -I ₁ Is synthesized by (a)

In a 100mL round bottom flask, compound 10 (10 g,12.1 mmol), pd/C (1 g, 10%) was dissolved in 10mL methanol and 50mL ethyl acetate, nitrogen was substituted for air, a hydrogen balloon was added, and the reaction was carried out overnight at ambient temperature. The reaction solution was filtered through celite, the celite was rinsed with methanol, and the filtrate was dried under reduced pressure to give 8.5g of white solid with a yield of 95.5%. H NMR (400 MHz, DMSO-d 6) delta: 11.98 (s, 1H), 5.20 (s, 2H), 4.95 (q, j=4.2 hz, 2H), 4.51 (d, j=7.2 hz, 1H), 4.46 (d, j=7.2 hz, 1H), 4.15-3.97 (M, 6H), 3.89-3.79 (M, 2H), 3.80-3.69 (M, 1H), 3.46-3.36 (M, 1H), 2.22-2.14 (t, j=7.2 hz, 2H), 2.15 (s, 6H), 2.00 (s, 6H), 1.95 (s, 6H), 1.87 (s, 3H), 1.59-1.42 (M, 4H) & MS (ESI), M/z 759.26 ([ m+na ] ] ⁺ ).

EXAMPLE 7 Compound A ₂ -I ₂ Is synthesized by (a)

(1) Synthesis of Compound 11

In a 500mL round-bottomed flask, compound 9 (20 g,29.5 mmol), 10-undecenol (6 g,35.4 mmol) was dissolved in 200mL anhydrous DCM and BF was added dropwise under ice-bath ₃ -OEt ₂ (14.8 mL) was kept in an ice bath for 24h and TLC was monitored for completion. The mixture was filtered through celite, and the filtrate was dissolved in 500mL of ethyl acetate and washed with 200mL of a saturated sodium bicarbonate solution and 200mL of a saturated brine in this order. The organic phase is dried over anhydrous magnesium sulfate, concentrated under reduced pressure and separated by a silica gel column (petroleum ether: ethyl acetate V: v=3:2) to give 19.5g of a white solid with a yield of 83.9%, MS (ESI), M/z:811.25 ([ m+na)] ⁺ ).

(2) Compound A ₂ -I ₂ Is synthesized by (a)

Starting from compound 11, reference A ₁ -I ₂ And (5) synthesizing. The yield thereof was found to be 87%. ¹ HNMR(400MHz,DMSO-d6)δ：11.82(s,1H),5.86-5.73(m,1H),5.22(s,1H),5.2-4.9(m,6H),4.5-4.98(s,J＝3.5Hz,2H),4.08-3.99(m,3H),3.9-3.88(m,2H),3.73-3.65(m,2H),3.48-3.38(m,1H),2.12(s,6H),2.05-2.01(m,2H),2.00(s,6H),1.88(s,6H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,8H).MS(ESI),m/z:829.7([M+Na] ⁺ ).

EXAMPLE 8 Compound A ₃ -I ₁ Is synthesized by (a)

(1) Synthesis of Compound 12

Synthesis of reference compound 5. White solid, 91% yield. ¹ H NMR(400MHz,DMSO-d6)δ：5.63(d,J＝8.8Hz,1H),5.26(d,J＝3.1Hz,1H),5.05(d,J＝11.3,3.3Hz,1H),4.36(m,4H),2.11(s,3H),2.03(s,3H),1.98(s,3H),1.90(s,3H),1.78(s,3H).MS(ESI),m/z:391.21([M+1] ⁺ ).

(2) Synthesis of Compound 13

The synthesis of compound 10 was referenced using compound 12 as a starting material. Clear oily liquid, 86% yield.

¹ HNMR(400MHz,DMSO-d6)δ：7.33–7.16(m,5H),5.28(d,J＝5.3Hz,1H),4.95(s,2H),4.93(q,J＝4.2Hz,1H),4.40(d,J＝8.6Hz,1H),4.00–3.86(m,3H),3.73–3.56(m,1H),3.36–3.21(m,2H),2.53(t,J＝8.2Hz,2H),2.11(s,3H),1.89(s,3H),1.83(s,3H),1.65(s,3H),1.59–1.36(m,4H).MS(ESI),m/z:561.2([M+Na] ⁺ ).

(3) Compound A ₃ -I ₁ Is synthesized by (a)

Reference compound A using compound 13 as raw material ₁ -I ₁ Is a synthesis of (a). White solid, 93.5% yield. ¹ HNMR(400MHz,DMSO-d6)δ：11.98(s,1H),5.20(s,1H),4.95(q,J＝4.2Hz,1H),4.51(d,J＝7.2Hz,1H),4.15-3.97(m,3H),3.89-3.79(m,1H),3.80-3.69(m,1H),3.46-3.36(m,1H)，2.22-2.14(t,J＝7.2Hz,2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.59–1.42(m,4H).MS(ESI),m/z:471.5([M+Na] ⁺ ).

EXAMPLE 9 Compound A ₃ -I ₂ Is synthesized by (a)

(1) Synthesis of Compound 14

Synthesis of reference compound 11 using compound 12 as a starting material. White solid, yield 88%. ¹ HNMR(400MHz,DMSO-d6)δ：5.86-5.73(m,1H),5.22(s,1H),5.2-4.9(m,3H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:523.5([M+Na] ⁺ ).

(2) Compound A ₃ -I ₂ Is synthesized by (a)

Reference compound A using compound 14 as raw material ₁ -I ₂ Is a synthesis of (a). Pale brown jelly productThe yield of the product was 97%. ¹ HNMR(400MHz,DMSO-d6)δ：11.99(s,1H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.73-3.65(m,1H),3.48-3.38(m,1H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:541.3([M+Na] ⁺ ).

EXAMPLE 10 Compound A ₁ -IV ₁ Is synthesized by (a)

(1) Synthesis of Compound 15

Synthesis of reference compound 8 using compound 6 as starting material. MS (ESI), M/z 484.2 ([ M+1)] ⁺ ).

(2) Compound A ₁ -IV ₁ Is synthesized by (a)

Reference compound A using compound 15 as raw material ₁ -I ₂ Is a synthesis of (a). ¹ HNMR(400MHz,DMSO-d6)δ：11.88(s,1H),7.77-7.73(d,J＝8.9Hz,1H),5.21(s,1H),5.0-4.96(q,J＝4.2Hz,1H),4.45-4.51(d,J＝7.2Hz,1H),4.12-4.07(m,3H),3.88-3.78(m,1H),3.72-3.68(m，2H)，3.62-3.58(m，2H)，3.56-3.46(m,4H)，2.15(s，3H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H).MS(ESI),m/z:502.6([M+1] ⁺ ).

EXAMPLE 11 Compound A ₁ -I ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 16

Into a 250mL round bottom flask, compound A was added ₁ -I ₁ (10 g,22.35 mmol), 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC. HCl) (5.14 g,26.82 mmol), N-hydroxysuccinimide (2.83 g,24.59 mmol), dichloromethane 100mL. Stirring at normal temperature for 0.5h, and adding compound R ₁ H (8.79 g,22.35 mmol), TLC monitored the reaction, after 4HThe reaction was complete. The reaction solution was washed with 50mL of a saturated sodium hydrogencarbonate solution and 50mL of a saturated brine, and the organic phase was dried over anhydrous sodium sulfate, concentrated, and separated by a silica gel column (dichloromethane: methanol V: v=20:1) to give 15.8g of a white solid in 86% yield. MS (ESI), M/z 845.2 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -I ₁ -R ₁ Is synthesized by (a)

In a 250mL two-port flask, compound 16 (5 g,6.08 mmol), nitrogen-protected, 100mL of anhydrous acetonitrile, bis (diisopropylamino) (2-cyanoethoxy) phosphine (3.66 g,12.16 mmol) and a solution of ethylthiotetrazole in acetonitrile (2.5M) (1.22 mL,3.04 mmol) were added dropwise with stirring, the reaction was allowed to proceed for 0.5h, TLC monitored, and after 0.5h the reaction was complete. Acetonitrile was removed by concentration under reduced pressure, and 100mL of methylene chloride was added thereto to dissolve the mixture, followed by washing with 100mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated, and separated by a silica gel column (petroleum ether: ethyl acetate V: v=1:3) to give 5.16g of a white solid in 83% yield. ¹ H NMR(400MHz,DMSO-d6)δ：7.84-7.79(d,J＝8.9Hz,1H),7.65-7.60(d,J＝8.9Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15-4.06(m,3H),4.05-3.96(m,1H),3.84-3.80(m,2H),3.89-3.79(m,1H),3.74(s,6H),3.71-3.69(m,1H),3.46-3.36(m,1H)，3.04-2.99(m,2H),2.95-2.90(m,2H)，2.88-2.84(m,2H),2.59-2.54(m,2H),2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.77(s,12H)，1.59-1.42(m,4H).MS(ESI),m/z:1045.5([M+Na] ⁺ ).

EXAMPLE 12 Compound A ₁ -I ₁ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 17

In the form of compound A ₁ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 82.5%. MS (ESI), M/z 859.2 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -I ₁ -R ₂ Is synthesized by (a)

Reference compound A using compound 17 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.2%. ¹ H NMR(400MHz,DMSO-d6)δ：7.83-7.79(d,J＝8.8Hz,1H),7.42-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27–7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15–3.97(m,3H),4.05–3.96(m,1H),3.84–3.80(m,2H),3.89–3.79(m,1H),3.74(s,6H),3.71–3.69(m,1H),3.46–3.36(m,1H)，3.04–2.99(m,2H),2.98–2.95(m,2H)，2.89–2.93(m,4H)，2.88–2.84(m,2H),2.60–2.55(m,2H),2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.77(s,12H),1.59–1.42(m,4H).MS(ESI),m/z:1059.6([M+Na] ⁺ ).

EXAMPLE 13 Compound A ₁ -I _1- R ₃ Is synthesized by (a)

(1) Synthesis of Compound 18

In the form of compound A ₁ -I ₁ As starting material, reference compound 16 was synthesized. White solid, 86% yield. MS (ESI), M/z 871.2 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -I ₁ -R ₃ Is synthesized by (a)

Reference compound A using compound 18 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.2%.

¹ HNMR(400MHz,DMSO-d6)δ：7.73-7.70(d,J＝7.9Hz,1H),7.42-7.37(d,J＝7.2Hz,2H),7.35-7.29(t,J＝6.9Hz,2H),7.28–7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H),5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15–3.97(m,3H),3.89–3.79(m,3H),3.74(s,6H),3.70–3.67(m,1H),3.46–3.36(m,1H),3.05–2.99(m,3H),2.90–2.86(m,3H),2.77–2.71(m,1H),2.60–2.55(m,2H),2.22-2.14(t,J＝7.2Hz,2H),2.15(s,3H),2.00(s,3H),1.95(s,3H),1.87(s,3H),1.88–1.81(m,2H)，1.77(s,12H),1.59–1.42(m,4H).MS(ESI),m/z:1071.4([M+Na] ⁺ ).

EXAMPLE 14 Compound A ₁ -I ₂ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 19

In the form of compound A ₁ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 85.6%. MS (ESI), M/z 915.5 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -I ₂ -R ₁ Is synthesized by (a)

Reference compound A using compound 19 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 82.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.82-7.78(d,J＝7.3Hz,1H),7.69-7.63(d,J＝7.3Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27–7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),4.05–3.97(m,1H),3.9-3.88(m,1H),3.84–3.80(m,2H),3.74(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.04–2.99(m,2H),2.95–2.90(m,2H)，2.88–2.84(m,2H),2.61–2.55(m,2H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:1115.2([M+Na] ⁺ ).

EXAMPLE 15 Compound A ₁ -I ₂ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 20

In the form of compound A ₁ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 84.2%. MS (ESI),m/z:929.3([M+Na] ⁺ ).

(2) Compound A ₁ -I ₂ -R ₂ Is synthesized by (a)

Reference compound A using compound 20 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 81.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.83-7.77(d,J＝7.3Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27–7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.84–3.80(m,2H),3.74(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.15–3.11(m,4H),3.04–2.99(m,2H),2.95–2.90(m,2H)，2.88–2.84(m,2H),2.61–2.55(m,2H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:1129.4([M+Na] ⁺ ).

EXAMPLE 16 Compound A ₁ -I ₂ -R ₃ Is synthesized by (a)

(1) Synthesis of Compound 21

In the form of compound A ₁ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 80.5%. MS (ESI), M/z 941.1 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -I ₂ -R ₃ Is synthesized by (a)

Reference compound A using compound 21 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 81.1%

¹ HNMR(400MHz,DMSO-d6)δ：7.82(d,J＝3.3Hz,1H),7.42-7.37(d,J＝7.2Hz,2H),7.35-7.29(t,J＝6.9Hz,2H),7.28–7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H),5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.84–3.80(m,2H),3.76(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.05–2.99(m,3H),2.90–2.84(m,4H),2.77–2.71(m,1H),2.62–2.56(m,2H),2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.87–1.81(m,2H)，1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,10H).MS(ESI),m/z:1141.2([M+Na] ⁺ ).

EXAMPLE 17 Compound A ₂ -I ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 22

In the form of compound A ₂ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 80.4%. MS (ESI), M/z 1134.7 ([ M+Na)] ⁺ ).

(2) Compound A ₂ -I ₁ -R ₁ Is synthesized by (a)

Reference compound A using compound 22 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 81.3%. H NMR (400 MHz, DMSO-d 6) delta: 7.61-7.57 (d, j=7.2 hz, 1H), 7.41-7.37 (d, j=7.2 hz, 2H), 7.33-7.28 (t, j=6.9 hz, 2H), 7.27-7.19 (M, 5H), 6.91-6.86 (d, j=8.2 hz, 4H), 5.20 (s, 2H), 4.95 (q, j=4.2 hz, 2H), 4.51 (d, j=7.2 hz, 1H), 4.46 (d, j=7.2 hz, 1H), 4.15-3.97 (M, 6H), 4.05-3.97 (M, 1H), 3.89-3.79 (M, 4H), 3.75 (s, 6H), 3.80-3.69 (M, 1H), 3.46-3.36 (M, 1H), 3.04-2.99 (M, 2H), 2.88-2 (s, 2H), 4.2 (d, 1H), 4.46 (d, j=7.2 hz, 1H), 4.4.15-3.9 (i, 1H), 4.7 (d, 1H), 4.15-3.7 (M, 6H), 4.80-3.9 (s, 1H), 3.80-3.9 (2H), 2 (2 s, 2H) and 2.4 (2 (1H) ] ⁺ ).

EXAMPLE 18 Compound A ₂ -I ₁ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 23

In the form of compound A ₂ -Ι ₁ As starting material, reference compound 16 was synthesized. White solid, 86.1% yield. MS (ESI), m-z:1148.3([M+Na] ⁺ ).

(2) Compound A ₂ -I ₁ -R ₂ Is synthesized by (a)

Reference compound A using compound 23 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 82.3%. H NMR (400 MHz, DMSO-d 6) delta: 7.40-7.36 (d, j=7.2 hz, 2H), 7.33-7.28 (t, j=6.9 hz, 2H), 7.27-7.19 (M, 5H), 6.91-6.86 (d, j=8.2 hz, 4H), 5.20 (s, 2H), 4.95 (q, j=4.2 hz, 2H), 4.51 (d, j=7.2 hz, 1H), 4.46 (d, j=7.2 hz, 1H), 4.15-3.97 (M, 6H), 3.89-3.79 (M, 4H), 3.75 (s, 6H), 3.80-3.69 (M, 1H), 3.46-3.41 (M, 4H), 3.46-3.36 (M, 1H), 3.04-2.99 (M, 2H), 2.95-2.90 (M, 2H), 2.84-2.2H), 4.15-3.97 (M, 6H), 3.80-3.69 (M, 1H), 3.80-3.9 (M, 1H), 3.46 (M, 6H), 2.12-2.12 (M, 6H), 2.12-2 (M, 1H), 4.15-3.9 (M, 6H), 1.9 (M, 6.9-1H), 1.9 (M, 6.9-2H); 1348.2 ([ M+Na)] ⁺ ).

EXAMPLE 19 Compound A ₂ -I ₁ -R ₃ Is synthesized by (a)

(1) Synthesis of Compound 24

In the form of compound A ₂ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 82.9%. MS (ESI), M/z 1160.5 ([ M+Na)] ⁺ ).

(2) Compound A ₂ -I ₁ -R ₃ Is synthesized by (a)

Reference compound A using compound 24 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 82.3%. H NMR (400 MHz, DMSO-d 6) delta: 7.44-7.39 (d, j=7.2 hz, 2H), 7.36-7.30 (t, j=6.9 hz, 2H), 7.28-7.19 (m, 5H), 6.92-6.86 (d, j=8.2 hz, 4H), 5.20 (s, 2H), 4.95 (q, j=4.2 hz, 2H), 4.51 (d, j=7.2 hz, 1H), 4.46 (d, j=7.2 hz, 1H), 4.15-3.97 (m, 6H), 3.89-3.82 (m, 4H), 3.80-3.76 (m, 1H), 3.74 (s, 6H), 3.46-3.36 (m, 1H), 3.05-2.99 (m, 3H), 2.90-2.86 (m, 2H), 2.77-2.71 (m, 1H), 2.61 (m, 2H), 4.15-3.97 (m, 6H), 3.89-3.6 (s, 6H), 3.80-3.76 (m, 1H), 2.9-2 (s, 2H), 2.6-1 s, 1H) .81(m,2H)，1.77(s,12H)，1.59-1.42(m,4H).MS(ESI),m/z:1360.26([M+Na] ⁺ ).

EXAMPLE 20 Compound A ₂ -I ₂ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 25

In the form of compound A ₂ -I ₂ As starting material, reference compound 16 was synthesized. White solid, 86.3% yield. MS (ESI), M/z 1204.6 ([ M+Na)] ⁺ ).

(2) Compound A ₂ -I ₂ -R ₁ Is synthesized by (a)

Reference compound A using compound 25 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 80.3%. ¹ HNMR(400MHz,DMSO-d6)δ：7.71-7.66(d,J＝7.2Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.86-5.73(m,1H),5.22(s,1H),5.2-4.9(m,6H),4.5-4.98(s,J＝3.5Hz,2H),4.08-3.99(m,4H),3.9-3.88(m,2H),3.84-3.80(m,2H)，3.75(s,6H)，3.73-3.65(m,2H),3.48-3.38(m,1H),3.04-2.99(m,2H),2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.59-2.55(m,2H),2.12(s,6H),2.05-2.01(m,2H),2.00(s,6H),1.88(s,6H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,8H).MS(ESI),m/z:1404.7([M+Na] ⁺ ).

EXAMPLE 21 Compound A ₂ -I ₂ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 26

In the form of compound A ₂ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 87.3%. MS (ESI), M/z 1218.4 ([ M+Na)] ⁺ ).

(2) Compound A ₂ -I ₂ -R ₂ Is synthesized by (a)

Reference compound A using compound 26 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.3%. ¹ HNMR(400MHz,DMSO-d6)δ：7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.86-5.73(m,1H),5.22(s,1H),5.2-4.9(m,6H),4.5-4.98(s,J＝3.5Hz,2H),3.9-3.88(m,2H),3.84-3.80(m,2H)，3.75(s,6H)，3.73-3.65(m,2H),3.48-3.38(m,1H),3.3.16-3.12(m,4H),3.04-2.99(m,2H),2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.59-2.55(m,2H),2.12(s,6H),2.05-2.01(m,2H),2.00(s,6H),1.88(s,6H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,8H).MS(ESI),m/z:1418.7([M+Na] ⁺ ).

EXAMPLE 22 Compound A ₂ -I ₂ -R ₃ Is synthesized by (a)

(1) Synthesis of Compound 27

In the form of compound A ₂ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 88.0%. MS (ESI), M/z 1230.2 ([ M+Na)] ⁺ ).

(2) Compound A ₂ -I ₂ -R ₃ Is synthesized by (a)

Reference compound A using compound 27 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 87.0%. ¹ HNMR(400MHz,DMSO-d6)δ：7.42-7.37(d,J＝7.2Hz,2H),7.35-7.29(t,J＝6.9Hz,2H)，7.28-7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H)，5.86-5.73(m,1H),5.22(s,1H),5.2-4.9(m,6H),4.5-4.98(s,J＝3.5Hz,2H),4.08-3.99(m,3H),3.9-3.88(m,2H),3.84-3.80(m,2H),3.74(s,6H),3.73-3.65(m,2H),3.48-3.38(m,1H),3.05-2.99(m,3H)，2.90-2.86(m,4H)，2.77-2.71(m,1H)，2.60-2.56(m,2H)，2.12(s,6H),2.05-2.01(m,2H),2.00(s,6H),1.88(s,6H),1.86-1.81(m,2H)，1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H),1.29-1.19(m,8H).MS(ESI),m/z:1430.2([M+Na] ⁺ ).

EXAMPLE 23 Compound A ₃ -I ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 28

In the form of compound A ₃ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 88.2%. MS (ESI), M/z 846.3 ([ M+Na)] ⁺ ).

(2) Compound A ₃ -I ₁ -R ₁ Is synthesized by (a)

Reference compound A using compound 28 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.2%. ¹ HNMR(400MHz,DMSO-d6)δ：7.61-7.56(d,J＝7.2Hz,1H),7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.20(s,1H),4.95(q,J＝4.2Hz,1H),4.51(d,J＝7.2Hz,1H),4.15-3.97(m,4H),3.89–3.79(m,3H),3.75(s,6H),3.73–3.69(m,1H),3.46–3.36(m,1H),3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.77(s,12H)，1.59-1.42(m,4H).MS(ESI),m/z:1046.5([M+Na] ⁺ ).

EXAMPLE 24 Compound A ₃ -I ₁ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 29

In the form of compound A ₃ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 88.9%. MS (ESI), M/z 860.3 ([ M+Na)] ⁺ ).

(2) Compound A ₃ -I ₁ -R ₂ Is synthesized by (a)

Reference compound A using compound 29 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.7%. ¹ HNMR(400MHz,DMSO-d6)δ：7.41-7.37(d,J＝7.2Hz,2H),7.33-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H),5.20(s,1H),4.95(q,J＝4.2Hz,1H),4.51(d,J＝7.2Hz,1H),3.89-3.79(m,3H),3.75(s,6H),3.73-3.69(m,1H),3.46-3.36(m,1H),3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.82-2.78(m,4H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz,2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.77(s,12H)，1.59–1.42(m,4H).MS(ESI),m/z:1060.5([M+Na] ⁺ ).

EXAMPLE 25 Compound A ₃ -I ₁ -R ₃ Is synthesized by (a)

(1) Synthesis of Compound 30

In the form of compound A ₃ -I ₁ As starting material, reference compound 16 was synthesized. White solid, yield 84.3%. MS (ESI), M/z 872.7 ([ M+Na)] ⁺ ).

(2) Compound A ₃ -I ₁ -R ₃ Is synthesized by (a)

Reference compound A using compound 30 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, 86.2% yield. ¹ HNMR(400MHz,DMSO-d6)δ：7.46-7.39(d,J＝7.2Hz,2H),7.37-7.31(t,J＝6.9Hz,2H),7.28-7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H),5.20(s,1H),4.95(q,J＝4.2Hz,1H),4.51(d,J＝7.2Hz,1H),4.15-3.97(m,3H),3.89-3.79(m,3H),3.76(s,6H),3.72-3.68(m,1H),3.46-3.36(m,1H)，3.05-2.99(m,3H),2.90-2.86(m,2H),2.88-2.84(m,2H)，2.77-2.71(m,1H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz,2H)，2.15(s,3H)，2.00(s,3H)，1.95(s,3H)，1.87(s,3H)，1.86-1.81(m,2H)，1.77(s,12H)，1.59–1.42(m,4H).MS(ESI),m/z:1072.8([M+Na] ⁺ ).

EXAMPLE 26 Compound A ₃ -I ₂ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 31

In the form of compound A ₃ -I ₂ As starting material, reference compound 16 was synthesized. White solid, 86.2% yield. MS (ESI), M/z 916.4 ([ M+Na)] ⁺ ).

(2) Compound A ₃ -I ₂ -R ₁ Is synthesized by (a)

Reference compound A using compound 31 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 85.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.75-7.71(d,J＝7.2Hz,1H),7.42-7.39(d,J＝7.2Hz,2H),7.32-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H)，5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.05-3.99(m,4H),3.9-3.88(m,1H),3.84-3.80(m,2H)，3.76(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.87-2.84(m,2H)，2.58-2.54(m,2H)，2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H)，1.29-1.19(m,10H).MS(ESI),m/z:1116.6([M+Na] ⁺ ).

EXAMPLE 27 Compound A ₃ -I ₂ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 32

In the form of compound A ₃ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 82.9%. MS (ESI), M/z 930.7 ([ M+Na) ] ⁺ ).

(2) Compound A ₃ -I ₂ -R ₂ Is synthesized by (a)

Reference compound A using compound 32 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.3%. ¹ HNMR(400MHz,DMSO-d6)δ：7.44-7.39(d,J＝7.2Hz,2H),7.32-7.28(t,J＝6.9Hz,2H),7.27-7.19(m,5H),6.91-6.86(d,J＝8.2Hz,4H)，5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),3.9-3.88(m,1H),3.84-3.80(m,2H)，3.76(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.04-2.99(m,2H)，2.97-2.94(m,2H)，2.93-2.88(m,4H)，2.87-2.84(m,2H)，2.58-2.54(m,2H)，2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H),1.39-1.3(m,2H)，1.29-1.19(m,10H).MS(ESI),m/z:1130.6([M+Na] ⁺ ).

EXAMPLE 28 Compound A ₃ -I ₂ -R ₃ Is synthesized by (a)

(1) Synthesis of Compound 33

In the form of compound A ₃ -I ₂ As starting material, reference compound 16 was synthesized. White solid, yield 83.8%. MS (ESI), M/z 942.4 ([ M+Na)] ⁺ ).

(2) Compound A ₃ -I ₂ -R ₃ Is synthesized by (a)

Reference compound A using compound 33 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 85.2%. ¹ HNMR(400MHz,DMSO-d6)δ：7.46-7.41(d,J＝7.2Hz,2H),7.37-7.31(t,J＝6.9Hz,2H),7.28-7.19(m,5H),6.92-6.86(d,J＝8.2Hz,4H)，5.22(s,1H),5.02-4.9(m,1H),4.5-4.98(s,J＝3.5Hz,1H),4.08-3.99(m,3H),3.9-3.88(m,1H),3.84-3.80(m,2H)，3.75(s,6H),3.73-3.65(m,1H),3.48-3.38(m,1H),3.05-3.00(m,3H),2.91-2.86(m,2H)，2.88-2.84(m,2H)，2.77-2.71(m,1H)，2.59-2.54(m,2H)，2.12(s,3H),2.05-2.01(m,2H),2.00(s,3H),1.88(s,3H),1.86-1.81(m,2H)，1.77(s,12H)，1.66(s,3H),1.5-1.4(m,2H)，1.39-1.3(m,2H)，1.29-1.19(m,10H).MS(ESI),m/z:1142.5([M+Na] ⁺ ).

EXAMPLE 29 Compound A ₁ -II ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 34

In a 250mL round bottom flask was added the compound N-benzyloxycarbonyl-6-aminocaproic acid (10 g,37.69 mmol), 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC. HCl) (8.67 g,45.23 mmol), N-hydroxysuccinimide (4.67 g,41.46 mmol), dichloromethane 100mL. Stirring at normal temperature for 0.5h, and adding compound R' ₁ H (14.8 g,37.69 mmol), TLC monitored reaction, after 4H reaction was complete. The reaction solution was washed with 50mL of a saturated sodium hydrogencarbonate solution and 50mL of a saturated brine, and the organic phase was dried over anhydrous sodium sulfate, concentrated, and separated by a silica gel column (ethyl acetate: petroleum ether V: v=4:1) to give 19.8g of a white solid in 82.1% yield. MS (ESI), M/z 663.1 ([ M+Na) ] ⁺ ).

(2) Synthesis of Compound 35

A100 mL round bottom flask, compound 34 (5 g,7.8 mmmol), pd/C (0.5 g, 10%) was dissolved in 10mL methanol and 40mL ethyl acetate, and the reaction was monitored by TLC with hydrogen balloon and completed after 6 h. The reaction solution was filtered through celite, the celite was rinsed with methanol, and the filtrate was concentrated under reduced pressure and dried to give 3.8g of white solid with 96.1% yield. ¹ HNMR(400MHz,DMSO-d6)δ：7.64-7.61(d,J＝7.2Hz,1H),7.43-7.37(d,J＝8.2Hz,2H)，7.33-7.28(t,J＝6.9Hz,2H)，7.27-7.19(m,5H),6.92-6.87(d,J＝8.2Hz,4H)，5.12(m,2H)，4.63-4.58(m,1H)，4.05-3.97(m,1H),3.73(s,6H),3.5-3.42(m,2H),3.04-2.99(m,2H),2.95-2.90(m,2H)，2.12-2.06(m,2H)，1.52-1.45(m,2H)，1.42-1.35(m,2H)，1.28-1.20(m,2H).MS(ESI),m/z:529.3([M+Na] ⁺ ).

(3) Synthesis of Compound 36

Into a 250mL round bottom flask, compound A was added ₁ -I ₁ (10 g,22.37 mmol), 1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDC. HCl) (5.15 g,26.85 mmol), N-hydroxysuccinimide (2.83 g,24.61 mmol), dichloromethane 100mL. After stirring the reaction at room temperature for 0.5h, compound 35 (11.32 g,22.37 mmol) was added and the reaction was monitored by TLC and after 6h the reaction was complete. The reaction solution was washed with 50mL of a saturated sodium hydrogencarbonate solution and 50mL of a saturated brine, and the organic phase was dried over anhydrous sodium sulfate, concentrated, and purified by passing through a silica gel column (dichloromethane: methanol V: v=20: 1) 17.3g of white solid was isolated in 82.7% yield. MS (ESI), M/z 958 ([ M+Na)] ⁺ ).

(4) Compound A ₁ -II ₁ -R ₁ Is synthesized by (a)

Reference compound A using compound 36 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.7%. ¹ HNMR(400MHz,DMSO-d6)δ：7.84-7.80(d,J＝7.2Hz,1H),7.72-7.66(m,1H)，7.64-7.61(d,J＝7.2Hz,1H),7.43-7.37(d,J＝8.2Hz,2H)，7.33-7.28(t,J＝6.9Hz,2H)，7.27-7.19(m,5H),6.92-6.87(d,J＝8.2Hz,4H)，5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15-4.11(m,3H),4.05-3.97(m,1H)，3.89-3.79(m,3H),3.76(s,6H),3.74-3.69(m,1H),3.54-3.49(m,2H)，3.46-3.36(m,1H)，3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.12-2.06(m,2H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H)，1.77(s，12H)，1.59-1.42(m,6H)，1.41-1.35(m,2H)，1.28-1.20(m,2H).MS(ESI),m/z:1158.5([M+Na] ⁺ ).

EXAMPLE 30 Compound A ₁ -II ₁ -R ₂ Is synthesized by (a)

(1) Synthesis of Compound 37

In the form of compound R' ₂ -synthesis of reference compound 34 starting from H. White solid, yield 84.3%. MS (ESI), M/z 677.5 ([ M+Na)] ⁺ ).

(2) Synthesis of Compound 38

Synthesis of reference compound 35 using compound 37 as a starting material. White solid, yield 88.2%.1HNMR (400 MHz, DMSO-d 6) delta: 7.44-7.38 (d, j=8.2 hz, 2H), 7.34-7.29 (t, j=6.9 hz, 2H), 7.28-7.20 (m, 5H), 6.92-6.87 (d, j=8.2 hz, 4H), 5.12 (m, 2H), 4.63-4.58 (m, 1H), 3.73 (s, 6H), 3.5-3.42 (m, 2H), 3.04-2.99 (m, 2H), 2.95-2.90 (m, 2H), 2.88-2.82 (m, 4H), 2.12-2.06 (m, 2H), 1.52-1.45 (m, 2H), 1.42-1.35 (m, 2H), 1.28-1.20%m,2H).MS(ESI),m/z:543.3([M+Na] ⁺ ).

(3) Synthesis of Compound 39

Synthesis of reference compound 36 starting from compound 38. White solid, yield 80.7%. MS (ESI), M/z 972.6 ([ M+Na)] ⁺ ).

(4) Compound A ₁ -II ₁ -R ₂ Is synthesized by (a)

Reference compound A using compound 39 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.83-7.79(d,J＝7.2Hz,1H),7.72-7.66(m,1H)，7.42-7.36(d,J＝8.2Hz,2H)，7.33-7.28(t,J＝6.9Hz,2H)，7.27-7.19(m,5H),6.92-6.87(d,J＝8.2Hz,4H)，5.20(s,1H),5.0-4.95(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H)，4.15-4.10(m,3H)，3.89-3.79(m,3H)，3.76(s,6H),3.74-3.69(m,1H),3.54-3.49(m,2H)，3.46-3.36(m,1H)，3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.88-2.84(m,6H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz,2H)，2.15(s,3H)，2.12-2.06(m,2H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H)，1.77(s，12H)，1.59-1.42(m，6H)1.41-1.35(m,2H)，1.28-1.20(m,2H).MS(ESI),m/z:1172.7([M+Na] ⁺ ).

EXAMPLE 31 Compound A ₁ -III ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 40

Synthesis of reference compound 34 using compound 35 as a starting material. White solid, yield 82.6%. MS (ESI), M/z 776.7 ([ M+Na)] ⁺ ).

(2) Synthesis of Compound 41

Synthesis of reference compound 35 using compound 40 as a starting material. White solid, yield 96.7%. ¹ HNMR(400MHz,DMSO-d6)δ：7.71-7.67(m,1H),7.65-7.62(d,J＝7.2Hz,1H),7.45-7.39(d,J＝8.2Hz,2H)，7.34-7.29(t,J＝6.9Hz,2H)，7.26-7.19(m,5H),6.93-6.88(d,J＝8.2Hz,4H)，5.14(m,2H)，4.64-4.58(m,1H)，4.05-3.98(m,1H),3.72(s,6H),3.5-3.43(m,4H),3.05-2.99(m,2H),2.95-2.90(m,2H)，2.12-2.06(m,4H)，1.52-1.45(m,4H)，1.41-1.35(m,4H)，1.29-1.20(m,4H).MS(ESI),m/z:642.3([M+Na] ⁺ ).

(3) Synthesis of Compound 42

Synthesis of reference compound 36 using compound 41 as a starting material. White solid, yield 86.3%. MS (ESI), M/z 1071.4 ([ M+Na)] ⁺ ).

(4) Compound A ₁ -III ₁ -R ₁ Is synthesized by (a)

Reference compound A using compound 42 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). White solid, yield 84.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.85-7.81(d,J＝7.2Hz,1H),7.78-7.74(m,1H),7.72-7.66(m,1H)，7.65-7.61(d,J＝7.2Hz,1H),7.42-7.38(d,J＝8.2Hz,2H)，7.34-7.29(t,J＝6.9Hz,2H)，7.27-7.18(m,5H),6.93-6.87(d,J＝8.2Hz,4H)，5.22(s,1H),5.0-4.96(q,J＝4.2Hz,1H),4.51-4.46(d,J＝7.2Hz,1H),4.15-4.11(m,3H),4.05-3.97(m,1H)，3.89-3.79(m,3H),3.76(s,6H),3.74-3.69(m,1H),3.54-3.49(m,4H)，3.46-3.36(m,1H)，3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.88-2.84(m,2H)，2.59-2.54(m,2H)，2.22-2.14(t,J＝7.2Hz，2H)，2.15(s,3H)，2.12-2.06(m,4H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H)，1.77(s，12H)，1.59-1.42(m,8H)，1.41-1.35(m,4H)，1.28-1.20(m,4H).MS(ESI),m/z:1271.2([M+Na] ⁺ ).

EXAMPLE 32 Compound A ₁ -IV ₁ -R ₁ Is synthesized by (a)

(1) Synthesis of Compound 43

In the form of compound A ₁ -III ₁ As starting material, reference compound 16 was synthesized. White solid, yield 82.8%. MS (ESI), M/z 877.4 ([ M+Na)] ⁺ ).

(2) Compound A ₁ -III ₁ -R ₁ Is synthesized by (a)

In the form of compounds40 as raw material, reference compound A ₁ -I ₁ -R ₁ Is a synthesis of (a). The yield was 82.9%. ¹ HNMR(400MHz,DMSO-d6)δ：7.76-7.72(d,J＝8.9Hz,1H)，7.70-7.66(d,J＝8.0Hz,1H)，7.40-7.36(d,J＝7.2Hz,2H),7.32-7.28(t,J＝6.9Hz,2H)，7.27-7.19(m,5H)，6.91-6.86(d,J＝8.2Hz,4H，5.21(s,1H),5.0-4.96(q,J＝4.2Hz,1H)，4.45-4.51(d,J＝7.2Hz,1H)，4.12-4.07(m,3H)，4.05-3.97(m,1H),3.88-3.78(m,3H)，3.74(s,6H)，3.72-3.68(m，2H)，3.62-3.58(m，2H)，3.56-3.46(m,4H)，3.04-2.99(m,2H)，2.95-2.90(m,2H)，2.89-2.85(m,2H)，2.58-2.53(m,2H)，2.15(s，3H)，2.00(s，3H)，1.95(s，3H)，1.88(s，3H)，1.76(s,12H).MS(ESI),m/z:502.6([M+1] ⁺ ). ¹ HNMR(400MHz,DMSO-d6)δ：MS(ESI),m/z:1077.3([M+Na] ⁺ ).

EXAMPLE 33 Compound A ₁ -V ₁ -R ₄ Is synthesized by (a)

(1) Synthesis of Compound 44

250mL round bottom flask, compound 6 (5 g,15.2 mmol), 1, 6-hexanediol (9 g,76 mmol) was dissolved in anhydrous 1, 2-dichloroethane 100mL, trimethylsilicone triflate (0.55 mL,3 mmol) was added after stirring for 30 min, reaction was allowed to proceed overnight at ambient temperature, the reaction solution was extracted with dichloromethane, the organic phase was washed twice with 80mL of saturated sodium bicarbonate solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and separated over a silica gel column (petroleum ether: ethyl acetate V: V=3:2) to give a clear oily liquid 5.86g, 86.2% yield. MS (ESI), M/z 470.2 ([ M+Na) ] ⁺ ).

(2) Compound A ₁ -V ₁ -R ₄ Is synthesized by (a)

Reference compound A using compound 41 as raw material ₁ -I ₁ -R ₁ Is a synthesis of (a). The yield was 84.1%. ¹ HNMR(400MHz,DMSO-d6)δ：7.80-7.75(d,J＝8.9Hz,1H),5.21(s,1H),5.02-4.95(q,J＝4.2Hz,1H),4.50-4.76(d,J＝7.2Hz,1H),4.12-4.07(m,3H),3.88-3.79(m,3H),3.80-3.69(m,2H),3.46-3.36(m,2H)，2.88-2.84(m,2H)，2.59-2.54(m,2H),2.23-2.28(m，2H)，2.22-2.14(m，2H)，2.15(s，3H)，2.00(s，3H)，1.95(s，3H)，1.87(s，3H)，1.79(s,12H)，1.58-1.42(m，4H).MS(ESI),m/z:870.5([M+Na] ⁺ ).

EXAMPLE 34 preparation of modified Single-stranded oligonucleotides

In this example, modified oligonucleotides were synthesized according to the theoretical yield of 1. Mu. Mol, as follows:

(1) 1. Mu. Mol of CPG or 3 '-cholesterol modified CPG (purchased from Chemgenes), a monomer of 2' -O-TBDMS protected RNA phosphoramidite, a DNA monomer, a 2 '-methoxy monomer, and a 2' -fluoro monomer (purchased from Sigma Aldrich) were weighed and dissolved in anhydrous acetonitrile to a concentration of 0.2M. For phosphobackbone thio-modified oligonucleotides, 0.2M PADS solution was used as the thio reagent. 5-ethylthio-1H-tetrazole (purchased from Chemgenes) acetonitrile solution is prepared as an activator (0.25M), a pyridine/water solution of 0.02M iodine is prepared as an oxidant, and a 3% trichloroacetic acid dichloromethane solution is used as a deprotection reagent, and the solution is placed at a designated position of a reagent corresponding to an ABI 394 type DNA/RNA automatic synthesizer.

(2) Setting synthesis program, inputting the base sequence of the specified oligonucleotide, checking, starting to synthesize cyclic oligonucleotide, coupling for 6 min each step, and preparing galactose ligand corresponding monomer (A _x -linker-R _x Compound) coupling time is 10-20 minutes. After automatic circulation, the oligonucleotide solid phase synthesis is completed.

(3) CPG was dried with dry nitrogen, transferred to a 5mL EP tube, 2mL of ammonia/ethanol solution (3/1) was added, and heated at 55deg.C for 16-18 hours. Centrifuging at 10000rpm for 10min to obtain supernatant, and pumping to obtain white colloidal solid. The solid was dissolved in 200. Mu.L of 1M TBAF in THF and shaken at room temperature for 20 hours. 0.5mL of 1M Tris-HCl buffer (pH 7.4) was added, and the mixture was shaken at room temperature for 15 minutes, and the mixture was pumped to a volume of 1/2 of the original volume by a centrifugal pump, and THF was removed. The solution was extracted 2 times with 0.5mL of chloroform, 1mL of 0.1M TEAA loading solution was added, and the mixed solution was poured into a solid phase extraction column to remove excess salt from the solution.

(4) The concentration of the obtained oligonucleotide was determined by a micro ultraviolet spectrophotometer (KO 5500). Mass spectrometry analysis was performed on an Oligo HTCS LC-MS system (Novatia) system. Nucleic acid molecular weights were calculated normalized by Promass software after primary scanning.

EXAMPLE 35 preparation of modified Single-stranded oligonucleotides

In this example, modified oligonucleotides were synthesized according to a specification of 1. Mu. Mol of theory, as follows:

(1) 1. Mu. Mol of CPG or 3' -cholesterol modified CPG (purchased from Chemgenes) as a general solid support was weighed, and the DNA monomer, 2' -methoxy monomer, and 2' -fluoro monomer (purchased from Sigma Aldrich) were dissolved in an anhydrous acetonitrile solution to a concentration of 0.2M. For phosphobackbone thio-modified oligonucleotides, 0.2M PADS solution was used as the thio reagent. 5-ethylthio-1H-tetrazole (purchased from Chemgenes) acetonitrile solution is prepared as an activator (0.25M), a pyridine/water solution of 0.02M iodine is prepared as an oxidant, and a 3% trichloroacetic acid dichloromethane solution is used as a deprotection reagent, and the solution is placed at a designated position of a reagent corresponding to an ABI 394 type DNA/RNA automatic synthesizer.

(2) Setting synthesis program, inputting the base sequence of the specified oligonucleotide, checking for error, starting cyclic oligonucleotide synthesis, coupling for 6 min each step, galactose ligand (A) _x -linker-R _x Compound) corresponds to a monomer coupling time of 6-10 minutes. After automatic circulation, the oligonucleotide solid phase synthesis is completed.

(3) CPG was dried with dry nitrogen, transferred to a 5mL EP tube, added with 2mL of aqueous ammonia solution and heated at 55deg.C for 16-18 hours. Centrifuging at 10000rpm for 10min to obtain supernatant, and pumping to obtain white or yellow colloidal solid. 1mL of 0.1M TEAA loading solution was added, and the mixed solution was poured into a solid phase extraction column to remove excess salt from the solution.

EXAMPLE 36 preparation of modified double-stranded oligonucleotides

The process is as follows: after completion of the preparation of the modified single-stranded oligonucleotide, the ultraviolet absorption content was 1:1, heating to 95 ℃ for three minutes, and cooling to room temperature to form double chains.

In examples 34-36, for modified oligonucleotides with crude purities below 50%, purification was performed by linear gradient on DNAPAc PA-100 ion exchange column, mobile phase A:20mM NaOH; mobile phase B:20mM NaOH+2M NaCl.

The sequences of exemplary modified oligonucleotides and corresponding molecular weight measurements are shown in Table 1.

Abbreviations description: n=rna; dn=dna; mn=2' ome modification; fn=2' f modification.

TABLE 1

/>

Example 37 cell targeting detection of modified oligonucleotides.

Modified oligonucleotides for animal experiments were filtered through a 0.22 μm membrane prior to injection.

1. Primary hepatocyte isolation in mice

The mice were anesthetized, the skin and muscle layers were cut, the liver exposed, a perfusion catheter was inserted into the portal vein, and the inferior vena cava cut open a small opening, ready for liver perfusion. Pre-heat perfusion Solution I (Hank's, 0.5mM EGTA, pH 8) and perfusion Solution II (Low-glucose DMEM,100U/mL Type IV, pH 7.4) at 40℃and perfuse liver along portal vein cannulation at 37℃ perfusion Solution I, flow rate 7mL/min, perfuse 5min, liver greying grey. The liver was then perfused with perfusion Solution II at 37℃at a flow rate of 7mL/min for 7min. After completion of perfusion, the liver was removed and placed in Solution III (10% FBS low-glucose DMEM,4 ℃) to terminate digestion, forceps were used to scratch the liver capsule, and hepatocytes were released by gentle shaking. The hepatocytes were filtered through a 70 μm cell filter, and the supernatant was discarded after centrifugation at 50g for 2 min. Cells were resuspended in Solution IV (40% percoll low-glucose DMEM,4 ℃) and the supernatant discarded after centrifugation at 100g for 2 min. Cells were resuspended in 2% FBS low-glucose DMEM for later use. Trypan blue staining identified cell viability.

2. Determination of GalNAc binding Curve and Kd value

Freshly isolated mouse primary hepatocytes were plated into 96-well plates, 2×10 ⁴ 100. Mu.L/well. GalNAc-siRNA was added to each well. Each GalNAc-siRNA was set to a final concentration of 0.9nM, 2.7nM, 8.3nM, 25nM, 50nM or 100nM. After incubation for 2h at 4℃50g was centrifuged for 2min and the supernatant discarded. The cells were resuspended in PI at 10. Mu.g/mL, stained for 10min, and centrifuged at 50g for 2min. Cells were washed with pre-chilled PBS and centrifuged at 50g for 2min, and the supernatant was discarded. PBS resuspended cells. Flow cytometer to determine average fluorescence intensity of living cells MFI (Mean Fluorescence Intensity), graphPad Prism 5 software to perform nonlinear fitting and dissociation constant K _d And (5) calculating a value. The results are shown in Table 2, table 3 and FIG. 1. The data show that GalNAc-siRNA can specifically target liver cells; galNAc ligand and cell receptor have Kd value between 7.6-53.4nM, and have relatively high affinity (Ki value 5.2-51.3 nM) compared with galactose ligand preferred in the prior art (PCT/US 2014/046425), galNAc-siRNA with different conjugate structures has a certain difference in receptor binding capacity, and A3 and A4 structures have relatively strong receptor affinity (smaller Kd value and larger affinity).

TABLE 2 Each experimental group K _d Values (nM) and B _max Value of

TABLE 3 experiment groups K _d Values (nM) and B _max Value of

EXAMPLE 38 in vivo liver targeting assay

The test was performed using 13 SPF-grade Balb/c-nu mice (purchased from Peking Violet laboratory animal Co., ltd.) of 6-7 weeks old, randomly divided into 4 groups, a blank control group, a P8G8 control group (unconjugated ligand), a P8G8-A3 group, and a P8G8-B3 group. The animals in each group were 2, 3, 4, and 4 animals, respectively, and were administered by tail vein injection at a dose of about 10mg/kg (see Table 4 for experimental design). All animals were imaged in vivo, including white light and X-ray imaging, pre-drug, 15min, 30min, 1h, 2h, 4h, 6h post-drug administration. After euthanasia 6 hours post-drug, brains, salivary glands, hearts, spleens, lungs, livers, kidneys and intestines were removed for ex vivo organ imaging.

TABLE 4 liver targeting protocol

The results of the in vitro imaging analysis (tables 5-6) showed that the fluorescence intensities of the livers of the P8G8-A3 group and the P8G8-B3 group were higher than those of the negative control group at 6 hours after the administration. The results show that both P8G8-A3 and P8G8-B3 have certain targeting to the liver.

TABLE 5 statistics of fluorescence intensity values of isolated organs after background subtraction (. Times.10) ⁸ ps/mm ² )

TABLE 6 results of fluorescence intensity ratios

	Salivary gland	Liver	Kidneys (kidney)	Intestinal tract
					P8G8-A3/P8G8	1.05	3.50	1.12	1.19
P8G8-B3/P8G8	1.10	2.88	0.92	1.30

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate that: many modifications and variations of the details are possible in light of the above teachings, and such variations are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Sequence listing

<110> Guangzhou City Ruibo biotechnology Co., ltd

<120> modified oligonucleotides and compounds useful for synthesizing the modified oligonucleotides

<130> IDC170149

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> RNA

<213> artificial sequence

<220>

<223> synthetic oligonucleotides

<400> 1

cagcaagugu gacagucau 19

<210> 2

<211> 25

<212> RNA

<213> artificial sequence

<220>

<223> synthetic oligonucleotides

<400> 2

augacuguca cacuugcugg ccugu 25

<210> 3

<211> 19

<212> RNA

<213> artificial sequence

<220>

<223> synthetic oligonucleotides

<400> 3

caggccagca agugugaca 19

<210> 4

<211> 21

<212> RNA

<213> artificial sequence

<220>

<223> synthetic oligonucleotides

<400> 4

ugucacacuu gctggccugu c 21

Claims

1. Compounds comprising oligonucleotide and conjugate groups of the general formulaWherein PN is an oligonucleotide, Y is 1, X is 2 or 3, each M has the same structure, and M _T Having the same A as M _x A structure; m is M _T X M are selected from the group of conjugates represented by formula (1') as shown in formula (1),

wherein A is _x Ligands for human asialoglycoprotein receptors of the structure

linker is a connecting arm, Q is hydroxyl;

the linker has a structure shown in formula (i)

n is 1.

2. The compound of claim 1, wherein the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide.

3. The compound of claim 1, wherein the oligonucleotide comprises one or more modified nucleotides.

4. The compound of claim 3, wherein the one or more modified nucleotides are each independently selected from the group consisting of: 2' -methoxyethyl modified nucleotide, 2' -O-alkyl modified nucleotide, 2' -O-allyl modified nucleotide, 2' -C-allyl modified nucleotide, 2' -fluoro modified nucleotide, 2' -deoxy modified nucleotide, 2' -hydroxy modified nucleotide, locked nucleotide, unlocked nucleic acid, hexitol nucleic acid.

5. The compound of claim 3, wherein the modified nucleotide is a 2' -O-methyl modified nucleotide.

6. The compound of claim 3, wherein the modified nucleotide is selected from the group consisting of a 2 '-O-alkyl modified nucleotide, a 2' -fluoro modified nucleotide.

7. The compound of claim 1, wherein the oligonucleotide has a terminal modification.

8. The compound of claim 7, wherein the terminal modifier is selected from the group consisting of: cholesterol, polyethylene glycol, fluorescent probes, biotin, polypeptides, vitamins, tissue targeting molecules, and any combination thereof.

9. The compound of claim 1, wherein the phosphate-containing backbone of the oligonucleotide is modified.

10. The compound of claim 9, wherein the modification is a thio modification.

11. The compound of claim 1, wherein the oligonucleotide is an siRNA.

12. The compound of claim 11, wherein the siRNA comprises a sense strand and an antisense strand that are complementary to form a double strand.

13. The compound of claim 11, wherein said siRNA comprises a sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

14. The compound of claim 1, wherein the compound is selected from the group consisting of,each independently ligating to the 3 'end, 5' end or sequence intermediate of either strand of the oligonucleotide.

15. The compound of claim 1, wherein the compound is selected from the group consisting of,is linked to the oligonucleotide by a phosphotriester linkage.

16. The compound of claim 1, wherein M and M _T Or M and M are connected through a phosphotriester bond.

17. The compound of claim 1, wherein the oligonucleotide is a single stranded oligonucleotide.

18. The compound of claim 17, wherein the compound is selected from the group consisting of,ligating to the 3 'end or the 5' end of the oligonucleotide.

19. The compound of claim 1, wherein the oligonucleotide is a double-stranded oligonucleotide.

20. The compound of claim 19, wherein the compound is selected from the group consisting of,ligating to the 3 'end or the 5' end of either strand of the oligonucleotide.

21. A pharmaceutical composition comprising a compound according to any one of claims 1-20.

22. The pharmaceutical composition of claim 21, further comprising a pharmaceutically acceptable carrier.