CN109943568A - A kind of single-chain nucleic acid aptamers and application thereof - Google Patents
A kind of single-chain nucleic acid aptamers and application thereof Download PDFInfo
- Publication number
- CN109943568A CN109943568A CN201910214033.9A CN201910214033A CN109943568A CN 109943568 A CN109943568 A CN 109943568A CN 201910214033 A CN201910214033 A CN 201910214033A CN 109943568 A CN109943568 A CN 109943568A
- Authority
- CN
- China
- Prior art keywords
- seq
- rhd
- aptamers
- red blood
- blood cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of nucleotide chain aptamers of disclosure of the invention and application thereof belong to biomedical and technical field of clinical medicine.Wherein, the aptamers meet: (1) being sequentially connected with nucleotide sequence shown in the nucleotide sequence shown in SEQ ID NO:1,40bp random nucleotides and SEQ ID NO:2 and form general formula shown in 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 '；It (2) can specificity and RhD antigen binding.The aptamers specific can cover erythrocyte surface RhD antigen, and RhD positive red blood cell is transformed into RhD feminine gender red blood cell.Purposes the invention also discloses aptamers preparation for being transformed into RhD positive red blood cell in the transformation agent of RhD feminine gender red blood cell.Using the present invention, hemolytic blood transfusion reaction caused by can be avoided because of isoimmunization can be used for non-homotype blood transfusion when RhD negative patient's emergency.
Description
Technical field
The invention belongs to biomedical and technical field of clinical medicine.Specifically, the present invention relates to a kind of single-chain nucleic acids
Aptamers and application thereof.
Background technique
In clinical blood transfusion practice, Rh blood group system is one of clinical meaning blood group system the most significant and the mankind
The blood group system of most complicated, most rich polymorphism in 36 blood group systems.The blood transfusion that Rh blood group system does not conform to can be due to isoimmunization
Cause the Adverse transfusion reactions such as Hemolysis, renal failure, or even dead.Rh blood group system antigen is by RHD and RHCE gene control
System coding, has now been found that 54 kinds of antigens.RhD antigen is that immunogenicity is most strong in Rh blood group system antigen, and clinical meaning is the most
Significant antigen, and influence the principal element of blood used in clinic safety.
Previous studies have shown that RhD negative patient, which is transfused 30 μ L RhD positive red blood cells, can produce anti-D of the same race.To protect
Hinder transfusion safety, RhD negative patient can only be transfused negative blood.But in China's Chinese Han Population, RhD negative individuals are only accounted for
0.1%-0.4%.As blood used in clinic amount increasingly increases, often there is shortage in the supply of RhD negative blood, seriously affects RhD yin
The daily treatment of blood transfusion of property patient can threaten patient vitals especially in the case where acute bleeding.On the contrary, RhD positive blood
But very abundant, is transformed into negative red blood cell for RhD positive red blood cell, then can solve the problems, such as the negative clinical blood supply shortage of RhD.
Technology (cell systematic evolution of is carried out by the Fas lignand system of the index concentration of target of cell
Ligands by exponential enrichment, cell-SELEX) appearance for realize the general blood of RhD transformation provide
It may.The aptamer that can get a certain target molecule of identification is screened by Cell-SELEX, with high specificity, affine
The advantages that power is high, small in size, and can largely be obtained by the method for gene chemical synthesis or PCR amplification, it is low in cost, and to human body
It is non-toxic.Aptamer it is highly sensitive test and analyze, diagnosis, protein interaction, anti-infective new drug development and refractory
Infections disease (such as AIDS, HBV, HSV, Rabies virus) etc. is used widely.
Summary of the invention
Inventor cuts down the Fas lignand system evolution technology of index concentration by red blood cell, unexpectedly filter out it is a kind of can be with
RhD antigen high-affinity, high specific combine and its antigenic single-chain nucleic acid (ssDNA) aptamers can be covered, it can be achieved that
RhD blood group " transformation " achievees the purpose that blood is general, in emergency circumstances can provide " blood group phase for RhD feminine gender rare blood type patient
The red blood cell of appearance ".
To which the present invention provides a kind of single-chain nucleic acid aptamers, it is anti-to cover RhD in conjunction with RhD antigentic specificity
RhD positive red blood cell is changed into RhD feminine gender red blood cell by originality.It can be prepared into therapeutic agent, can not obtain RhD yin in time
When property blood, RhD positive red blood cell is transformed into negative red blood cell using this therapeutic agent, the first aid for RhD negative patient is defeated
Blood.
In order to complete above-mentioned purpose, one aspect of the present invention provides a kind of single-chain nucleic acid aptamers, and the aptamers meet:
(1) there is the nucleotide sequence as shown in SEQ ID NO:1,40bp random nucleotides and SEQ ID NO:2 institute
Show that nucleotide sequence is sequentially connected composition 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 '
Shown in general formula；
It (2) can specificity and RhD antigen binding.
In some embodiments of the present invention, the random nucleotides in SEQ ID NO:3-14 one
Kind.
In some specific embodiments of the invention, the random nucleotides are selected from SEQ ID NO:3, SEQ ID
One of NO:4, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:11.
In one embodiment of the invention, the random nucleotides are selected from SEQ ID NO:3 and SEQ
One of ID NO:4.
The second aspect of the present invention provides a kind of single-chain nucleic acid aptamers composition comprising at least two single-chain nucleic acids are suitable
Ligand, any aptamers meet:
(1) there is the nucleotide sequence as shown in SEQ ID NO:1,40bp random nucleotides and SEQ ID NO:2 institute
Show that nucleotide sequence is sequentially connected composition 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 '
Shown in general formula；
It (2) can specificity and RhD antigen binding.
In some embodiments of the present invention, the random nucleotides in SEQ ID NO:3-14 at least
Two kinds.
In some embodiments of the present invention, the random nucleotides are selected from SEQ ID NO:3, SEQ ID NO:
4, at least two in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:11.
In some embodiments of the present invention, the random nucleotides are respectively SEQ ID NO:3 and SEQ ID
NO:4。
The third aspect of the present invention is provided described in aptamers described in first aspect present invention or second aspect of the present invention
Aptamers composition is in preparation for RhD positive red blood cell to be transformed into the purposes of RhD feminine gender red blood cell being transformed in agent.
Fourth aspect present invention provide it is a kind of for RhD positive red blood cell to be transformed into the transformation agent of RhD feminine gender red blood cell,
The transformation agent includes aptamers composition described in aptamers described in first aspect present invention or second aspect of the present invention.
Beneficial effects of the present invention
Single-chain nucleic acid aptamers of the invention can be specifically resisted with RhD by the small-molecule substance of 82 base compositions
Original combines, and can effectively cover red blood cell RhD antigen, it is made to lose bioactivity, blocks the specific binding with allo-antibody,
Hemolytic blood transfusion reaction caused by avoiding because of isoimmunization can be used for non-homotype blood transfusion when RhD negative patient's emergency.
Detailed description of the invention
Fig. 1 is that the red blood cell of embodiment 1 cuts down the preparation side that SELEX screens RhD antigentic specificity ssDNA aptamer
Method flow chart.
Fig. 2 is the agarose gel electrophoresis figure that secondary library prepares effect in embodiment 1, from left to right successively are as follows:
Marker；1 is the non-symmetric PCR amplification product of step 5；2 be the asymmetric PCR amplified production of step 6；3 exist for step 7
Product on the basis of the product of step 2 after purification.
Fig. 3 is that the fluorescence intensity in 2 validation verification of embodiment after different ssDNA full length sequences cover RhD antigen becomes
Change, wherein abscissa is ssDNA number, and ordinate is fluorescence intensity.
Fig. 4 is RhD positive red blood cell in the verifying of 2 affinity of embodiment in conjunction with SEQ ID NO:15, SEQ ID NO:16
The variation of fluorescence intensity afterwards, wherein abscissa is the concentration of ssDNA full length sequence, and ordinate is fluorescence intensity.
Fig. 5 is that masking RhD antigen effect is used in combination in SEQ ID NO:15 and SEQ ID NO:16 in embodiment 2, from a left side
Successively to the right side are as follows: A is flow cytometry inspection result；B is without SEQ ID NO:15 and SEQ ID NO:16 Combined Treatment
Microscopically observation result；Microscopically observation knot when C is SEQ ID NO:15 and SEQ ID NO:16 concentration is 500pmol
Fruit.
Specific embodiment
In order to which the technical problems, technical solutions and beneficial effects solved by the present invention is more clearly understood, below in conjunction with
Embodiment, the present invention will be described in further detail.
Embodiment
Following example is used herein to demonstration the preferred embodiments of the invention.Those skilled in the art, it will be appreciated that under
State the technology disclosed in example represent inventor discovery can be used for implementing technology of the invention, therefore can be considered as implementation this
The preferred embodiment of invention.But those skilled in the art should be understood that specific reality disclosed herein according to this specification
Many modifications can be made by applying example, still can be obtained identical or similar as a result, rather than away from the spirit or scope of the present invention.
Unless otherwise defined, the term of all technologies as used herein and science, and the technology in fields of the present invention
Personnel institute is normally understood equivalent in meaning, and being disclosed reference and their materials of reference will all be incorporated.
Those skilled in the art will recognize or just will appreciate that by routine test many described here
Invention specific embodiment many equivalent technologies.These will equally be comprised in claims.
Embodiment 1
Present embodiments provide a kind of system of red blood cell abatement SELEX screening RhD antigentic specificity ssDNA aptamer
Preparation Method, preparation flow and main preparation parameter are shown in that Fig. 1, table 1 include the following steps:
1 red blood cell of table cuts down SELEX parameter
Step 1: negative sense screening.In 1.5mL centrifuge tube, sequentially adding 100 μ L concentration is 2.0 × 106/μL RhD-It is red
Cell physiological saline suspension, 950 μ L anticoagulants for storage of whole blood III (CPDA-I saves liquid), 15.2 μ L salmon sperm dnas and 100 μ L ssDNA
Library is incubated for 30min under room temperature (25 DEG C).5000rpm, 2min centrifugation removal red blood cell (RBC), supernatant is transferred to another clean
In net 1.5mL centrifuge tube, for positive screening.
The library ssDNA is made of 82bp, is the random sequence of 40bp among library, two sides are to be made of respectively 21bp
Primer binding zone, the wherein end 5' combined area are as follows:
5'-AGAGACGGACACAGGATGAGC-3'(SEQ ID NO:1)
The end 3' combined area are as follows:
5'-CCTTCCCCAAGACAGCATCCA-3'(SEQ ID NO:2)
Thus it forms
General formula shown in 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 '.
The library ssDNA is synthesized by TaKaRa company.Salmon sperm dna is purchased from Life Technologies company (Salmon
Sperm DNA, article No.: AM9680, lot number: 1502041).
Step 2: forward direction screening.It is 2.0 × 10 that 100 μ L concentration are added in the library screened through negative sense4/μL RhD+It is red
Cell physiological saline suspension is incubated for 60min at room temperature.Centrifugation remove supernatant, red blood cell buckle be added 400 μ l physiological saline and
Red blood cell is resuspended in 100 μ l red blood cell magnetized liquids, is placed on magnetic frame, stands 2min.Suck supernatant.Repeated washing 5 times, every time
Need tube.
The red blood cell magnetized liquid is purchased from Diagast company (MagneLys, lot number: 581000).
Step 3: it is incorporated into RhD+The ssDNA of red blood cell is extracted.In the red blood cell of removal supernatant, it is seedless that 200 μ L are added
Sour enzyme water, 95 DEG C, 5min.300 μ L Lysis/Binding Buffer are added.Reverse centrifuge tube 4~6 times, incubation at room temperature
5min.150 μ L isopropanols (isopropanol) are added.Add the magnetic bead of 50 μ L (2mg) suspension.It is incubated at room temperature on Mixer
10min.It is placed on magnetic frame, stands 2min, suck supernatant.850 μ L Washing Buffer 1 are added (will be by before use
Illustrate that isopropanol is added), it overturns centrifuge tube 3~4 times, magnetic bead is resuspended.1min is stood on magnetic frame, removes supernatant.Repetition is washed
450 μ L Washing Buffer 2 of primary rear addition are washed, then suspension containing magnetic beads are transferred in another clean centrifuge tube.
2min is stood on magnetic frame, removes supernatant.Repeated washing is primary, but does not have to tube again.After all absorbing remaining liq, in magnetic frame
On dry magnetic bead, make ethyl alcohol all volatilize.10~15min is about needed at room temperature.100 μ L Elution Buffer are added, with sample-adding
Think highly of outstanding magnetic bead, 70 DEG C, 3min.Magnetic bead is removed, supernatant is ssDNA.
The ssDNA extracts reagent and is purchased from Life Technologies company (Dynabeads SILANE ivral
NA, lot number: 37011D).
Step 4: ssDNA concentration quantitative detection.SsDNA concentration in supernatant is detected using fluorescent quantitation.Instead
Answer system are as follows: 8 μ L H2O, PCR grad, 10 μ L Master Mix, 1 μ L ssDNA template, 1 μ L concentration is 10pmol/ μ L
Upstream and downstream mix primer.Amplification condition strictly presses kit specification progress.
The ssDNA fluorogenic quantitative detection reagent is purchased from Roche company (480 SYBR Green I of LightCycler
Master, lot number: 04707516001).
Step 5: the amplification and purifying of secondary library.Using biotin labeling the upstream and downstream library primer pair ssDNA into
Row PCR amplification obtains the dsDNA for carrying biotin, provides enough templates for asymmetric PCR.
PCR reaction system is as follows:
The Taq enzyme is selected from the kit of the model M1665S of Promega company.
The biotin labeling upstream primer are as follows:
5'-biotin-AGAGACGGACACAGGATGAGC-3'；
The biotin labeling downstream primer are as follows:
5'-biotin-TGGATGCTGTCTTGGGGAAGG-3'；
Wherein, biotin is biotin, and primer is synthesized by TaKaRa company.
Amplification condition:
First stage:
94℃ 5min
Second stage: (11 circulations)
94℃ 30s
59℃ 30s
72℃ 30s
Phase III:
72℃ 5min
4 DEG C of preservations obtain obtaining the dsDNA amplified production for carrying biotin.
Step 6: the dsDNA amplified production for carrying biotin obtained using step 5 is marked as template using inanimate object element
Upstream primer and biotin labeling downstream primer, the ratio between amount of the two substance be 20:1, carry out asymmetric PCR amplification.
Obtained dsDNA, byproduct carry biotin after asymmetric PCR expands, and ssDNA is free of biotin.
The AmpliTaq Gold Fast PCR Master Mix (2 ×) is from Life Technologies company
4390939 kits.
The upstream primer is 5 '-AGAGACGGACACAGGATGAGC-3 '；
The biotin labeling downstream primer is 5 '-biotin-TGGATGCTGTCTTGGGGAAGG-3 '；
Wherein, biotin is biotin, and above-mentioned primer is synthesized by TaKaRa company.
It is expanded by following condition:
First stage:
95℃ 10min
Second stage: (30 circulations)
96℃ 3s
59℃ 3s
68℃ 3s
Phase III:
72℃ 10s
4 DEG C of preservations, obtain amplified production, this amplified production includes the dsDNA and byproduct for carrying biotin, and not
SsDNA containing biotin.
Step 7: being finally added Streptavidin MagneSphere in the amplified production of step 6, removes in amplified production and owns
The dsDNA and byproduct for carrying biotin, to obtain the ssDNA of high-purity, high concentration.
Take 1.5 times of volumes of amplified production of step 6 Streptavidin MagneSphere (
Paramagnetic Particles, Promega, Z5482), with PBS-Tween (pH 7.4, with 0.02%Tween-20)
Washing 3 times, the adherent 30s on magnetic frame removes supernatant.SsDNA amplified production is transferred in magnetic bead pipe, room temperature waves incubation
20min.Supernatant is sucked out on magnetic frame, supernatant is required ssDNA secondary library.
As a result it detects: using the purity of high-resolution agarose gel electrophoresis detection ssDNA, as a result seeing Fig. 2.
Embodiment 2
Present embodiments providing can be in conjunction with RhD antigentic specificity simultaneously by the ssDNA secondary library screening of embodiment 1
Cover the method for its antigenic single-chain nucleic acid aptamers:
Step 1: the ssDNA sequence library sequencing filtered out
Sequence measuring joints sequence is added at the both ends in the ssDNA screening library that embodiment 1 obtains:
CCATCTCATCCCTGCGTGTCTCCGACTCAG；
CCTCTCTATGGGCAGTCGGTGAT。
It is surveyed after PCR amplification using Ion Torrent Personal Genome Machine semiconductor sequenator
Sequence (is completed) by the Shanghai Life Technologies branch company, the U.S..According to sequencing result, we by centre have target sequence,
Both ends have connector and the sequence of connector exact matching is as identifying object, and it is random to filter out dominant ssDNA in sequence library
Sequence is shown in Table 2, screening criteria are as follows: copy number > 1000 in ssDNA sequence library, and the sequence that variable section length is 40bp.
2 advantage ssDNA aptamer variable region base sequence of table
| Sequence number | Random fragment base sequence (5 ' → 3 ') |
| SEQ ID NO:3 | GGCCTGGTCTGTTAGCCGGGTAGCAGCCCCGGCACCTATT |
| SEQ ID NO:4 | GGGTAGCAGCCCCGCGGAGGGTCGGCTATAAGAACCAAGA |
| SEQ ID NO:5 | CTATTCCCCACGTCACTTTTCCCGTAGGTTGGACTCGACC |
| SEQ ID NO:6 | GGTGCAGGGGGGTCGGAGAAGAGGTTGAGGGGAGAGGGGT |
| SEQ ID NO:7 | ACGGCCTCTGTATAATGCTGGCCTTGACGCTTGTCCCTTG |
| SEQ ID NO:8 | ACGGCCTCTGTACAATGCTGGCCTTGACGCTTGTCCCTTG |
| SEQ ID NO:9 | TACACCAATCTCCCCCCTACATTCTCCCACCAGCACTCCA |
| SEQ ID NO:10 | GGGTAGCAGCCCCGCGGAGGGTCGGCTATAAGAACTAGGA |
| SEQ ID NO:11 | GGGTAGCAGCCCCGCGGAGGGTCGGCTATAAGAACCAGGA |
| SEQ ID NO:12 | GGGTAGCAGCCCCGCGGAGGGTCAGCTATAAGAACCAGGA |
| SEQ ID NO:13 | GGGTAGCAGCCCCGCGGAGGGTCGGCTATAGGAACCAGGA |
| SEQ ID NO:14 | CTATTCCCCACGTCACTTTTCCCGTAGGCTGGACTCGACC |
Step 2: many index verifying is carried out to the random sequence for the ssDNA that step 1 filters out
1, validation verification (the masking antigenic proficiency testing of RhD)
RhD positive red blood cell (4 × 10 is added in micro-reaction plate6Red blood cell/hole), it is separately added into the Dan Te filtered out
Anisotropic ssDNA full length sequence 500pmol, at room temperature (25 DEG C) incubation 60min.Then monoclonal anti-D of the 50 μ L through markization is added
[128 times of dilutions, potency are 512 (1024, score 109)], is incubated for 30min at room temperature.After brine 3 times, it is added
(2 fluorescence secondary antibody of F (ab ') is incubated for after 15min using life the goat anti-human igg of the diluted FITC label of 100 1000 times of μ L at room temperature
200 μ L physiological saline are added in reason salt water washing 3 times, mix, use Flow cytometry red blood cell fluorescence intensity.
Positive control and blank control are set simultaneously, respectively do 3 parallel holes.The preparation method of positive control is to use physiology salt
Water substitutes the ssDNA in above-mentioned test.(red blood cell after F (ab ') 2 is incubated for is made by RhD positive red blood cell and FITC- goat anti-human igg
For blank control.
The above-mentioned anti-D of monoclonal is purchased from Shanghai blood biomedical limited liability company's (lot number: 20160725)；Above-mentioned sheep
Anti-human igg (2 fluorescence antibody of F (ab ') purchased from Jackson company (2 Anti Human IgG:FITC of Goat F (ab`), lot number:
125089)；The flow cytometer that above-mentioned flow cytometer detection uses is the FACSCanto II of U.S. company BD；The above-mentioned list filtered out
Specific ssDNA full length sequence is synthesized by Shanghai Sheng Gong bioengineering limited liability company.
Interpretation of result:
Using positive control fluorescence intensity as reference, observation test group fluorescence intensity declines degree.Use IBM SPSS
22 software of Statistics, p < whether significant using one-way analysis of variance (One-Way Anova) more each mean value difference
0.05 is statistically significant for difference.
Fig. 3 shows each ssDNA full length sequence masking RhD antigen to block fluorescence after anti-D and RhD antigen binding strong
Situation of change is spent, as can be seen from Fig.: the ssDNA overall length that intermediate random sequence is made of SEQ ID NO:3, SEQ ID NO:4
Sequence has the function of significantly covering RhD antigen, and statistical difference is significant (p value is < 0.05) compared with positive control.
Conclusion:
By screen 2 kinds of effective ssDNA random sequences, the full length sequence of ssDNA are as shown in table 3:
Table 3 is through screening effective ssDNA full length sequence
2, the verifying of affinity
100 μ L 0.2%RhD are added in 96 orifice plates+Then red blood cell physiological saline suspension adds respectively in different holes
Enter Alexa Fluor 488 and mark monospecific ssDNA Seq 1 and Seq 2, reaches the final concentration of every kind of ssDNA
200nmol/L, 400nmol/L, 800nmol/L, 1000nmol/L and 1200nmol/L.37 DEG C are waved incubation 60min.
4500rcf (Labofuge 400R, Heraeus Instruments) is centrifuged 5min.Get rid of the liquid in plate.Use physiological saline
After supernatant is removed in last time centrifugation, 200 μ L physiological saline are added in washing 3 times, strong using Flow cytometry red blood cell fluorescence
Degree.
Above-mentioned Alexa Fluor 488 marks monospecific ssDNA to be closed by Shanghai Sheng Gong bioengineering limited liability company
At.
Testing result:
Fig. 4 shows the change of SEQ ID NO:15, SEQ ID NO:16 rear fluorescence intensity in conjunction with RhD positive red blood cell
Change, according to fluorescence intensity change situation, dissociation constant (dissociation is calculated using GraphPad Prims V6 software
constant,Kd).Data analyze the requirement of composite non-linear Fitting Analysis, calculate Kd value using following formula:
Bmax is Bmax, and X is the concentration of each ssDNA full length sequence, and Y is fluorescence intensity level corresponding with X value.By
SEQ ID NO:15 is calculated in this, the Kd value of SEQ ID NO:16 be respectively as follows: 580.5 ± 142.0nM and 737.7 ±
161.8nM。
Conclusion:
Affinity is from high to low successively are as follows: SEQ ID NO:15, SEQ ID NO:16.
3, ssDNA covers the dose-effect relationship of RhD antigen
Streaming method and indirect antiglobulin test method (IAT) is respectively adopted to close the dosage effect of ssDNA masking RhD antigen
System is analyzed.
Streaming method: 100 μ L RhD are added in micro-reaction plate+Cell physiological saline suspension (4 × 106Red blood cell/hole),
SEQ ID NO:15, SEQ ID NO:16 are separately added by the gradient of 200pmol, 300pmol, 400pmol, 500pmol, 37 DEG C
It is incubated for 60min.With brine 3 times, add the anti-D of 100 μ L source of people, 37 DEG C of incubation 30min, with brine 3 times,
The goat anti-human igg that the diluted FITC of 1000 times of 100 μ L is marked is added, and (2 fluorescence secondary antibody of F (ab ') makes after being incubated for 15min at room temperature
With brine 3 times, 200 μ L physiological saline are added, mixes, uses Flow cytometry red blood cell fluorescence intensity.Together
When equipment positive control and blank control.The preparation method of positive control is the ssDNA substituted in above-mentioned test with physiological saline.
(red blood cell after the incubation of F (ab ') 2 is as blank control by RhD positive red blood cell and FITC- goat anti-human igg.
Indirect antiglobulin method: 100 μ L RhD are added in micro-reaction plate+Cell physiological saline suspension (4 × 106It is red thin
Born of the same parents/hole), SEQ ID NO:15, SEQ ID NO are separately added by the gradient of 200pmol, 300pmol, 400pmol, 500pmol:
16,37 DEG C of incubation 60min.With brine 3 times, the anti-D of 100 μ L source of people, 37 DEG C of incubation 30min is added to be washed with physiology salt
It washs 3 times, 100 μ L antiglobulin reagents is added, 1000g is centrifuged 15s, piece is dripped after resuspension, microscope be (Japanese Olympus company
Olympus BX43 type microscope) under observe and result and record.Positive control and blank control, the system of positive control are set simultaneously
Preparation Method is the ssDNA substituted in above-mentioned test with physiological saline.The preparation method of positive control is substituted with physiological saline
State the anti-D of source of people in test.
The above-mentioned anti-D of source of people is provided by the volunteer for generating anti-D；Above-mentioned antiglobulin reagent is cured purchased from Shanghai blood biology
Medicine Co., Ltd (lot number: 20141203).(2 fluorescence antibody of F (ab ') is purchased from Jackson company to above-mentioned goat anti-human igg
(2 Anti Human IgG:FITC of Goat F (ab`), lot number: 125089)；The flow cytometer that above-mentioned flow cytometer detection uses for
The FACSCanto II of U.S. company BD；The above-mentioned monospecific ssDNA full length sequence filtered out is by the raw work bioengineering in Shanghai
Limited liability company's synthesis.
Testing result:
Above-mentioned test result such as table 4, shown in Fig. 5.
Table 4
According to table 4, Fig. 5 can be seen that the raising with ssDNA concentration, when SEQ ID NO:15, SEQ ID NO:16 are equal
When reaching 500pmol can completely obscured RhD antigen, so that test result is negative.
Conclusion:
SEQ ID NO:15 and SEQ ID NO:16 is used in combination when concentration reaches 500pmol can be completely obscured red
Cell RhD antigen makes IAT test result by the positive shift negative findings before handling.
5, monocyte monolayer assay (MMA)
6 person-portion peripheral blood mononuclear cells are extracted using density-gradient centrifugation method, are washed 1 time with RPMI 1640, by 6 parts of lists
Nucleus mixing, and cell concentration is adjusted to 5 × 106A cell/mL.50 μ L mixing monocytes are added in chamber slides,
In CO237 DEG C of incubation 60min, keep cell adherent in incubator.Non- attached cell is gently rinsed out with physiological saline, in different holes
In be separately added into 100 μ L concentration be 1 × 107The test group of a cell/mL, positive controls, negative control group red blood cell, in CO2
37 DEG C of incubation 90min in incubator.Slide carries out Rui Shi-Ji's nurse Sa dyeing after brine 3 times.It is seen under microscope
500 monocytes are examined, is positive detection limit with 3% phagocytosis/adhesion rate, judges each group test result.
Above-mentioned test group red blood cell is that RhD positive red blood cell and SEQ ID NO:15 and SEQ ID NO:16 are each
500pmol37 DEG C of incubation 60min is added the anti-D of source of people of 2 times of volumes, incubates after mixing at 37 DEG C after brine 3 times
Educate 60min.After brine 5 times, cell concentration is adjusted to 1 × 10 with RPMI 16407A cell/mL.Positive controls
Preparation method be to substitute above-mentioned SEQ ID NO:15 and SEQ ID NO:16 with physiological saline.Negative control is negative with RhD
Red blood cell substitutes above-mentioned RhD positive red blood cell.
Testing result:
Test group monocyte phagocytosis/adhesion rate is 2.5%, positive controls 19.5%, and negative control group is
2.2%.Positive detection is limited to 3%.
Conclusion:
SEQ ID NO:15 and SEQ ID NO:16 is used in combination, can be completely obscured red when concentration reaches 500pmol
Cell RhD antigen makes MMA test result in sex-limited reaction.It is believed that handled through SEQ ID NO:15 and SEQ ID NO:16
RhD positive red blood cell will not cause hemolytic blood transfusion adverse reaction after being infused into RhD negative patient body because of isoimmunization.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Sequence table
<110>hospital general, Shenzhen University
<120>a kind of single-chain nucleic acid aptamers and application thereof
<130> KH19-1-153
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agagacggac acaggatgag c 21
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccttccccaa gacagcatcc a 21
<210> 3
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ggcctggtct gttagccggg tagcagcccc ggcacctatt 40
<210> 4
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gggtagcagc cccgcggagg gtcggctata agaaccaaga 40
<210> 5
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ctattcccca cgtcactttt cccgtaggtt ggactcgacc 40
<210> 6
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ggtgcagggg ggtcggagaa gaggttgagg ggagaggggt 40
<210> 7
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
acggcctctg tataatgctg gccttgacgc ttgtcccttg 40
<210> 8
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
acggcctctg tacaatgctg gccttgacgc ttgtcccttg 40
<210> 9
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
tacaccaatc tcccccctac attctcccac cagcactcca 40
<210> 10
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gggtagcagc cccgcggagg gtcggctata agaactagga 40
<210> 11
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gggtagcagc cccgcggagg gtcggctata agaaccagga 40
<210> 12
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gggtagcagc cccgcggagg gtcagctata agaaccagga 40
<210> 13
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gggtagcagc cccgcggagg gtcggctata ggaaccagga 40
<210> 14
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
ctattcccca cgtcactttt cccgtaggct ggactcgacc 40
<210> 15
<211> 82
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
agagacggac acaggatgag cggcctggtc tgttagccgg gtagcagccc cggcacctat 60
tccttcccca agacagcatc ca 82
<210> 16
<211> 82
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
agagacggac acaggatgag cgggtagcag ccccgcggag ggtcggctat aagaaccaag 60
accttcccca agacagcatc ca 82
Claims (10)
1. a kind of single-chain nucleic acid aptamers, which is characterized in that the aptamers meet:
(1) have shown in the nucleotide sequence as shown in SEQ ID NO: 1,40bp random nucleotides and SEQ ID NO:2
Nucleotide sequence is sequentially connected composition 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 ' institute
The general formula shown；
It (2) can specificity and RhD antigen binding.
2. aptamers according to claim 1, which is characterized in that the random nucleotides are selected from SEQ ID NO:
One of 3-14.
3. aptamers according to claim 2, which is characterized in that the random nucleotides are selected from SEQ ID NO:
3, one of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:11.
4. aptamers according to claim 3, which is characterized in that the random nucleotides are selected from SEQ ID NO:3
One of with SEQ ID NO:4.
5. a kind of single-chain nucleic acid aptamers composition comprising at least two single-chain nucleic acid aptamers, which is characterized in that Ren Yishi
Ligand meets:
(1) have shown in the nucleotide sequence as shown in SEQ ID NO: 1,40bp random nucleotides and SEQ ID NO:2
Nucleotide sequence is sequentially connected composition 5'-AGAGACGGACACAGGATGAGC-N40-CCTTCCCCAAGACAGCATCCA-3 ' institute
The general formula shown；
It (2) can specificity and RhD antigen binding.
6. aptamers composition according to claim 5, which is characterized in that the random nucleotides are selected from SEQ ID
At least two in NO:3-14.
7. aptamers composition according to claim 6, which is characterized in that the random nucleotides are selected from SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:6, at least two in SEQ ID NO:7 and SEQ ID NO:11.
8. aptamers composition according to claim 7, which is characterized in that the random nucleotides are respectively SEQ
ID NO:3 and SEQ ID NO:4.
9. any any aptamers composition of the aptamers or claim 5-8 of claim 1-4 is used in preparation
Purposes in the transformation agent that RhD positive red blood cell is transformed into RhD feminine gender red blood cell.
10. a kind of for RhD positive red blood cell to be transformed into the transformation agent of RhD feminine gender red blood cell, which is characterized in that the transformation
Agent includes any any aptamers composition of the aptamers or claim 5-8 of claim 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910214033.9A CN109943568B (en) | 2019-03-20 | 2019-03-20 | Single-stranded nucleic acid aptamer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910214033.9A CN109943568B (en) | 2019-03-20 | 2019-03-20 | Single-stranded nucleic acid aptamer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109943568A true CN109943568A (en) | 2019-06-28 |
| CN109943568B CN109943568B (en) | 2023-05-16 |
Family
ID=67010370
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910214033.9A Active CN109943568B (en) | 2019-03-20 | 2019-03-20 | Single-stranded nucleic acid aptamer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109943568B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818280A (en) * | 2015-04-24 | 2015-08-05 | 深圳市血液中心 | Single-stranded aptamer and application thereof |
-
2019
- 2019-03-20 CN CN201910214033.9A patent/CN109943568B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104818280A (en) * | 2015-04-24 | 2015-08-05 | 深圳市血液中心 | Single-stranded aptamer and application thereof |
Non-Patent Citations (6)
| Title |
|---|
| YINZE ZHANG等: "Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody_ a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody", 《BLOOD TRANSFUS.》 * |
| 庄乃保等: "RhD抗体ssDNA适配体的筛选与鉴定", 《中国输血杂志》 * |
| 张印则等: "基于RhD蛋白Aptamer筛选技术的随机ssDNA次级文库制备条件的优化", 《中国输血杂志》 * |
| 李执如等: "隐蔽红细胞RhD抗原遮盖效果研究", 《现代预防医学》 * |
| 李桢等: "ssDNA适配体阻断FcγR介导巨噬细胞吞噬作用的研究", 《中国输血杂志》 * |
| 章昊等: "红细胞RhD膜蛋白提取与固相化方法的研究", 《中国输血杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109943568B (en) | 2023-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mitsialis et al. | Single-cell analyses of colon and blood reveal distinct immune cell signatures of ulcerative colitis and Crohn’s disease | |
| Nyangahu et al. | Disruption of maternal gut microbiota during gestation alters offspring microbiota and immunity | |
| Olin et al. | Stereotypic immune system development in newborn children | |
| Lee et al. | Tracking microbial colonization in fecal microbiota transplantation experiments via genome-resolved metagenomics | |
| EP2663864B1 (en) | Immunodiversity assessment method and its use | |
| Nair et al. | High-dimensional immune profiling of total and rotavirus VP6-specific intestinal and circulating B cells by mass cytometry | |
| JP2017508457A (en) | T cell balance gene expression, composition and method of use thereof | |
| CN104818280B (en) | Single-chain nucleic acid aptamers and its application | |
| El Kenz et al. | Transfusion support of autoimmune hemolytic anemia: how could the blood group genotyping help? | |
| Wu et al. | Subpopulations of exosomes purified via different exosomal markers carry different microRNA contents | |
| CN104818316B (en) | Human leukocyte antigen gene detecting kit for dermal drug adverse reaction caused by screening salicylazosulfapyridine | |
| Goods et al. | Blood handling and leukocyte isolation methods impact the global transcriptome of immune cells | |
| Wang et al. | High-throughput isolation of fetal nucleated red blood cells by multifunctional microsphere-assisted inertial microfluidics | |
| Ben-Othman et al. | Systems biology methods applied to blood and tissue for a comprehensive analysis of immune response to hepatitis B vaccine in adults | |
| Fan et al. | Utilizing single-cell RNA sequencing for analyzing the characteristics of PBMC in patients with Kawasaki disease | |
| Vallania et al. | Multicohort analysis identifies monocyte gene signatures to accurately monitor subset-specific changes in human diseases | |
| Li et al. | IFN‐γ facilitates liver fibrogenesis by CD161+ CD4+ T cells through a regenerative IL‐23/IL‐17 axis in chronic hepatitis B virus infection | |
| Choi et al. | KIR+ CD8+ and NKG2A+ CD8+ T cells are distinct innate-like populations in humans | |
| Udani et al. | Secretion encoded single-cell sequencing (SEC-seq) uncovers gene expression signatures associated with high VEGF-A secretion in mesenchymal stromal cells | |
| Wu et al. | Separation and purification of Toxoplasma gondii tachyzoites from in vitro and in vivo culture systems | |
| Pugh et al. | In vitro education of human natural killer cells by KIR3DL1 | |
| CN109943568A (en) | A kind of single-chain nucleic acid aptamers and application thereof | |
| Yousuf et al. | Naturally occurring ‘enzyme only’anti-E antibody: a rare occurrence | |
| Tang et al. | Research progress in isolation and enrichment of fetal cells from maternal blood | |
| Jiao et al. | Dissecting human placental cells heterogeneity in preeclampsia and gestational diabetes using single-cell sequencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |