CN109953904B - Moisturizing face cream containing tremella spore extracellular polysaccharide - Google Patents

Abstract

The invention discloses a moisturizing cream containing tremella spore extracellular polysaccharide. The preparation process of the tremella spore exopolysaccharide comprises the following steps: taking the supernatant of the tremella spore fermentation liquid, adding absolute ethyl alcohol for precipitation; and then adding water to dissolve the precipitate, taking the supernatant, removing protein by a Sevage method, centrifuging to obtain the supernatant, adding ethanol for precipitation, and freeze-drying the precipitate to obtain the tremella spore extracellular polysaccharide. According to the invention, the fermentation liquor of tremella spores is used as a raw material, extracellular polysaccharide with a moisturizing effect is separated and extracted from the fermentation liquor, and the purified extracellular polysaccharide has a good moisturizing effect, even the moisturizing effect is superior to that of glycerol; meanwhile, the exopolysaccharide has good antioxidation effect, and can be used as a moisturizing active ingredient and an antioxidant active ingredient for preparing skin care products; the prepared skin care product has a good moisturizing effect and also has a function of repairing cell damage caused by UVB radiation.

Description

Moisturizing face cream containing tremella spore extracellular polysaccharide

Technical Field

The invention relates to the technical field of skin care products, and particularly relates to a moisturizing cream containing tremella spore exopolysaccharide.

Background

The tremella polysaccharide is heteropolysaccharide extracted and purified from sporophore, deep fermented spore liquid, etc. of tremella, and may be divided into neutral polysaccharide, acid polysaccharide, extracellular polysaccharide, cell wall polysaccharide and acid oligosaccharide based on its property and source, and has the functions of promoting body's immunity, inhibiting tumor, lowering blood sugar and blood fat content, eliminating free radical, delaying body's senility and protecting body from radiation damage.

However, when the polysaccharide is extracted from the fruiting body of the tremella fuciformis and is utilized, on one hand, the growth of the fruiting body of the tremella fuciformis needs a longer time; on the other hand, the content of polysaccharide in the tremella sporocarp is low, so that the cost is high, time and labor are wasted, the efficiency is extremely low, and the application of the tremella sporocarp polysaccharide is limited. Moreover, the tremella extracellular polysaccharide is rarely researched at present, and has a great exploration space.

Therefore, it is necessary to provide a method for obtaining tremella polysaccharide with high efficiency, research on extraction and purification processes of tremella polysaccharide and establishment of related structure-activity relationship, which is beneficial to increase of added value of tremella as a nutritional product and broaden of the existing consumer market, thereby further promoting industrial development of tremella efficacy products and having considerable market value.

Disclosure of Invention

The invention aims to provide moisturizing cream containing tremella spore extracellular polysaccharide. The extracellular polysaccharide with the moisturizing effect is separated and extracted from the tremella spore strain fermentation liquor, the purified extracellular polysaccharide has a good moisturizing effect and a good antioxidation effect, the extracellular polysaccharide can be used as a moisturizing active ingredient and an antioxidation active ingredient to be applied to preparing moisturizing cream, the product has a good moisturizing effect and an antioxidation effect and can repair cell damage caused by UVB radiation, and the application value, the approach and the market of the tremella spore extracellular polysaccharide are expanded.

The above object of the present invention is achieved by the following scheme:

a moisturizing cream containing tremella spore exopolysaccharide, comprising tremella spore exopolysaccharide prepared by the following method: taking the supernatant of the tremella spore fermentation liquid, adding 3 times of absolute ethyl alcohol for precipitation; and then adding water to dissolve the precipitate, taking the supernatant, removing protein by a Sevage method, centrifuging to obtain the supernatant, adding 3 times of ethanol for precipitation, and freeze-drying the precipitate to obtain the tremella spore extracellular polysaccharide.

The inventor separates and extracts the extracellular polysaccharide with the moisturizing effect from the tremella spore strain fermentation liquor, and the purified extracellular polysaccharide has good moisturizing effect, even the moisturizing effect is superior to that of glycerol; meanwhile, the exopolysaccharide has good antioxidation effect, and can be used as a moisturizing active ingredient and an antioxidant active ingredient to be applied to preparing skin care products.

Preferably, the mass ratio of the tremella spore extracellular polysaccharide in the moisturizing cream is 0.5-2%.

Preferably, the proportion of the tremella spore extracellular polysaccharide in the moisturizing cream is 1% by mass.

Preferably, the Tremella fuciformis is Tremella fuciformis Tyc63 and/or Tr 01; more preferably, the Tremella fuciformis spore is Tremella fuciformis Tyc 63.

Preferably, the moisturizing cream contains the following components in percentage by mass: 35-45% of an oil phase, 45-55% of water, 8-15% of glycerol, 0.5-2% of tremella spore exopolysaccharide and 0.5-1.5% of jemmbp.

Preferably, the moisturizing cream contains the following components in percentage by mass: 37% of oil phase, 51% of water, 10% of glycerol, 1% of tremella spore exopolysaccharide and 1% of jemmbp.

Preferably, the oil phase consists of olive emulsifying wax, sweet almond oil, wheat germ oil and oil-soluble vitamin E according to the mass ratio of 20:7:7: 3.

Preferably, the Tremella spore fermentation liquid is fermentation liquid obtained by performing shaking culture on Tremella fuciformis Tyc63 or Tr01 in a PDA culture medium at 25 ℃ and 150r/min for 6 days. Under the condition of the fermentation, the content of extracellular polysaccharide is highest by 2 Tremella fuciformis Tyc63 or Tr01 strains, the content of extracellular polysaccharide in the fermentation liquor is continuously increased along with the time extension in the first 6 days of the fermentation, the content of extracellular fructose in the fermentation liquor is highest on the 6 th day of the fermentation, and the content of extracellular polysaccharide in the fermentation liquor is reduced on the contrary when the fermentation is continued.

Preferably, the specific process for removing the protein by the Sevage method is as follows:

s1, weighing the crude polysaccharide precipitated by ethanol, adding water to fully dissolve, and centrifuging to collect supernatant;

s2, adding a Sevage reagent with the volume of 1/3 into the supernatant, intensively mixing and oscillating on an oscillator for 15min, then putting into a shaking table, adjusting the rotating speed to 250r/min, oscillating for 15min, and then centrifuging for 15min at 4000r/min to obtain a water layer and remove the denatured protein at the junction;

s3, repeating the step S2 for three times until no white precipitate exists at the interface of the reagent layer after centrifugation.

Preferably, in step S1, the crude polysaccharide can be sufficiently dissolved by heating at 60 ℃; the rotating speed of the centrifugation is 8000r/min, and the centrifugation time is 15 min; in the step S2, the Sevage reagent is composed of chloroform and n-butanol according to the volume ratio of 4: 1.

Preferably, the tremella spore extracellular polysaccharide contains polysaccharides TPF-1, TPF-2 and TPF-3, wherein the molecular weight of TPF-1 is 5189kDa, and the tremella spore extracellular polysaccharide consists of fucose, xylose, mannose and glucuronic acid in a molar ratio of 9.25:23.4:16.05: 37.1; the molecular weight of TPF-2 is 171.6kDa, and the TPF-2 consists of fucose, xylose, mannose, glucuronic acid and galactose in a molar ratio of 1.78:9.55:12.63:128.59: 13.91; TPF-3 has a molecular weight of 661kDa and consists of rhamnose, xylose, mannose, glucuronic acid and galactose in a molar ratio of 3.8:30.78:52.78:12.73: 14.6.

Through further separation and purification of the extracellular polysaccharide obtained by separation, 3 polysaccharides of TPF-1, TPF-2 and TPF-3 are mainly contained in the extracellular fructose, and the 3 polysaccharides have no special odor, are easy to absorb moisture and absorb dampness, are easy to dissolve in water and have good moisturizing effect.

Preferably, the content ratio of polysaccharides TPF-1, TPF-2 and TPF-3 in the tremella spore exopolysaccharide is 2.1-2.3: 0.7-0.9: 1.7-1.9.

More preferably, the content ratio of the polysaccharides TPF-1, TPF-2 and TPF-3 in the tremella spore exopolysaccharide is 2.2:0.8: 1.8.

Compared with the prior art, the invention has the following beneficial effects:

the Tremella fuciformis Tyc63 or Tr01 is used as a strain for fermentation, fermentation liquor is used as a raw material, extracellular polysaccharide with a moisturizing effect is separated and extracted from the fermentation liquor, and the purified extracellular polysaccharide has a good moisturizing effect, even the moisturizing effect is better than that of glycerol; meanwhile, the exopolysaccharide has good antioxidation effect, and can be used as a moisturizing active ingredient and an antioxidant active ingredient to be applied to preparing skin care products.

The cream prepared by taking the tremella spore exopolysaccharide as an active ingredient has a good moisturizing effect and also has a function of repairing cell damage caused by UVB radiation.

Furthermore, as the exopolysaccharide produced by the spore fermentation of the tremella fuciformis has the moisturizing and anti-oxidation effects, in order to separate the tremella fuciformis as much as possible to obtain the effective exopolysaccharide, the inventor researches the optimal fermentation conditions and the fermentation periods of two tremella fuciformis spore strains, finds the fermentation conditions and the fermentation periods with the highest content of the exopolysaccharide in the fermentation broth, and is beneficial to the industrial production of moisturizing skin care products prepared by utilizing the exopolysaccharide in the later period.

Drawings

FIG. 1 shows the result of amplification of rDNA ITS sequences of 6 spores of Tremella fuciformis in example 1.

FIG. 2 is the alignment result of the spores of 6 Tremella fuciformis strains in example 1.

FIG. 3 is a glucose standard curve of example 2.

FIG. 4 is the comparison result of the yields of exopolysaccharides of 4 Tremella fuciformis strains in example 2.

FIG. 5 shows the results of the exopolysaccharides and spore yields of 2 spore strains of Tremella fuciformis in example 2 as a function of days.

FIG. 6 is a standard curve for ferrous sulfate in example 3.

FIG. 7 is the analysis of the antioxidant results of the crude polysaccharide in example 3.

FIG. 8 is an analysis of the results of moisture absorption and retention of the crude polysaccharide of example 4.

Fig. 9 is the appearance of the unpackaged 3 moisturizing skin care products of example 5.

Fig. 10 is the appearance of the 3 moisturizing skin care products packaged in example 5.

FIG. 11 shows HSF cells grown in the normal state in example 6.

FIG. 12 is a graph showing the toxic effect of 3 moisturizing skin care products of example 6 on HSF

FIG. 13 is the model construction of UVB induced HSF aging in example 6.

Fig. 14 is a graph showing the protective effect of the 3 moisturizing skin care products of example 6 on HSF.

FIG. 15 is DEAE-Sepharose Fast Flow ion exchange chromatography of Tremella fuciformis Tyc63 polysaccharide of example 7.

FIG. 16 is a chromatogram of Tremella fuciformis Tyc63 polysaccharide further subjected to Sephadex G-100 gel filtration in example 7.

FIG. 17 shows the appearance of TPF-1, TPF-2 and TPF-3.

FIG. 18 is a UV scan of TPF-1, TPF-2 and TPF-3.

FIG. 19 is a Sephadex G-100 purity identification map of TPF-1, TPF-2 and TPF-3.

FIG. 20 is a GC-MS chromatogram of mixed derivative monosaccharide A.

FIG. 21 is a GC-MS chromatogram of TPF-1, TPF-2, and TPF-3.

FIG. 22 is a GPC-RI-MALS spectrum of TPF-1.

FIG. 23 is a GPC-RI-MALS map of TPF-2.

FIG. 24 is a GPC-RI-MALS map of TPF-3.

FIG. 25 is a molecular configuration map of TPF-1.

FIG. 26 is a molecular configuration map of TPF-2.

FIG. 27 is a molecular configuration map of TPF-3.

FIG. 28 is a scan of the infrared spectrum of TPF-1.

FIG. 29 is a scan of the infrared spectrum of TPF-2.

FIG. 30 is a scan of the infrared spectrum of TPF-3.

FIG. 31 shows Congo Red test results for TPF-1, TPF-2, and TPF-3.

Detailed Description

The present invention is further described in detail below with reference to specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 screening of spore species of Tremella fuciformis

The best strains are selected from six tremella spores Tyc63, Y2, Y11, Tr01, Tr21 and Tr 9901.

Rejuvenation and culture of tremella spores

(1) Respectively inoculating the strains stored in a refrigerator at minus 80 ℃ on a PDA solid culture medium in a flat-plate scribing or coating mode for activation, and then culturing in an incubator at 25 ℃ for 2-3d at constant temperature;

(2) and selecting single colonies with good forms on the culture medium, dipping a loop in a PDB culture medium in an ultraclean workbench, and carrying out shake flask culture at the temperature of 25 ℃ for 3d production to logarithmic growth phase at the speed of 150 r/min. Then taking out and placing in a refrigerator at 4 ℃ for standby.

Molecular identification of tremella spores

1. Preparation of PCR identification template DNA

(1) Taking out the tremella spore liquid strain growing to logarithmic phase from the shaking table, centrifuging at 8000r/min for 15min at normal temperature, discarding supernatant, and collecting thallus in a liquid shaking bottle;

(2) collecting mycelium (100mg-200mg) in 2mL liquid nitrogen precooling centrifuge tube, adding 500 μ LBuffer CPL and 10 μ L2-mercaptoethanol;

(3) the tube was heated in a metal bath at 65 ℃ for 15 min. (two aliquots were mixed during this period, 5. mu.L of RNase was added);

(4) add 500. mu.L of PCI and shake well. Centrifuging at 12000r/min for 5 min;

(5) carefully pipette 300. mu.L of the supernatant into a new 1.5mL centrifuge tube;

(6) adding 150 μ L Buffer CXD containing 300 μ L absolute ethanol to obtain a uniform mixture;

(7) transferring all samples to an adsorption column containing a collecting pipe, centrifuging for 1min at 10000r/min, and discarding a collecting liquid and the collecting pipe;

(8) transferring the adsorption column into a new collection tube, adding 650 μ L of SPW wash Buffer containing absolute ethanol, centrifuging at 10000r/min for 1min, discarding the collection liquid, and returning the adsorption column into the collection tube;

(9) repeating operation 7;

(10) discarding the collected liquid, and centrifuging for 2min at 12000 r/min;

(11) blowing the residual alcohol by an air duct, and adding 50 mu L of deionized water preheated at 65 ℃. Standing at room temperature for 2min, and centrifuging at 12000r/min for 2 min;

(12) the operation 10 is repeated to obtain genomic DNA.

2. PCR primer sequences

PCR amplification was performed using ITS universal primers ITS1 and ITS4, with the amplification primer sequences:

ITS1:TCCGTAGGTGAACCTGCGG

ITS4:TCCTCCGCTTATTGATATGC

synthesized by Guangzhou branch of Shanghai Czeri, and the length of the amplified fragment is 500 bp.

3. PCR identification reaction system and reaction program

(1) PCR reaction System (100. mu.L)

TABLE 1 ITS sequence amplification PCR System

Reagent	Volume (μ L)
		ddH2O	71.5
10xEx-Taq buffer	10
		dNTP	8
Upstream primer	2
		Downstream primer	2
Template DNA	6
		Ex-Taq enzyme	0.5

(2) PCR reaction procedure

Pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30sec, annealing at 52 ℃ for 30sec, extension at 72 ℃ for 1min, 30 cycles, and extension at 72 ℃ for 5 min;

(3) gel electrophoresis detection of PCR products

Electrophoresis in 1% agarose, 150V, 100mA, 20min electrophoresis observation;

(4) observing the electrophoresis result by a gel imaging system;

(5) sequencing and sequence alignment: the target gene was submitted to the Cantonese Mergine for sequencing and the sequencing results were BLAST aligned at NCBI.

Third, the result of identification

1. The amplification results of spore rDNA ITS sequences of 6 strains of tremella are shown in FIG. 1. Wherein M: DNA marker 3; lane 1: tyc63 gene; lane 2: the Y2 gene; lane 3: the Y11 gene; lane 4: the Tr01 gene; lane 5: tr9901 gene; lane 6: tr21 gene.

As can be seen from FIG. 1, 6 strains of purified and rejuvenated tremella spore are subjected to DNA extraction by using a fungus genome extraction kit, ITS sequences are amplified by adopting ITS1 primers and ITS4 primers, and DNA fragments are single and are all about 500 bp.

2. The sequence alignment result of 6 tremella spores is shown in FIG. 2. Wherein A: y2; b: tyc63, respectively; c: y11; d: tr 01; e: tr 21; f: tr 9901.

According to BLAST comparison results, the similarity of Tyc63, Tr01, Tr21 and Tr9901 with Tremella fuciformis is the highest and reaches more than 99%, so that the four Tremella spore strains can be determined.

Example 2 screening of spore strain of Tremella fuciformis with high exopolysaccharide production and determination of fermentation period

Screening of tremella spore strain with high extracellular polysaccharide yield

1. Extraction and separation of tremella spore extracellular polysaccharide

In example 1, Tyc63, Tr01, Tr21 and Tr9901 are determined to be tremella spore strains, so that the four tremella spore strains are screened, and the specific experimental flow is as follows:

white fungus spore fermentation liquid → centrifugation → supernatant liquid concentration, adding 3V absolute ethyl alcohol to precipitate polysaccharide → precipitation → crude polysaccharide → distilled water heating and dissolving → centrifugation → supernatant liquid → Sevage method protein removal → centrifugation supernatant liquid → 3V ethanol precipitation polysaccharide → precipitation → freeze drying → refined polysaccharide

The method comprises the following operation steps:

(1) centrifuging fresh tremella spore fermentation liquid at 8000r/min at normal temperature for 20min, removing lower layer spore, and collecting supernatant;

(2) concentrating the supernatant to a small volume by using a rotary evaporator;

(3) adding 3V volume of absolute ethyl alcohol into the mixture, and precipitating the mixture overnight;

(4) centrifuging at 8000r/min at 4 deg.C for 10min, and collecting precipitate;

(5) washing the precipitate with anhydrous ethanol for 2-3 times, and drying in a freeze dryer for 36 hr to obtain crude polysaccharide;

(6) dissolving the crude polysaccharide in hot water bath at 60 deg.C, centrifuging at 8000r/min for 10min, collecting supernatant, redissolving the precipitate, centrifuging at 8000r/min for 10min, and repeating twice to obtain polysaccharide water solution;

(7) according to the polysaccharide water solution: mixing sevage reagent (chloroform: n-butyl alcohol is 4:1) at a ratio of 5:1, strongly shaking for 20min in a shaker to generate milky white precipitate, centrifuging at 4000r/min for 15min, collecting supernatant, and repeating the steps at least three times until no obvious protein layer appears;

(8) adding 3V anhydrous ethanol into the supernatant, precipitating overnight, centrifuging at 4 deg.C and 8000r/min for 10min, collecting precipitate, and vacuum freeze drying for 24 hr to obtain refined polysaccharide.

2. Content determination of tremella spore exopolysaccharide

Drawing of glucose standard curve

(1) Precisely measuring 1mL, 2mL, 4mL, 6mL and 10mL of standard glucose solution, respectively placing in a 50mL volumetric flask, adding water to a constant volume, and shaking up;

(2) precisely measuring 1mL of the solution in each volumetric flask into a clean 15mL centrifuge tube, respectively adding 1mL of 6% phenol solution and 5mL of 95% sulfuric acid solution, and uniformly mixing;

(3) water bath at 40 deg.C for 30min, taking out and cooling to room temperature;

(4) determination of light absorption value OD by spectrophotometer₄₉₀；

(5) Taking the glucose concentration as an abscissa and the absorbance as an ordinate, a linear regression equation is prepared, and the regression equation is obtained in the way that y is 6.2986x +0.0649 and r is²0.999 (zhangjie et al, 2012).

(6) Determination of sugar content in sample by phenol-sulfuric acid method

Respectively preparing exopolysaccharides of six tremella spores into polysaccharide solutions with proper concentrations, accurately sucking 1.0mL of the polysaccharide solutions, adding 1.0mL of 6% phenol solution, mixing, and fully mixing with 5.0mL of concentrated sulfuric acid, developing, and performing OD₄₉₀And measuring the absorbance value at the wavelength, and calculating the yield of the extracellular polysaccharide according to the glucose standard curve and the absorbance value of the polysaccharide.

(7) Formula for calculating polysaccharide yield

Polysaccharide yield (%). polysaccharide content × dilution factor/sample dry weight × 100%

Secondly, determination of fermentation period

The fermentation period has great influence on the yield of spores and exopolysaccharides during the spore liquid fermentation of tremella fuciformis, so that an optimal fermentation period needs to be found to obtain the highest yield of polysaccharides, and the specific operation is as follows:

inoculating 1mL of seed solution into 100mL of PDA culture medium in a clean bench, carrying out shaking culture at 25 ℃ at 150r/min, continuously sampling for 10 days to determine the residual sugar content, spore dry weight and extracellular polysaccharide content change in tremella spore fermentation liquid, setting three groups in parallel, and finding out the optimal fermentation period.

Three, result in

1. The results of comparison of the yields of exopolysaccharides of four tremella spore strains are shown in FIG. 4. As can be seen from the figure, the polysaccharide yield of the spore of tremella fuciformis is obviously higher than that of Tr21 and Tr9901 in Tr01 and Tyc63, so that the subsequent fermentation period is determined by researching two strains Tr01 and Tr Tyc 63.

2. Determination of fermentation period: the results of the change of exopolysaccharides and spore yields of two strains of tremella fuciformis spores with the change of fermentation days are shown in FIG. 4. As can be seen from FIG. 4, the polysaccharide production gradually increased from the first day of culture until the production reached the maximum on the sixth day, followed by a tendency toward gradual decrease. While spore production rose sharply at days 0-4, reached a maximum at day four, and then tended to decline overall and eventually stabilized. Because the main research object of our experiment is extracellular polysaccharide, the optimal fermentation period of tremella spores is determined to be 6 days, and the obtained polysaccharide yield is highest.

Wherein the Tremella fuciformis spores Tyc63(Tremella fuciformis Tyc63) is classified as Tremella fuciformis and is preserved in Guangdong province collection center of microorganism strains in 2018, 6 and 15 days, and the preservation number is GDMCC NO. 60388.

The Tremella fuciformis Tyc63 strain was abbreviated in the examples hereinafter as Tyc 63.

The 5.8S rRNA sequence of the Tremella fuciformis Tyc63 is shown as SEQ ID NO. 1.

Example 3 analysis of the antioxidant Activity of Tremella fuciformis spore exopolysaccharides

1. Hydroxyl radical scavenging effect of tremella spore exopolysaccharide

The reaction system contained 8.8mmol/L H as determined by reference to the experiment of Yanjun et al (Yanjun et al, 2005)₂O₂ 1mL，9mmol/L FeSO₄1mL, 9mmol/L salicylic acid-ethanol 1mL, different concentrations of poly1mL sugar solution and H₂O₂The reaction was started, and the reaction was carried out at 37 ℃ for 0.5 hour, and the absorbance at each concentration was measured at 510nm with distilled water as a reference. Considering the absorbance of polysaccharide per se, 9mmol/L FeSO₄1mL, 9mmol/L salicylic acid-ethanol 1mL, polysaccharide solutions of different concentrations 1mL and 1mL distilled water as background absorption values of the polysaccharide.

The clearance calculation formula is:

in the formula A₀The absorbance of the blank control solution; a. the_XIs the absorbance after adding the polysaccharide solution; a. the_XOWithout adding a color-developing agent H₂O₂Absorbance of polysaccharide solution background.

The result is shown in A picture in figure 7, the scavenging effect of the tremella spore crude polysaccharide on hydroxyl free radicals reaches the maximum when the concentration is 5mg/mL, and the scavenging rate is as high as 97%, wherein the IC50 values of Tyc63 and Tr01 of tremella spores are respectively 1.2mg/mL and 1.09 mg/mL.

2. Eliminating effect of tremella spore extracellular polysaccharide on ABTs free radicals

Slightly adjusting according to the experiment of Wuzhen et al (Wuzhen, 2015), accurately preparing 7.0mmol/L ABTs solution and 2.45mmol/L potassium persulfate aqueous solution, mixing the two solutions, standing at room temperature in dark for 12-16h to obtain ABTs⁺And (4) mother liquor. ABTs to be obtained⁺Diluting the mother liquor with primary water to make its absorbance at 734nm be 0.7 + -0.023, and balancing at 30 deg.C for 30min to obtain ABTs⁺And (4) working fluid. Respectively taking 2.0mL of sample to be detected and 2.0mLABTs⁺Adding the working solution into a test tube, mixing uniformly, standing at room temperature in the dark for 20min, and measuring the light absorption value at 734 nm. Replacing the sample to be tested and ABTs with deionized water⁺Working solutions were mixed and used as controls. Three replicates were set and averaged.

The elimination effect of the sample to be tested on ABTs free radicals is calculated according to the following formula:

in the formula: a. the_{Sample (I)}The light absorption value is obtained after the polysaccharide solution and the working solution are mixed and reacted; a. the_{Blank space}The absorbance of the solution without the addition of polysaccharide.

The results are shown in graph B of FIG. 7, where the scavenging capacity of the extracellular polysaccharide for ABTs free radicals is directly correlated with the concentration within the range determined. Tyc63 and Tr01 crude polysaccharide at high concentration of 5mg/mL, the clearance reached 90%, calculated to obtain Tyc63 IC50 value 2.13mg/mL, Tr01 IC50 value 1.12 mg/mL. The result shows that the tremella spore extracellular crude polysaccharide has remarkable capability of eliminating ABTs free radicals, and particularly shows more remarkable performance under the condition of high concentration.

3. Determination of reduction capability of tremella spore extracellular polysaccharide to iron ions

With reference to the experiments of zheng fei et al (zheng fei et al, 2017) with minor modifications:

(1) making a standard curve: 0.5mL of FeSO with concentration of 0.025, 0.1, 0.15, 0.2, 0.4, 0.5, 0.8, 1.0 and 1.5mmol/L is respectively sucked₄The solution was mixed with 0.5mL of 0.01mol/L TPTZ solution and 5.0mL of 0.3mol/L acetic acid-sodium acetate buffer (pH 3.6), and the absorbance was measured at 593nm, and the average value was determined in 3 replicates.

With FeSO in the reaction system₄The concentration of the solution is plotted as ordinate and the light absorption value is plotted as abscissa, and the regression equation is calculated as y being 0.5492x-0.003, r²The standard curve is shown in fig. 6 at 0.9999.

(2) Sample FRAP determination: measuring the light absorption value A of the FRAP working solution at 593nm_{Before reaction}(ii) a Adding 0.6mL of supernatant into 4.5mL of FRAP working solution, reacting for 8min, and measuring light absorption A at 593nm_{After the reaction}(ii) a From A_{After the reaction}-A_{Before reaction}The corresponding FeSO of the sample is obtained on the standard curve₄Concentration, defined as FRAP value. Deionized water was used as a control in place of the same volume of the supernatant, and 3 replicates were used for averaging.

In the acidic solution, the acid solution is added,Fe³⁺-TPTZ(Fe³⁺pyridine triazazine) can be reduced by an antioxidant substance in the sample, at OD₅₉₃There is maximum light absorption, and the absorbance is proportional to the strength of the antioxidant activity of the sample. The results of evaluating total antioxidant activity of tremella spore polysaccharides using iron reduction/antioxidant capacity (FRAP) analysis are shown in fig. 7, panel C.

As can be seen from the C diagram, the Tyc63 and Tr01 crude polysaccharides have certain iron ion reducing capability with reference to VC, but are much lower than the VC in the reference group.

4. Scavenging effect of tremella spore exopolysaccharide on DPPH free radical

Slightly modifying the experiment of Meng san Lei et al (Meng san Lei et al, 2010), mixing polysaccharide sample solutions with different concentrations with DPPH-ethanol solution, standing for 30min, and adding the mixture to OD₅₁₇The absorbance Ai is measured. The DPPH radical clearance by polysaccharides can be expressed as:

in the formula: a. the_iThe absorbance of the reaction solution is DPPH and polysaccharide solutions with different concentrations; a. the_jAbsorbance of blank (sample 0.5mL +2.5mL 95% ethanol); ac is the absorbance of a DPPH solution (2.5mL DPPH +0.5mL absolute ethanol); three sets of replicates were set and their average was taken.

The DPPH free radical scavenging ability of each sample is that the experimental concentration of the sample is used as the abscissa, the corresponding hydroxyl free radical scavenging rate is used as the ordinate, a linear regression equation is solved, and the concentration when the hydroxyl free radical scavenging rate is 50 percent, namely the half-scavenging concentration IC is solved according to the regression equation₅₀. And half clearance concentration IC₅₀Smaller indicates greater scavenging capacity, i.e., IC₅₀The magnitude is inversely related to the magnitude of the scavenging capacity.

The result is shown in graph D in FIG. 7, wherein the scavenging effect of Tyc63 and Tr01 crude polysaccharides on DPPH free radicals is much lower than that of the control VC, wherein Tr01 crude polysaccharide has almost no scavenging effect on DPPH free radicals, while Tyc63 crude polysaccharide has the strongest scavenging effect reaching 48% when the concentration reaches 1mg/mL, and then the scavenging rate is reduced along with the increase of the concentration.

Example 4 moisture absorption and Retention of exopolysaccharides

1. Moisture absorption experiment of extracellular polysaccharide

Will be saturated with (NH)₄)₂SO₄Aqueous solution as a drier with a relative humidity of 81% and saturated K₂SO₃The aqueous solution is taken as a dryer with the relative humidity of 43 percent and is placed in a constant temperature environment of 20 ℃, 2 parts of dried samples to be tested, 1.0g of the dried samples to be tested, are accurately weighed and are respectively placed in crystallizing dishes with the diameter of 3cm and are placed in two dryers, the mass of each sample is measured every 12 hours until the test lasts for 48 hours. The control group was glycerol, and the moisture absorption rate was determined from the difference in mass between the samples before and after standing by the following formula:

moisture absorption rate (%) < 100 (m)_n-m₀)/m₀

Wherein m is₀Mass m before sample placement_nThe mass of the sample after placement.

2. Moisture retention test of extracellular polysaccharide

Preparing 5% solutions of polysaccharide samples and reference substances, respectively placing the solutions into the two driers, weighing the mass of each sample every 12h, and calculating the moisture retention rate according to the mass difference of the samples before and after continuous placement by the following formula:

moisture retention rate (%) of 100m_a/m_b

Wherein m is_bM is the water mass of the sample_aThe water content of the sample after placement.

The test results are shown in fig. 8, where a: the moisture absorption rate of the sample in an environment of 83 percent; b: the moisture absorption rate of the sample under 44% environment; c: moisture retention rate D of the sample under 83% environment: the sample had a moisture retention of 44% ambient. As can be seen from the figure, the moisture retention rates of the polysaccharide sample and the glycerin are gradually reduced within 48h of the test under the environment with the relative humidity of 83% and 44%, and although the moisture retention rate of the polysaccharide sample is reduced relatively to the glycerin, the moisture retention rates of the polysaccharide sample and the glycerin are still 10% and 42% at 48 h.

Example 5 development of exopolysaccharide moisturizing skin care products

The exopolysaccharide prepared by the preparation method of example 2 was used as a moisturizing active ingredient to prepare a moisturizing skin care product. The prepared products are 3 kinds, namely moisturizing toner, moisturizing cream and moisturizing face cream.

1. The formulas of the moisturizing toner, the moisturizing lotion and the moisturizing cream are shown in tables 2 to 4, respectively.

TABLE 2 formula of extracellular polysaccharide toner

Composition (I)	Mass percent/%)
		Glycerol	3.0
Extracellular polysaccharide extract	50.0
		Jacob bp	0.5
Distilled water	Make up to 100%

TABLE 3 extracellular polysaccharide skin lotion formulation

TABLE 4 extracellular polysaccharide moisturizing cream formula

Wherein, the moisturizing toner is prepared according to the formula in the table 2, and the materials in the formula are dissolved uniformly by fully stirring in the operation, and the extracellular polysaccharide toner is obtained by subpackaging.

The moisturizing lotion was formulated according to the formula in table 3:

(1) firstly, heating the oil phase in water bath to 80 ℃, and stirring to completely melt the materials for later use;

(2) similarly, heating the water phase to 80 ℃ for standby, pouring the oil phase into the water phase while the water phase is hot, and continuously stirring until the temperature is reduced to 40 ℃ to generate emulsion;

(3) adding the added components into the stirred and emulsified sample for multiple times, and stirring uniformly and fully emulsifying each time until the added components are completely added; cooling to room temperature, standing, and bottling.

The moisturizing cream is prepared according to the formula shown in Table 4, the specific operation steps are the same as those of the moisturizing lotion, and the moisturizing cream is obtained by standing and bottling after the temperature is reduced to the room temperature.

The appearances of the moisturizing toner, the moisturizing cream and the moisturizing cream prepared according to the above methods are shown in fig. 9. Wherein, A is moisturizing; b is moisturizing toner; c is moisturizing cream. From fig. 9, it can be seen that the moisturizing toner is yellowish in appearance, clear and transparent, and slightly sticky; the moisturizing lotion is milky white, fine in texture and flowable; the moisturizing cream is milky white, slightly thick, fine and smooth in texture.

The appearance of the finished product was as shown in fig. 10.

2. Detection of physicochemical Properties of moisturizing toner, moisturizing emulsion, and moisturizing cream

Samples were tested for heat, cold, and centrifugal stability according to QB/T2286-1997 and QB/T2660-2004 standards.

(1) Heat resistance test: placing the sample in a constant temperature box of (40 +/-1) DEG C for 24h, and observing whether the skin moisturizing lotion sample has obvious character difference and oil-water separation phenomenon compared with the skin moisturizing lotion before the test after the sample is restored to the room temperature.

(2) Cold resistance test: placing the essence and skin moistening water samples in a refrigerator at (5 +/-1) DEG C for 24h, and observing whether obvious property difference exists or not compared with the samples before the test after the samples are returned to the room temperature; and (3) placing the skin lotion sample in a refrigerator at the temperature of 20 ℃ below zero for 24 hours, and observing whether oil-water separation occurs or not after the temperature is restored to the room temperature.

(3) And (3) centrifugal stability test: putting the skin lotion sample into a centrifugal test tube, putting into an electric heating constant temperature incubator at 40 ℃, keeping for 1h, moving into a centrifugal machine, adjusting the rotating speed to 2000r/min, carrying out centrifugal separation for 30min, taking out, and observing whether the layering phenomenon exists.

After testing and observation, the oil-water separation phenomenon does not occur in the three skin care products after the treatment, so that the three skin care product samples have good heat resistance and cold resistance, and the skin lotion and the moisturizing cream are not layered in a centrifugal test.

Example 6 Effect of moisturizing toner, moisturizing cream and moisturizing cream on human skin fibroblast proliferation

1. MTT method for measuring cytotoxicity of moisturizing toner, moisturizing cream and moisturizing cream

Test cells: HSF cells (human skin fibroblasts)

Cell culture: the experimental cells were 3-8 passages in logarithmic growth phase. The culture medium was DMEM (containing 10% fetal bovine serum, 100U/mL penicillin sodium, 100mg/mL streptomycin sulfate) and was cultured in a 5% CO2 incubator at 37 ℃. The specific experimental procedures are as follows:

(1) cell recovery: the cells were suspended in 4mL of complete medium and cultured in a petri dish at 37 ℃ in 5% CO2 in 95% air to ensure sufficient humidity.

(2) Replacing the cell culture solution: the next day after cell passage, the cell culture medium must be changed, followed by changing every 1-2 days.

(3) Cell passage: HSF cells were digested by adding 2mL of pancreatin containing 0.25% EDTA for 1-2 min. When the cell is completely rounded but not completely separated from the wall, a complete culture medium is quickly added to neutralize the pancreatin, the cell is blown by a suction head, the cell suspension is sucked into a 10mL centrifuge tube, the cell suspension is centrifuged at 1000r/min for 5min, and the cell is collected. 4mL of complete medium was added continuously to blow out the residual cells, and the cells were pipetted into a new dish for further culture.

(4) Plate paving: taking fibroblasts in the passage exponential growth phase, counting by using a cell counter, adjusting the cell density to 50000/mL by using a complete culture medium, inoculating the fibroblasts on a 96-well plate, wherein each well is 100 mu L, a peripheral well is sealed by adding PBS buffer solution, and each well is 100 mu L.

(5) Sample adding: after 24h of culture, the old culture solution is sucked up, the culture solution which is prepared by using the complete culture medium and contains the polysaccharide and the skin care product with various concentrations is added, each well is 100 mu L, 6 groups are parallel, and the culture is carried out for 24 h.

(6) MTT assay testing HSF cell viability: after the sample is added for 24 hours, the culture solution is discarded, 90 mu L of complete culture medium and 10 mu L of 5mg/mL MTT solution are added, and the mixture is placed in a CO2 incubator for culture for 4 hours; then, the culture medium was discarded, 100. mu.L of DMSO was added, shaking was carried out for 10min, and the absorbance at OD570 was measured.

The cells used in the experiment were HSF (human skin fibroblasts) at 37 ℃ with 5% CO₂The growth state under normal conditions of (2) is shown in fig. 11. HSF cells are bulky, poorly defined, and exhibit elongated, fibrous structures.

The MTT (tetramethylazozolium) method is a sensitive, rapid and convenient biological viable cell counting method, and has the principle that the amount of MTT reduced to formazan (blue-violet) by mitochondrial dehydrogenase in viable cells is in direct proportion to the number of viable cells. Thus, by measuring OD₅₇₀The absorbance of the sample can indirectly reflect the number of living cells.

After different concentrations of moisturizing toner, moisturizing lotion and moisturizing cream act on HSF cells for 24 hours, the OD is determined by MTT method₅₇₀Calculating the survival rate of the cells, and the result is shown in figure 12, wherein, A is the toxic effect of the crude polysaccharide on HSF; b is the toxic effect of the moisturizing toner on HSF; graph C shows toxicity effects of moisturizing cream on HSF and graph D shows toxicity effects of moisturizing cream on HSF (indicating significant P < 0.05;. indicating very significant P < 0.01) compared to the control group.

(1) Toxic effects of extracellular crude polysaccharide on HSF cells

The experimental result shows that the toxicity of the extracellular crude polysaccharide to HSF cells is extremely low in the tested concentration range (0.01mg/mL-0.5mg/mL) (graph A), and the proliferation capacities of the HSF cells are higher than those of a control group to different degrees under the low concentration condition (0.01-0.02mg/mL), which shows that the extracellular crude polysaccharide has a promotion effect on the growth of the HSF cells. The relative survival rate of HSF cells decreased slightly with increasing crude polysaccharide concentration, but did not differ significantly (P > 0.05) compared to the control group, thus demonstrating that the toxicity of extracellular crude polysaccharide to HSF cells was extremely low.

(2) Toxic effect of moisturizing toner, moisturizing lotion and moisturizing cream on HSF cells

Experimental results show that the proliferation capacity of HSF cells cultured by adding the moisturizing toner with low, medium and high quality concentrations is not obviously changed compared with a control group (P is more than 0.05).

When HSF cells are cultured by using the moisturizing lotion with low, medium and high quality concentrations, the moisturizing lotion has a remarkable promoting effect (P is less than 0.05) on the proliferation of the HSF cells at low (0.01-0.05mg/mL) and medium (0.1-0.5mg/mL) dosages, and has a remarkable effect (P is less than 0.01) at the concentrations of 0.01, 0.02, 0.1, 0.2 and 0.3 mg/mL. Under high dose (1-2mg/mL), the effect on HSF cells is not obvious (P is more than 0.05), and the promoting and inhibiting effects are not obvious.

When HSF cells are cultured by using moisturizing creams with low, medium and high quality concentrations, the HSF cells are remarkably promoted (P is less than 0.05) when the concentration is 0.1mg/mL or 0.2mg/mL, and the HSF cells are remarkably promoted (P is less than 0.01) when the concentration is 0.05 mg/mL. At high dose, the inhibition effect on HSF cells is not significantly different from that of the control group.

IC according to the criteria for determining toxicity of cosmetic products in the European Union laboratory₅₀Not less than 1.5mg/mL, indicates little or no cosmetic toxicity, IC₅₀Less than 1.5mg/mL is more than or equal to 0.5mg/mL, indicating moderate toxicity of the cosmetic and IC₅₀When the concentration is less than 0.5mg/mL, the toxicity of the cosmetic is strong. In the experiment, the relative survival rates of HSF cells are all higher than 80% under the condition of adding high-dose (1-2mg/mL) of moisturizing toner, moisturizing cream and moisturizing cream, so that the three skin care products can be proved to have no cytotoxicity or very low toxicity.

2. Protective effect of moisturizing toner, moisturizing lotion and moisturizing cream on UVB-induced HSF (human immunodeficiency Virus) cells

(1) Construction of UVB-induced HSF cell senescence model

Recovering, passaging and plating HSF cells in the same way as the steps (1), (2), (3) and (4);

UVB-induced cell aging: culturing for 24h, discarding the original culture solution, adding 100 μ L PBS into each well, wrapping the blank group with tinfoil paper, irradiating model group with UVB, measuring the distance between UVB irradiation light source and cell to 5cm, measuring the intensity with ultraviolet radiometer to be 330 μ W/cm2, and selecting irradiation time to be 1min, 2min, 3min and 4 min;

and thirdly, after the irradiation is finished, the PBS solution is removed, a complete culture medium is added, the incubation is continued for 2 hours, 10 mu L of MTT is added into each hole of each group, after 4 hours, 100 mu L of DMSO is added, the mixture is shaken on a shaking table at 37 ℃ for 10 minutes to dissolve crystals, and finally, the activity of the cells is checked at OD570 by using an enzyme-labeling instrument.

Induction of HSF cells with UVB, the results are shown in fig. 13: compared with a blank control group, the HSF cell has very obvious inhibition effect (P is less than 0.05) on HSF cells after irradiation for 1min, 2min, 3min and 4min, and the cell survival rates are as follows in sequence: 78%, 76.8%, 76.1%, 75.9%. The stronger the inhibitory effect of UVB on cells with the increase of irradiation time, thus indicating that the UVB causes HSF (human skin fibroblast) damage model to be successfully constructed.

(2) Test of the protective Effect of 3 skin Care products on UVB-induced HSF cells

The experimental group is treated in the same way as above, except that in the second step, after 24h of culture, before UVB irradiation, certain concentrations of moisturizing toner, moisturizing cream or moisturizing cream are respectively added, after 24h of addition, the culture medium is sucked and removed, washed for 2 times by PBS liquid, and a thin layer of PBS liquid is paved, then UVB irradiation is carried out in the second step, 2 parallel UVB lamp tubes are used as UVB light sources and are 5cm away from cells, and the intensity measured by an ultraviolet radiometer is 330 muW/cm²The irradiation time is 120s, and the UVB irradiation dose is 40mJ/cm². After the irradiation is finished, newly adding the original sucked culture medium into each hole, and continuing the culture; the activity of the cells was then examined as described above.

The details of each treatment group are shown in table 5, and the skin care product in table 5 is one of moisturizing toner, moisturizing cream or moisturizing cream.

Table 5 grouping of the effects of 3 skin care products on UVB-induced HSF cells

Group of	Number of samples
		Control group
	6
		UVB model group	6
UVB sample blank group	6
		UVB +0.01mg/mL (skin care sample)	6
UVB +0.02mg/mL (skin care sample)	6
		UVB +0.05mg/mL (skin care sample)	6
UVB +0.1mg/mL (skin care sample)	6
		UVB +0.2mg/mL (skin care sample)	6
UVB +0.3mg/mL (skin care sample)	6

The experimental results are shown in fig. 14: compared with a blank control group (without light and added with a skin care product), the relative survival rate of the UVB model group is remarkably reduced (P is less than 0.01), and the model is successful.

Compared with the UVB model group, when the dosage of each experimental group added with the crude extracellular polysaccharide is 0.01mg/mL and 0.02mg/mL, the relative survival rate of each experimental group added with the crude extracellular polysaccharide is obviously different from that of the UVB control group (P is less than 0.05), which shows that the crude extracellular polysaccharide has a certain protection effect on HSF cells under low dosage.

Compared with the UVB model group, the relative survival rate of each experimental group added with the extracellular polysaccharide toner is obviously higher than that of the UVB model group when the dosage is 0.1, 0.2 and 0.3 mg/mL. The dosage of each experimental group added with the exopolysaccharide skin lotion is obviously higher than that of the UVB model group at 0.05mg/mL, and then the relative survival rate is slightly reduced with the increase of the concentration, but still higher than that of the UVB model group. The relative survival rate of each experimental group added with the extracellular polysaccharide moisturizing cream is higher than that of the UVB model group, and in the dosage range, the relative survival rate shows a rising trend along with the increase of the concentration, wherein the relative survival rate of the 0.5mg/mL group is obviously higher than that of the UVB model group (P < 0.05).

The relative survival rates of the sample control group (to which three skin care products without polysaccharide were added) were significantly different from those of the blank control group and from those of the UVB model group, and the results indicate that the substance for protecting HSF cells from UVB damage originated from exopolysaccharide, not from other components in the skin care products.

Example 7 analysis of physicochemical Properties and Structure of Tremella spore exopolysaccharides

Tyc63 extracellular polysaccharide separated after fermentation is used as a research object, and the pear flower property and structure analysis is tested.

Research on separation and purification of tremella spore exopolysaccharide

The process for separating and purifying the tremella spore extracellular polysaccharide comprises the following steps: exopolysaccharide prepared according to the procedure in example 2 → agarose gel chromatography → eluent → dialysis → concentration under reduced pressure → 3V ethanol precipitated polysaccharide → precipitation → purification by gel chromatography → eluent → concentration under reduced pressure → 3V ethanol precipitated polysaccharide → vacuum freeze-drying → homogeneous tremella spore exopolysaccharide.

1. The specific steps of removing protein by the Sevage method are as follows:

(1) weighing a certain mass of crude polysaccharide, dissolving with deionized water, stirring uniformly, placing in a 60 ℃ water bath kettle for full dissolution, then centrifuging at 8000r/min at normal temperature for 15min, and collecting supernatant;

(2) adding a Sevage reagent (chloroform: n-butyl alcohol is 4:1) with the volume of 1/3 into the crude polysaccharide solution, intensively mixing and shaking on a shaker for 15min, then placing into a shaking table, adjusting the rotating speed to 250r/min, shaking for 15min, and then centrifuging at 4000r/min for 15min to obtain a water layer and remove the denatured protein at the junction. This was repeated several times (at least three times) until no white precipitate appeared at the interface of the reagent layers after centrifugation indicating that the protein was substantially removed.

2. DEAE-Sepharose Fast Flow exchange column chromatography

Packing of gel chromatographic column:

(1) selection and treatment of the gel: washing ethanol protective solution in gel DEAE-Sepharose Fast Flow with deionized water by suction filtration device, adding small amount of deionized water, and ultrasonic degassing for 30 min;

(2) filling a chromatographic column: selecting (2.5 × 30cm) glass chromatographic column, adding the swollen DEAE-Sepharose Fast Flow gel into the chromatographic column, allowing the gel to settle naturally for 12h, and adding primary water to perform balanced elution for 24h after the gel is completely settled.

Separation and purification of a sample:

(1) preparing exopolysaccharide into a solution of 10mg/mL, filtering with a microporous membrane of 0.45 mu L, slowly adding the exopolysaccharide from the top of a chromatographic column adherent to the wall, wherein the sample adding amount is 5mL at one time without damaging a filler interface;

(2) after sample adding, eluting with deionized water, collecting one tube every ten minutes, collecting 10mL of sample in each tube at a flow rate of 1 mL/min;

(3) measuring the content of polysaccharide in each tube by a phenol-sulfuric acid method, detecting the absorbance at OD490 by using an enzyme-labeling instrument, and eluting until no color reaction appears; then gradient elution is carried out by using NaCl of 0.1, 0.3 and 0.5mol/L, fractional collection is continued, the content of polysaccharide is identified by the same method, the same components are combined, and concentration is carried out. And drawing an elution curve of the DEAE-Sepharose Fast Flow gel exchange column by taking the number of the collection tubes as an abscissa and the light absorption value A as an ordinate.

(4) Running water dialysis

Pretreatment of a dialysis bag: cutting the dialysis bag into small sections of about 20cm, adding first-class water, boiling with strong fire for 30min, and cleaning with first-class water.

The deionized water is replaced once every 1h in the early stage of dialysis and once every 6h in the later stage. Taking out after 72h, pre-freezing in a refrigerator at-80 deg.C for 30min, and drying in a freeze dryer for 36h for further purification.

(5) Cleaning and storage of ion exchangers: the medium was removed from the column, washed with a mixture of 2mol/L NaCl and 0.1mol/L NaOH, and eluted for five column volumes, followed by ten column volumes with deionized water. When the product is not used for a long time, the product is required to be filtered, dried and stored in an environment of 4 ℃.

As a result: after the preliminary separation by DEAE-Sepharose Fast Flow exchange column chromatography, 4 fractions, namely TPF-1, TPF-2, TPF-3 and TPF-4, can be obtained after gradient elution by deionized water, 0.1mol/L, 0.3mol/L and 0.5mol/L NaCl, and the elution curves are shown in FIG. 15. Wherein the 0-23 tube is TPF-1 eluted by deionized water; the 24-44 tube is TPF-2 eluted by 0.1mol/L NaCl; the 45-67 tube is TPF-3 eluted by 0.3mol/L NaCl; the 68-83 tubes were TPF-4 eluted with 0.5mol/L NaCl.

The larger the peak area of each component in the graph is, the more the component is, the most the content of the deionized water-washed polysaccharide TPF-1 is, the least the content of TPF-4 is, the collection time is long, and the collection is not carried out in consideration of the feasibility of subsequent experiments. Therefore, the three eluates of TPF-1, TPF-2 and TPF-3 were collected, concentrated and dried, and then subjected to Sephadex chromatography. As can be seen from FIG. 15, the content ratio of the polysaccharides TPF-1, TPF-2 and TPF-3 is 2.1-2.2: 0.7-0.9: 1.7-1.9, and the content ratio of the three is 2.2:0.8:1.8 by quantitative determination.

3. Sephadex G-100 Sephadex column chromatography

The polysaccharide fraction was initially separated on a DEAE-Sepharose Fast Flow gel exchange column, but further fine structure studies were carried out using a dextran column chromatography due to possible differences in molecular weight distribution and structure.

Packing of gel chromatographic column:

(1) selection and treatment of the gel: gel Sephadex G-100 was subjected to a water flotation method to remove non-particulate, broken monomers from dextran. Then, adding the selected particles into deionized water with the volume-to-mass ratio (mL/g) of 30 times, and soaking for 24 hours to fully swell the particles;

(2) filling a chromatographic column: selecting a (1.6 multiplied by 30cm) glass chromatographic column, filling the column by a wet method, and balancing by deionized water for 24 hours for later use;

(3) 2.0mL of each polysaccharide solution obtained by DEAE-Sepharose Fast Flow gel exchange column separation is added into the column after being filtered by a 0.45 micron microporous membrane, and the sample adding amount is 5mL at one time without damaging a filler interface;

(4) after sample adding, eluting with deionized water, collecting one tube every ten minutes, collecting 10mL of each tube, and enabling the flow rate to be 1 mL/min;

(5) and (3) measuring the content of polysaccharide in each tube by a phenol-sulfuric acid method, and detecting the absorbance at OD490 by using an enzyme-labeling instrument until no color reaction appears. Drawing an elution curve of the Sephadex G-100 Sephadex column, and taking the number of the tubes as an abscissa and the light absorption value A as an ordinate.

Cleaning and storage of the gel:

and (3) eluting five column volumes by using 1mol/L NaOH solution, taking out the medium after multiple times of use, and soaking and cleaning. When the product is not used for a long time, the product needs to be soaked in 20% ethanol solution and stored in an environment of 4 ℃.

As a result: after purification by Sephadex G-100 Sephadex chromatography, the eluate was eluted with deionized water to obtain an elution curve, see FIG. 16. It can be seen that after the three refined polysaccharides TPF-1, TPF-2 and TPF-3 are purified, a single elution peak can be obtained, which indicates that TPF-1, TPF-2 and TPF-3 are uniform polysaccharides in molecular weight distribution. Collecting corresponding eluent, concentrating, and freeze-drying to obtain refined extracellular polysaccharide of Tremella spore with small amount, so that subsequent tests are carried out with TPF-1, TPF-2, and TPF-3 as research objects.

The appearance of 3 single polysaccharides TPF-1, TPF-2 and TPF-3 obtained by the above process is shown in FIG. 17. Wherein TPF-1 is white floccule, and TPF-2 and TPF-3 are loose white meshes. The three polysaccharides have no special odor, are easy to absorb moisture and absorb dampness, are easily soluble in water, are insoluble in organic solvents such as methanol, ethanol, acetone, n-butanol and the like, and have viscous high-concentration aqueous solution.

Secondly, purity identification of the polysaccharide obtained after separation and purification in the process

1. Gel filtration chromatography

And (3) respectively taking a little of elution peaks of each polysaccharide sample, concentrating to 2-3mg/mL, and performing Sephadex G-100 gel filtration chromatography again. The operation conditions are the same as the above process.

2. Ultraviolet spectral analysis

The polysaccharide samples after separation and purification with constant weight are accurately weighed, deionized water is respectively used for preparing 1.5mg/mL solution, and an ultraviolet spectrophotometer is used for scanning within the range of wavelength of 250-800 nm.

As a result: 1. the absorbance of the aqueous solutions of TPF-1, TPF-2 and TPF-3 at wavelengths of 220 nm, 260 nm and 280nm was measured by UV spectrophotometer, and the results are shown in FIG. 18 as no absorption peak, indicating that the sample does not contain protein and nucleic acid.

2. The polysaccharides TPF-1, TPF-2 and TPF-3 obtained in the above way are concentrated and then are subjected to Sephadex G100 gel filtration chromatography again, and the content of the polysaccharides in the collected liquid is determined by a phenol-sulfuric acid method, and the results are shown in figure 19, wherein obvious main peaks are generated and the polysaccharides are single and symmetrical, so that the polysaccharides obtained by purification are all single components.

Third, analysis of monosaccharide composition of tremella spore exopolysaccharide

1. Hydrolysis of polysaccharides

Weighing 15mg of TPF-1, TPF-2 and TPF-3 polysaccharide respectively, adding 2mL of 2mol/L trifluoroacetic acid, hydrolyzing at 100 ℃ for 8h, taking out, cooling, concentrating under reduced pressure to dryness to obtain monosaccharide, and placing in a dryer for later use.

2. Preparation of samples to be tested

Taking 5mg of hydrolyzed and dried polysaccharide, adding 10mg of hydroxylamine hydrochloride and 0.5mL of pyridine, placing in a 90 ℃ oven for 30min, taking out, cooling to room temperature, adding 0.5mL of acetic anhydride, placing in a 90 ℃ oven for 30min, taking out, reducing the pressure to be dry, dissolving with 1mL of chloroform for later use.

3. Preparation of monosaccharide control derivatives

Accurately weighing 5mg of each of rhamnose, arabinose, xylose, mannose, galactose, fucose and glucuronic acid as reference substances, adding 10mg of hydroxylamine hydrochloride, treating according to the method under item (2), and dissolving with 5mL of chloroform for use. Respectively taking 1.0mL of the prepared monosaccharide derivatives, and mixing to obtain a standard monosaccharide derivative mixed solution.

4. Chromatographic column conditions

The monosaccharides were derivatized to form cyanosugars acetyl esters and then analyzed and determined by GC-MS, and the specific detection conditions are shown in the following table.

5. Standard Curve preparation

Precisely measuring 1.5mL, 1.8 mL, 2.0mL, 4.0 mL and 8.0mL of standard monosaccharide derivative mixed solution, respectively placing in a 10mL measuring flask, diluting to scale with chloroform, and shaking to obtain a series of monosaccharide reference solutions. Separately, 1. mu.L of the solution was precisely aspirated, and the solution was measured by gas chromatography, and the measurement was repeated 3 times for each concentration. The measurement results were plotted with the concentration (mg/mL) of each component as the abscissa and the peak area as the ordinate.

TABLE 6 GPC-RI-MALS detection conditions

As a result: the specific results of the analysis of monosaccharide compositions of TPF-1, TPF-2 and TPF-3 in the experiment by using a method combining derivatization with GC-MS are shown in figures 20 and 21, wherein figure 20 is a GC-MS chromatogram of mixed derivative monosaccharide A, and 1 is rhamnose; 2 is arabinose; 3 is fucose; 4 is xylose; 5 is mannose; 6 is glucuronic acid; 7 is galactose; FIG. 21 is a GC-MS chromatogram of exopolysaccharides TPF-1, TPF-2, TPF-3; b is TPF-1 chromatogram, 1 is fucose; 2 is xylose; 3 is mannose; 4 is glucuronic acid; figure C is a TPF-2 chromatogram, and 1 is rhamnose; 2 is arabinose; 3 is mannose; 4 is glucuronic acid; 5 is galactose; d is a TPF-3 chromatogram, and 1 is rhamnose; 2 is arabinose; 3 is mannose; 4 is glucuronic acid; and 5 is galactose.

According to the peak area calculation, the composition ratio of the monosaccharide is as follows: TPF-1 mainly comprises fucose, xylose, mannose and glucuronic acid, the molar ratio of the monosaccharides is 9.25:23.4:16.05:37.1, wherein the glucuronic acid accounts for the largest proportion, the xylose accounts for the second time, rhamnose and arabinose are not contained, and the monosaccharide proportion is relatively simple.

TPF-2 mainly comprises fucose, xylose, mannose, glucuronic acid and galactose, and the proportion of the fucose, the xylose, the mannose, the glucuronic acid and the galactose is 1.78:9.55:12.63:128.59: 13.91.

TPF-3 is mainly composed of rhamnose, xylose, mannose, glucuronic acid and galactose, the proportion of each is 3.8:30.78:52.78:12.73:14.6, and compared with TPF-1, the monosaccharides contained in TPF-2 and TPF-3 are relatively complex.

TABLE 7 monosaccharide compositions of TPF-1, TPF-2, TPF-3

The proportion of glucuronic acid is the largest in the monosaccharide content of TPF-1 and TPF-2. Wherein, the content of uronic acid is positively correlated with the antioxidant activity of polysaccharide, the proportion of mannose in TPF-3 is the largest, and the proportion of the rest monosaccharide residues is not much different, so that the main chains of TPF-1 and TPF-2 can be acidic heteropolysaccharide with glucuronic acid as the main chain, and simultaneously contain a plurality of branched chains, and the main chain of TPF-3 can be acidic heteropolysaccharide with mannose as the main chain.

Fourthly, molecular weight analysis of TPF-1, TPF-2 and TPF-3

The weight average molecular weight, number average molecular weight and molar mass dispersity of TPF-1, TPF-2 and TPF-3 measured by GPC-RI-MALS (gel chromatography-differential-multi angle laser light scattering) are shown in Table 8 below, and their GPC-RI-MALS spectra are shown in FIGS. 22, 23 and 24, respectively.

TABLE 8 molecular weights of TPF-1, TPF-2, TPF-3

TPF-1, TPF-2 and TPF-3 have weight average molecular weights of 5189kDa, 171.6kDa and 661kDa, respectively. The TPF-1 component eluted by using the ultrapure water has the maximum molecular weight, TPF-3 times and TPF-2 has the minimum molecular weight, and the experimental result also shows that the small molecular polysaccharides can be eluted by using NaCl solutions with different concentrations. And it can be seen from the ratio of Mw/Mn that the distribution of TPF-2 is not uniform, while the distribution of TPF-3 is more uniform. The radius of rotation of the polysaccharide can be directly determined using a GPC-RI-MALS (gel chromatography-differential-multi angle laser light scattering) system, wherein the radii of rotation of TPF-1 and TPF-3 are shown in Table 8 above. Since the molecular weight of TPF-2 was too small, the radius of rotation thereof could not be detected.

The Conformation of the polysaccharides in different solvents was analyzed according to the Conformation Plot shown in FIGS. 25, 26 and 27 (molecular Conformation maps of TPF-1, TPF-2 and TPF-3, respectively): the slope of log (molar masses) is plotted as abscissa and log (r.m.s.radius) is plotted as ordinate, which reflects the molecular configuration of the macromolecule. Analysis of these 3 figures shows that TPF-1, TPF-2 and TPF-3 are all branched polymers with a compact structure.

Infrared Spectroscopy (FTIR) analysis of TPF-1, TPF-2 and TPF-3

Weighing 1mg polysaccharide sample, mixing for 100mg KBr, ground to powder in an agate mortar and then tabletted for analysis. Measuring infrared spectrum range 4000cm^-1-400cm^-1. The results are shown in Table 9 and in FIGS. 28, 29 and 30 (Infrared scanning Spectrum of TPF-1, TPF-2 and TPF-3, respectively).

TABLE 9 analysis of the results of IR spectroscopy of TPF-1, TPF-2 and TPF-3

3370.13cm in the IR spectra of samples TPF-1, TPF-2^-1、3369.84cm^-1A broad strong peak is generated, which is an absorption peak of O-H stretching vibration and indicates that intermolecular and intramolecular hydrogen bonds exist; 2931.29cm^-1、2929.80cm^-1Is the absorption peak of C-H stretching vibration; 1646.62cm^-1、1645.70cm^-1Is the absorption peak of O-H bending vibration; 1424.91cm^-1、1415.62cm^-1Is the absorption peak of C-H bending vibration. 1200cm^-1-900cm^-1Several strong and wide peaks appear in the region, which are absorption peaks of C-O stretching vibration; these peaks give an initial judgment that the sample is a polysaccharide compound.

TPF-1 and TPF-2 samples at 1100cm^-1-1010cm^-1Within the region, only 2 peaks appear, which can be shown to be furanosides; 934.66cm^-1、932.86cm^-1Is a characteristic absorption peak of saccharide molecule vibration, and is an alpha-type absorption peak of a saccharide ring; 765.05cm^-1、762.99cm^-1Is a sugar ring expansion motion alpha-type absorption peak, indicating that the sample is alpha-type polysaccharide.

3396.00cm in the IR spectrum of sample TPF-3^-1A broad strong peak is generated, which is an absorption peak of O-H stretching vibration and indicates that intermolecular and intramolecular hydrogen bonds exist; 2931.70cm^-1Is the absorption peak of C-H stretching vibration; 1612.49cm^-1Is the absorption peak of O-H bending vibration; 1418.35cm^-1Is C-absorption peak of H bending vibration. 1200cm^-1-900cm^-1Several strong and wide peaks appear in the region, which are absorption peaks of C-O stretching vibration; these groups of peaks can preliminarily judge that the sample is a polysaccharide compound; 1100cm^-1-1010cm^-1The area only has 2 peaks, and the area should be furanoside; 895.13cm^-1Is a characteristic absorption peak of the vibration of saccharide molecules and is a beta-type absorption peak of a saccharide ring; 768.43cm^-1Is the beta-type absorption peak of sugar ring expansion movement, which indicates that the sample is beta-type polysaccharide.

Experiment with Congo Red

6 parts of polysaccharide sample is accurately weighed, about 3mg of polysaccharide sample is added with 2.0mL of deionized water and 2.0mL of Congo red reagent of 80 mu mol/L respectively, and the mixture is fully and evenly mixed. Then adding a proper amount of 1.0mol/L NaOH to ensure that the concentration of the NaOH in the mixed solution is respectively 0.0, 0.1, 0.2, 0.3, 0.4 and 0.5mol/L, fully mixing and standing for 5min, adjusting the deionized water to zero, scanning a sample at 400-800nm by using an ultraviolet-visible spectrophotometer, and measuring the maximum absorption wavelength of the mixed solution under different NaOH concentrations. The blank control is not added with a sample, and is added with the same amount of deionized water, Congo red and NaOH solution, and the maximum absorption wavelength of different NaOH solutions is measured by the same method.

By comparing the sample liquid with the blank maximum absorption wavelength variation. Generally, as the concentration of NaOH is increased from low to high, if the sample to be measured has a triple helix structure, the maximum absorption wavelength of the sample solution will show an increase and then decrease, and if the sample does not have the triple helix structure, the change trend is substantially the same as that of the blank.

The test results are shown in fig. 31. As can be seen from the figure, the maximum absorption wavelength of the complex formed by TPF-1 and TPF-3 and Congo red is red-shifted compared with that of Congo red, and when the concentration of NaOH is from 0.0mol/L to 0.1mol/L, the ultraviolet absorption is shifted to long wave, which shows that the sample can form the complex with Congo red and has regular triple-helix conformation; as the NaOH concentration continues to increase, the maximum absorption wavelength begins to decrease, indicating that the helical structure in the polysaccharide is destroyed and becomes a random coil pattern. The trend of the absorption maximum wavelength of TPF-2 was similar to that of the blank control, and therefore it was considered that the two could not react to form a complex, i.e., the triple helix conformation might not be present in TPF-2.

It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> moisturizing cream containing tremella spore exopolysaccharide

<150> 2018112469901

<151> 2018-10-24

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 502

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

aacaaggttt ccgtaggtga acctgcggaa ggatcattag agatgccgaa aggcttatcc 60

aaacacctgt gcacatcgga ccgcgccccc gggccgggcc gctttcacac aaacgcatgt 120

cacgaacgta atgcatcata acatgaaaca actttcaaca acggatctct tggctctcgc 180

atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca 240

tcgaatcttt gaacgcacct tgcgcctttt ggtattccga aaggcatgcc tgtttgagtg 300

tcatgtagac tcaacccccc gggtttctga cccggcggtg ttggatttgg gccctgcctc 360

ccccggctgg ccttaaatgc gttagtggtt tcacgcagac gtcgtaagtt acgcgtcgac 420

tgtgggccgc tcacaacccc ccctactttt gcactctgac ctcaaatcag gtagggctac 480

ccgctgaact taagcatatc aa 502

Claims (4)

1. A moisturizing cream containing tremella spore exopolysaccharide is characterized by comprising the tremella spore exopolysaccharide prepared by the following method: taking the supernatant of the tremella spore fermentation liquid, adding 3 times of absolute ethyl alcohol for precipitation; adding water to dissolve the precipitate, taking the supernatant, removing protein by a Sevage method, centrifuging to obtain the supernatant, adding 3 times of ethanol for precipitation, and freeze-drying the precipitate to obtain tremella spore extracellular polysaccharide;

the Tremella spore strain is Tremella fuciformis Tyc63 and/or Tr 01;

the tremella spore exopolysaccharide contains polysaccharides TPF-1, TPF-2 and TPF-3, and the content ratio of TPF-1 to TPF-2 to TPF-3 is 2.1-2.2: 0.7-0.9: 1.7-1.9, wherein the molecular weight of TPF-1 is 5189kDa, and the TPF-1 is prepared from fucose, xylose, mannose and glucuronic acid in a molar ratio of 9.25:23.4:16.05: 37.1; the molecular weight of TPF-2 is 171.6kDa, and the molecular weight of TPF-2 is determined by the molar ratio of fucose, xylose, mannose, glucuronic acid and galactose of 1.78:9.55:12.63:128.59: 13.91; TPF-3 has a molecular weight of 661kDa and is prepared from rhamnose, xylose, mannose, glucuronic acid and galactose in a molar ratio of 3.8:30.78:52.78:12.73: 14.6;

the moisturizing cream comprises the following components in percentage by mass: 35-45% of an oil phase, 45-55% of water, 8-15% of glycerol, 0.5-2% of tremella spore exopolysaccharide and 0.5-1.5% of jemmbp;

the oil phase is prepared from olive emulsifying wax, sweet almond oil, wheat germ oil and oil-soluble vitamin E according to the mass ratio of 20:7:7:3, and (3).

2. The moisturizing cream containing tremella spore exopolysaccharide as claimed in claim 1, which comprises the following components in percentage by mass: 37% of oil phase, 51% of water, 10% of glycerol, 1% of tremella spore exopolysaccharide and 1% of Jimmbp.

3. The moisturizing cream containing tremella spore exopolysaccharide as claimed in claim 1, wherein the specific process of removing protein by the Sevage method is as follows:

s1, weighing the crude polysaccharide precipitated by ethanol, adding water to fully dissolve, and centrifuging to collect supernatant;

s2, adding a Sevage reagent with the volume of 1/3 into the supernatant, intensively mixing and oscillating on an oscillator for 15min, then putting into a shaking table, adjusting the rotating speed to 250r/min, oscillating for 15min, and then centrifuging for 15min at 4000r/min to obtain a water layer and remove the denatured protein at the junction;

s3, repeating the step S2 for three times until no white precipitate exists at the interface of the reagent layer after centrifugation;

in the step S2, Sevage reagent is prepared by mixing chloroform and n-butanol according to a volume ratio of 4: 1.

4. The moisturizing cream containing tremella spore exopolysaccharide as claimed in claim 3, wherein the crude polysaccharide is heated to be fully dissolved in step S1, the heating temperature is 60 ℃; the rotating speed of the centrifugation is 8000r/min, and the centrifugation time is 15 min.

Images