CN109942691A - Conotoxin polypeptide CTx-btg01 and its preparation method and application - Google Patents
Conotoxin polypeptide CTx-btg01 and its preparation method and application Download PDFInfo
- Publication number
- CN109942691A CN109942691A CN201711384611.0A CN201711384611A CN109942691A CN 109942691 A CN109942691 A CN 109942691A CN 201711384611 A CN201711384611 A CN 201711384611A CN 109942691 A CN109942691 A CN 109942691A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- conotoxin
- conotoxin polypeptide
- btg01
- ctx
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to the extraction of polypeptide protein and preparation fields more particularly to a kind of conotoxin polypeptide CTx-btg01 and its preparation method and application.Conotoxin polypeptide CTx-btg01 provided by the invention is made of 17 amino acid, and the amino acid full length sequence of the conotoxin polypeptide is GGCCSHPACGVNHPELC.It uses this using conotoxin polypeptide CTx-btg01 as active pharmaceutical ingredient, is used for field of pesticides.Conotoxin polypeptide CTx-btg01 of the invention has efficient anti-insect activity, and small to mammalian toxicity, and energy specific effect has significant application value in insect in terms of the biological insecticides of exploitation highly effective and safe.
Description
Technical field
The present invention relates to the extraction of polypeptide protein and preparation field more particularly to a kind of conotoxin polypeptide CTx-btg01
And its preparation method and application.
Background technique
With the generally use of many chemical insecticides, the drug resistance of agricultural pests is continuously increased, and leads to insecticide toxicity
It is all increasing with usage amount, and then entire ecological environment is caused huge harm, the mankind are especially seriously threatened to food
The worry and damage human health of health, demand to novel, efficient, harmless biological insecticides.
Cone shell (Cone snail) is mainly grown on Tropical Ocean Area, belongs to Mollusca, Gastropoda, Conidae, be
The beautiful snail lived on coastal coral reef, sandy beach.The whole world can be divided into there are about 500 kinds or more cone shells according to cone shell feeding habits
Three categories, carnivorism cone shell (are greater than 350 kinds);It eats spiral shell cone shell (about 70 kinds);Ichthyophagy cone shell (about 70 kinds).Conotoxin
(Conopeptide, Conotoxin, CTX) is the biologically active polypeptide toxoid of one kind obtained from cone shell, is had
The effect for acting on different kinds of ions channel is mainly used in analgesia field, as MVIIA is used as advanced cancer town by FDA approval
Pain medicine.Now studies have found that certain conotoxins have the function of inhibiting insect cell growth, but report that is come out can send out
It waves and inhibits the conotoxin of insect cell growth seldom, therefore filter out efficiently pest-resistant active peptide and be even more important.
Summary of the invention
The present invention is directed to solve at least some of the technical problems in related technologies.For this purpose, of the invention
One purpose is: a kind of active peptides for capableing of desinsection are provided, it is safe and non-toxic, and also insecticidal effect is good.
The present inventor has found after study: conotoxin caused by carnivorism cone shell can specific effect in elder brother
The intracorporal target spot of worm and there is stronger killing ability, toxicity very little to mammal or have no toxic side effect.Therefore, from carnivorism
In conotoxin gene library and peptide library, screening obtains efficiently pest-resistant conotoxin, has significant insecticidal effect, and can
The drug resistance of traditional chemical insecticide and the defect that toxicity is big are solved, can be used as a kind of good biological insecticides exploitation makes
With.
For this purpose, the first aspect of the present invention provides a kind of conotoxin polypeptide CTx-btg01.Implementation according to the present invention
Example, the conotoxin polypeptide are made of 17 amino acid, and the amino acid full length sequence of the conotoxin polypeptide is
GGCCSHPACGVNHPELC.According to an embodiment of the invention, the present invention produces barrel-shaped cone shell (Conusbetulinus) poison from Hainan
The new conotoxin polypeptide CTx-btg01 is extracted and identified in pipe, confirms cone shell poison by mtt assay and insect injection method
Element has efficient anti-insect activity, and electro physiology confirmation is small to mammalian toxicity, and energy specific effect is efficient in exploitation in insect
Be of great significance in terms of the biological insecticides of safety, can be used as a kind of excellent biological insecticides come using.
According to an embodiment of the invention, the conotoxin polypeptide is from left side number, the 3rd amino acid and the 9th amino acid
Between, between the 4th amino acid and the 17th amino acid be respectively formed disulfide bond.The molecular weight of the conotoxin polypeptide is
1678.92 dalton.It is combined by forming stable disulfide bond in chain, can have the anti-insect activity of stability and high efficiency, and
To the small toxicity of mammal, can be used as a kind of excellent biological insecticides come using.
The second aspect of the present invention provides a kind of DNA sequence dna.According to an embodiment of the invention, the DNA sequence encoding
The conotoxin polypeptide CTx-btg01.For the amino acid sequence of the conotoxin polypeptide, the rule encoded according to codon
Then, determining different DNA sequence dnas are corresponding with.Using the DNA sequence dna, different insect host cells can be inserted it into
In, to express corresponding toxic polypeptide, play good insecticidal effect.For example, should using modern molecular biology technique
Recombinant insect virus can be constructed in the DNA encoding sequence insertion insect viruses genome of specificity, improves insect viruses pair
The insecticide efficiency of host is conducive to the application of insect viruses.Can effectively solve insect wild virus insecticide desinsection speed it is slow,
The narrow problem of insecticidal spectrum, and conotoxin gene expression product is non-toxic to mammal and crustacean or toxicity is atomic
It is weak, securely and reliably.
The third aspect of the present invention provides purposes of the above-described conotoxin polypeptide in pharmaceutical preparation field, institute
Stating drug includes the drug for desinsection.Conotoxin polypeptide of the invention is used as and prepares drug, there is effective pest-resistant work
Property, and highly effective and safe.
According to an embodiment of the invention, above-described on the way, the drug includes biological insecticides.
According to an embodiment of the invention, above-described on the way, the drug includes insect killer.
The fourth aspect of the present invention provides a kind of insecticidal materials, and the insecticidal materials are with the conotoxin polypeptide
For CTx-btg01 as pharmaceutical activity center, the insecticidal materials further include pharmaceutically available excipient or pharmaceutic adjuvant.With
Conotoxin polypeptide CTx-btg01 is prepared into as pharmaceutical activity center, while with pharmaceutically available auxiliary material or excipient
Insecticidal materials meet the needs of different user.
According to an embodiment of the invention, the dosage form of the insecticidal materials includes in pulvis, solution, pill or paste
At least one.Insecticidal materials of the invention are prepared into different dosage forms, can satisfy demand different in agricultural production, and
And according to actual needs, it is designed to different dosage forms, can satisfy the demand of different users.Those skilled in the art can root
According to needs, conotoxin polypeptide CTx-btg01 is prepared into other dosage forms in addition to pulvis, solution, pill or paste.Example
As in practical applications, the effect of sprinkling form can be can be used into conotoxin polypeptide CTx-btg01 building group weight baculoviral
Onto crop.
According to an embodiment of the invention, the insecticidal materials are prepared into independent reagent unit, the reagent unit it is dense
Degree is at least 0.16nM.Insecticidal materials are prepared into individual reagent unit, each reagent unit as an independent packaging,
As desinsection, convenient for packaging and storage, and facilitate according to the amount of polypide itself the amount for determining used insecticidal materials.Example
Such as, the concentration of conotoxin polypeptide can be expanded to the integral multiple of 0.16nM, it can also be on the basis of the concentration of 0.16nM
It is appropriate to increase, to play good insecticidal effect.
The fifth aspect of the present invention provides a kind of pharmaceutical composition, and described pharmaceutical composition includes the conotoxin
Peptide C Tx-btg01.Conotoxin polypeptide CTx-btg01 of the invention and other insecticidal materials are combined, drug is prepared into
Composition can play the purpose of joint desinsection, so that insecticidal effect is highly efficient.
The sixth aspect of the present invention provides a kind of kit, and the kit includes conotoxin polypeptide, the cone shell
Toxin polypeptide is made of 17 amino acid, and the amino acid full length sequence of the conotoxin polypeptide is GGCCSHPACGVNHPELC;
Wherein, the conotoxin polypeptide between left side number, the 3rd amino acid and the 9th amino acid, the 4th amino acid and the 17th
Disulfide bond is respectively formed between a amino acid.By the kit formed by conotoxin polypeptide CTx-btg01, can be answered
Use desinsection field, especially insect desinsection field, it is small to mammalian toxicity, can specific effect in insect, be a kind of tool
There is the kit of important market application value.Those skilled in the art also can according to need processed be prepared into medicine box,
The forms such as pack.It will be understood by those skilled in the art that no matter be machined to kit or medicine box or pack or
Other forms conveniently taken, pharmaceutical activity center are conotoxin polypeptide CTx-btg01, are all contained in model of the invention
Within enclosing.
According to an embodiment of the invention, the kit includes independent reagent unit, the reagent unit includes described
Conotoxin polypeptide, the concentration of conotoxin polypeptide is at least 0.16nM in the reagent unit.Preparation box is prepared into independence
Packaging, each packaging is used as an independent reagent unit, and the concentration of conotoxin polypeptide is at least in each reagent unit
0.16nM convenient for packaging and storage, and facilitates according to the amount of polypide itself the amount for determining used insecticidal materials.Example
Such as, the concentration of conotoxin polypeptide can be expanded to the integral multiple of 0.16nM, it can also be on the basis of the concentration of 0.16nM
It is appropriate to increase, to play good insecticidal effect.
The seventh aspect of the present invention provides the preparation method of conotoxin polypeptide CTx-btg01, the preparation method packet
It includes:
The extraction and enrichment of conotoxin polypeptide;
Separation, mass spectrum sequencing and the sequence of conotoxin polypeptide are chosen;
The renaturation of solid-phase synthesis synthesis polypeptide and synthesis polypeptide.
According to an embodiment of the invention, in method made above, the extraction of the conotoxin polypeptide includes:
Poison pipe to be taken out from barrel-shaped cone shell, is placed in polypeptide extracting solution, mixing centrifuge separation takes supernatant freezing to drain,
Wherein, the polypeptide extracting solution includes the trifluoroacetic acid and protease of 20~40 volume % acetonitriles and 0.1~0.5 volume %
Inhibitor.
According to an embodiment of the invention, in method made above, the separation of the conotoxin polypeptide, mass spectrum sequencing and
Sequence choose include: the obtained conotoxin polypeptide of enrichment is separated using strong cation exchange high performance liquid chromatography, then
Polypeptide Mass Spectrometer Method is carried out using high performance liquid chromatography-mass spectrometry instrument, is counted according to the mass spectrometric data that Mass Spectrometer Method generates
According to parsing and analysis of biological information, the complete amino acid sequence of conotoxin polypeptide is obtained.
According to an embodiment of the invention, in method made above, the renaturation of solid-phase synthesis synthesis polypeptide and synthesis polypeptide
It include: that chemical synthesis process synthesizes its complete sequence, polypeptide is determined using ESI-MS progress molecular weight after synthesis, then by synthesis
Polypeptide carries out renaturation, restores the natural structure for playing active function, the polypeptide of renaturation carries out annealing efficiency detection, then further pure
Polypeptide after changing renaturation.
It is obtained by the present invention to have the beneficial effect that toxin polypeptide of the invention from natural activity Animal resources, belongs to
Biologically active peptide, it is safer, less side effects compared with traditional small-molecule chemical medicine, and selectivity is high, high specificity.Again
Because its structure is simple, be easy for workers to synthesize, acts on the strong beneficial features of ion channel activity, ion channel can be widely applied to
Related disease.The conotoxin has efficient anti-insect activity, and electro physiology confirms, energy specific effect small to mammalian toxicity
In insect, there is significant application value in terms of the biological insecticides of exploitation highly effective and safe.
Additional aspect and advantage of the invention will be set forth in part in the description, and will partially become from the following description
Obviously, or practice through the invention is recognized.
Detailed description of the invention
Above-mentioned and/or additional aspect of the invention and advantage will become from the description of the embodiment in conjunction with the following figures
Obviously and it is readily appreciated that, in which:
Fig. 1 is the mass spectrogram after CTx-btg01 Peptide systhesis.
Fig. 2A is that CTx-btg01 of embodiment of the present invention polypeptide forms the mass spectrogram after 1 pair of disulfide bond.
Fig. 2 B is that CTx-btg01 of embodiment of the present invention polypeptide forms the mass spectrogram after 2 pairs of disulfide bond.
Fig. 3 is the signal that conotoxin polypeptide of embodiment of the present invention CTx-btg01 inhibits sf9 insect cell growth result
Figure.
Fig. 4 is that conotoxin polypeptide of embodiment of the present invention CTx-btg01 illustrates the experiment effect of yellow meal worm injection experiment
Figure.
Fig. 5 is testing result of conotoxin polypeptide of the embodiment of the present invention CTx-btg01 to source of mouse nAChRs different subtype
Figure.
Specific embodiment
The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings.Below with reference to
The embodiment of attached drawing description is exemplary, it is intended to is used to explain the present invention, and is not considered as limiting the invention.
The present invention is by the way that from carnivorism conotoxin gene library and peptide library, screening obtains a kind of efficiently pest-resistant cone shell poison
Element, and there is significant insecticidal effect by experimental verification, drug resistance and the toxicity for being able to solve traditional chemical insecticide are big
Defect, so as to developed as a kind of good biological insecticides use.
According to an embodiment of the invention, the present invention provides a kind of conotoxin polypeptide CTx-btg01, the conotoxin
Polypeptide is made of 17 amino acid, and the amino acid full length sequence of the conotoxin polypeptide is GGCCSHPACGVNHPELC (SEQ
ID NO:1)。
According to an embodiment of the invention, a kind of conotoxin polypeptide CTx-btg01 of the present invention, the conotoxin polypeptide by
17 amino acid compositions, the amino acid full length sequence of the conotoxin polypeptide are GGCCSHPACGVNHPELC, the cone shell poison
Plain polypeptide is distinguished between left side number, the 3rd amino acid and the 9th amino acid, between the 4th amino acid and the 17th amino acid
Disulfide bond is formed, the molecular weight of the conotoxin polypeptide is 1678.92 dalton.
It should be noted that shorthand notation used in amino acid full length sequence of the invention is those skilled in the art
General dummy suffix notation, specifically, G is glycine (Gly), C is cysteine (Cys), and S is serine (Ser), and H is group
Propylhomoserin (His), P are proline (Pro), and A is alanine (Ala), and V is valine (Val), and N is asparagine (Asn), and E is paddy
Propylhomoserin (Glu), L are leucine (Leu).
According to an embodiment of the invention, the present invention also provides a kind of DNA sequence dna, taro described in the DNA sequence encoding
Spiral shell toxin polypeptide CTx-btg01.
According to one embodiment of present invention, the DNA sequence dna is SEQ ID NO:2,
atgttcaccgtgtttctgctggttgtcttggcaaccactgtggtttccttcacttcaggtcgtgcatttcgtggcag
gaatcccgcagccaacgacaaaaggtctgacctggccgctctgagcgtcaggggaggatgctgttcccatcctgcct
gtggcgtgaatcatccagagctttgtggctga;
It is expressed by SEQ ID NO:2 nucleotide sequence and forms precursor peptide, then can formed by modification, shearing mature
Polypeptide, i.e., the conotoxin polypeptide of native form shown in SEQ ID NO:1 in the application.
According to an embodiment of the invention, the DNA sequence dna can be mature peptide sequence identical as SEQ ID NO:2 coding,
That is the arbitrary all DNA sequence of conotoxin polypeptide CTx-btg01 (SEQ ID NO:1GGCCSHPACGVNHPELC).Especially
It is the degeneracy according to codon, after certain nucleotide replace with degenerate codon in SEQ ID NO:2DNA sequence, also wraps
It is contained in the DNA sequence dna of the claimed coding conotoxin polypeptide CTx-btg01.
According to an embodiment of the invention, the DNA sequence dna is SEQ ID NO:3:
ggaggatgctgttcccatcctgcctgtggcgtgaatcatccagagctttgt;
Polypeptide sequence shown in SEQ ID NO:1 can be given expression to as SEQ ID NO:3.Those skilled in the art should manage
Solution, the DNA sequence dna can be the sequence with SEQ ID NO:3 coding phase homopolypeptide.According to an embodiment of the invention, according to
The degeneracy of codon is also contained in after certain nucleotide in SEQ ID NO:3DNA sequence replace with degenerate codon
In the DNA sequence dna of the claimed coding conotoxin polypeptide CTx-btg01.
According to an embodiment of the invention, the present invention also provides conotoxin polypeptide CTx-btg01 in field of pesticides
Application, the insecticide can be biological insecticides, the insecticide may further be insect killer.
The solution of the present invention is explained below in conjunction with embodiment.It will be understood to those of skill in the art that following
Embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Particular technique or item are not specified in embodiment
Part, it described technology or conditions or is carried out according to the literature in the art according to product description.Agents useful for same or instrument
Production firm person is not specified in device, and being can be with conventional products that are commercially available.
The preparation of one conotoxin polypeptide of embodiment
Embodiment according to the present invention one, The present invention gives the specific preparation sides of conotoxin polypeptide CTx-btg01
Method includes the following steps:
1, dissection and Toxic extraction
4 Hainan are produced after barrel-shaped cone shell pounds shell and dissect clip poison pipe, ddH2O is put into 800 μ L pre-cooling after simply rinsing
Extraction buffer (0.1 volume % trifluoroacetic acid, the mixture of 30 volume % acetonitriles and protease inhibitors cocktail), shreds
It is dissolved in Extraction buffer at venom is squeezed out with tweezers after segment, be vortexed concussion, mixes, 4 DEG C of centrifugation 10min of 10000g, supernatant
As Toxic extraction liquid, freezing are drained, then multiple with 8M urea (urea is dissolved in advance in the Tris-HCl of 0.1M, pH 8.5)
It is molten.
2, conotoxin polypeptide is enriched with
Above-mentioned toxin is diluted to 1ml with 8M urea, by Strata-X C18 enrichment standard practice instructions operation, is first used
1ml methanol activate pillar, then plus 1ml 0.1%FA make its balance, toxin sample loading 1ml, buffer (5%ACN+0.1%
FA it) washs, washes repeatedly 3 times, 100%ACN elutes conotoxin polypeptide.
3, it is enriched with polypeptide Quality Control
Enrichment polypeptide molecular weight and concentration are detected by MALDI-TOF-MS, Nanodrop (Thermo Scientific).
MALDI-TOF-MS molecular weight detection range is 700~3500 dalton, and 1 μ L of point sample on plate, after drying plus matrix (is saturated
CHCA), standard items point sample detects after drying.By the measurement standard practice instructions operation of 8000 peptide concentration of Nanodrop, A280
Concentration is surveyed, testing result see the table below (table 1).
Table 1 toxin polypeptide Nanodrop (A280) testing result
Note: T1, T2 are two repetitions.
Two conotoxin polypeptide Sequence Identification of embodiment
1, toxin polypeptide sequencing
The 240 μ g mixed polypeptides for taking one step 2 of above-described embodiment to prepare, carry out group through SCX-HPLC (Shimadzu) system
Separation (table 2), polypeptide strong cation exchange buffer solution A (10mM KH2PO4In 25%ACN, pH 3.5) dilution after upper prop,
Buffer solution B ingredient is the potassium chloride containing 500mM on the basis of buffer solution A, and when separation first uses the linear binary ladder of 0-40%
The buffer solution B of degree is reacted 2 minutes with the flow separation 10min of 1ml per minute, the buffer solution B of concentration 40-90%, concentration 90%
Buffer solution B continue 3 minutes, 214nm carry out absorbance detection, collect 10 fractions altogether by gradient elution.That collects evaporates
Dividing and is dried with SCANVAC concentrating instrument, 0.1% formic acid redissolves, C18 solid-phase extraction column desalination (Strata-X,
Phenomenex), redissolved after the dry concentration of the polypeptide after desalination with 0.1% formic acid of 30 μ l, carry out nanoLC-MS/MS points
Analysis.
The applied sample amount of 2 polypeptide sample of table separation
Sample | Concentration (μ g/ul) | Injection rate (μ g) | Injected slurry volume (μ l) |
T1 | 3.036 | 240 | 80 |
T2 | 2.925 | 240 | 80 |
Note: T1, T2 are two repetitions.
2, nanoLC-MS/MS is analyzed:
LC-MS instrument is using the nano HPLC chromatogram instrument system of Shimadzu and the Triple TOF of AB Sciex
5600 spectrometer systems.The good polypeptide fractions of each pre-separation pass through homemade 12cm long respectively, and 75 μm of internal diameters are filled with partial size
The Ultimate capillary analysis post separation of the Welch Materials brand XB-C18 column material of 3 μm of aperture 120A, flow velocity are
300nl/min.Detection sampling volume is 25 μ l, and gradient uniformly rises to 45% by 40min from 5% for B liquid concentration.Matter
The electron spray voltage of spectrum acquisition is 2.5kV, and auxiliary gas air pressure is 30PSI, and sheath gas air pressure is 15PSI, and source temperature is 150 DEG C.Level-one
Mass spectrographic acquisition uses the high resolution model for being greater than or equal to 30000.The acquisition of second order ms selects parent ion valence state 2
Charge then can continuously do 30 second order ms fragmentations after run-down first mass spectrometric, in this way in 250ms to the range of 5 charges
Scanning of the interior completion to 30 second level music score ions, per second to can produce more than 120 second level spectrums, a total circulation time is
3.3 the second.
3, data are analyzed
It is searched for again with Mascot after the raw mass spectrum data that nanoLC-MS/MS is detected are formatted into MGF
Software carries out data search identification.In obtained polypeptide sequence, analyzing selection full length amino acid sequence by sequence signature is
The CTx-btg01 polypeptide of GGCCSHPACGVNHPELC carries out chemical synthesis.
Three Peptide systhesis of embodiment and renaturation
The chemical synthesis of conotoxin polypeptide: using standard amino acid resin chemical synthetic method synthesize its complete sequence (by
The customization of Shanghai gill biochemistry Synesis Company is completed), polypeptide carries out molecular weight using ESI-MS (electrospray ionization mass spectrometry) after synthesis
It determines (such as Fig. 1).
Chemically synthesized polypeptide primary structure is subjected to branch and pinpoints renaturation, makes disulfide bond by I-III, the connection of II-IV
Mode forms disulfide bond connection, makes to restore the structure that its nature plays active function.Specific refolding method are as follows: use renaturation
Solution (including 0.1M Tris-HCl, the mixture of 0.1M NaCl, 5mM GSH and 0.5mM GSSG, PH 7.4) presses mass body
Product dissolves the polypeptide of synthesis than 1:10, reacts 24~48h under the conditions of 25 DEG C.Polypeptide after the completion of renaturation carries out renaturation with ESI-MS
Efficiency testing (such as Fig. 2A and Fig. 2 B).Then the polypeptide after renaturation being further purified with Strata-X C18 extraction column.
It will be seen from figure 1 that linear peptides (at this time including blocking group) molecular weight of synthesis is 1824.7 dalton;By
After first step oxidative folding, molecular weight reduces 2, is 1822.7 dalton (such as Fig. 2A);By sloughing blocking group and second step
After oxidative folding, molecular weight is 1678.92 dalton (such as Fig. 2 B).
The Activity determination of example IV conotoxin polypeptide
MTT experiment
Using the toxicity of MTT testing inspection conotoxin polypeptide CTx-btg01, the specific steps are as follows:
The Sf9 cell (purchased from Invitrogen company) for taking logarithmic phase to grow, is counted with cell counting board, by every hole
100 μ l are inoculated in 96 orifice plates, and every hole cell quantity control is in (1~10) × 103Between a, 27 DEG C of cultures are pasted completely to cell
After wall, the CTx-btg01 sterling and conotoxin ImI for being separately added into various concentration (0.1nM, 0.5nM, 1.0nM) are as positive
It compares (producer: Wuxi Peptide Biological Technology Co., Ltd.), every group is arranged 3 multiple holes, (is added with the experimental group of without inhibitor
Enter the ddH of same volume2O) make negative control.After cultivating 48h under the conditions of 27 DEG C, 10 μ l MTT (5mg/ml) are added in every hole, after
Continuous culture 4h.Culture solution and MTT in plate are discarded, 100 μ l DMSO are added in every hole, and room temperature low speed shakes 15min.Object to be crystallized is complete
Absorbance value (as shown in Figure 3) after fully dissolved, at enzyme-labeled immunity analyzer measurement 490nm.
Can be seen that conotoxin CTx-btg01 from the result of Fig. 3 has suppression well to the growth of Insect cells Sf9
Effect processed, IC50 0.16nM.And it is compared to commercially available conotoxin ImI, the CTx-btg01 that the present invention is prepared is pure
Product show more excellent inhibitory effect in 0.5nM and 1.0nM.
Insect injection experiment
The yellow meal worm (180mg/ item) between 3 ages and 4 ages is selected, uses chicken feed diet before injecting.Work as in experiment
It by conotoxin ImI (positive control) and CTx-btg01 be dissolved in 0.7% salt water to required concentration (5mM, 10mM and
20mM), it using 0.7% saline solution as negative control (Negative control), is then injected into yellow meal worm respectively.Together
When using the yellow meal worm of any solution of no injection or drug as blank control.Injection uses the high dove micro-syringe in Shanghai (point
End) it is injected, volume injected is 5 μ l, then with left drug in 15 μ l, 0.7% salt water irrigating catheter dead space.
Each concentration does three repetition concentration, and each concentration that repeats is injected into 10 yellow meal worms.Injection is observed after 48h
The yellow meal worm death condition (such as Fig. 4) of ImI, CTx-btg01 and 0.7% salt water.
Fig. 4 abscissa represents ImI, CTx-btg01 processing of various concentration, and ordinate represents lethality.From the result of Fig. 4
As can be seen that conotoxin CTx-btg01 has the effect of killing yellow meal worm well, the insecticidal effect of CTx-btg01 wants excellent
In ImI, the LC50 of conotoxin CTx-btg01 is 11.7nM.And the toxicity of CTx-btg01 has than ImI to mammal
The advantages of small toxicity.
Electro physiology test experience
NAChR (nicotinic acetylcholine receptors, nAChRs) be people most
The receptoroid early found is the ligand-gated ion channel albumen that fast signal transmits between mediating cynapse, in maincenter and periphery
It is widely distributed in nervous system and muscle.The cross-film pentamer that it is made of 5 subunits, is divided into nervous system type and muscularity two is big
Class.Muscularity nAChRs is made of 5 subunits (2 α, 1 β, 1 δ and 1 γ/ε).Nervous system type nAChRs is extremely complex, there is 12 kinds of subunits
(2~α of α 7, α 9, α 10 and 2~β of β 4), it is most of for 2 α subunits and 3 β subunits or 3 α subunits and 2 β subunit compositions one
A heterologous pentamer, and α 7, α 9 may be separately formed functional homologous pentamer, 9 α 10 of α in the presence of no β subunit
Heterologous pentamer can be formed.
The embodiment of the present invention has investigated the interaction between conotoxin CTx-btg01 hypotype each for nAChRs.
Specific experimentation is as follows:
It will be transcribed in vitro comprising the plasmid of nAChR (nAChRs) subunit gene and obtain corresponding cRNA.
It is injected in Xenopus Oocytes after cRNA is mixed by type.Be placed in 17 DEG C, containing culture 3 in anti-ND96 physiological liquid~
5d utilizes the expression of Axon900A Patch Clamp System detection receptor.The conotoxin CTx- for being 10 μm of ol/L by concentration
Btg01 is added in cell slot, investigates the interaction between each hypotype of CTx-btg01 and nAChRs.
Voltage clamp experiments condition: Clamping voltages -70mV, perfusion rate 2ml/min, electrode resistance 0.5~2M Ω, frog's egg exist
In the record time of 1min, the acetylcholine stimulation (as shown in Figure 5) of 2s is given.Wherein, the cone shell that A is 10 μm of ol/L in Fig. 5
For toxin CTx-btg01 for the testing result figure of 3 β of α, 4 type nAChR, B is the conotoxin of 10 μm of ol/L
Testing result figure of the CTx-btg01 for 2 β of α, 3 type nAChR.The result shows that 10 μm of ol/L CTx-btg01
It is only 28% to 3 β 4nAChRs barrier effect of α, and conotoxin CTx-btg01 is disclosed to the food in one's mouth without effect to 2 β 3nAChRs of α
The toxicity of newborn animal is smaller.
To sum up, as can be seen from the above embodiments, toxin polypeptide CTx-btg01 provided by the invention is living as a kind of biology
Property peptide, it is safer, less side effects compared with traditional small-molecule chemical medicine, and selectivity is high, high specificity.And pass through
MTT experiment, insect injection experiment confirm that the conotoxin has efficient anti-insect activity, are confirmed by electro physiology experiment dynamic to lactation
Object small toxicity, energy specific effect have significant application value in insect in terms of the biological insecticides of exploitation highly effective and safe.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means specific features, structure, material or spy described in conjunction with this embodiment or example
Point is included at least one embodiment or example of the invention.In the present specification, schematic expression of the above terms are not
It must be directed to identical embodiment or example.Moreover, particular features, structures, materials, or characteristics described can be in office
It can be combined in any suitable manner in one or more embodiment or examples.In addition, without conflicting with each other, the skill of this field
Art personnel can tie the feature of different embodiments or examples described in this specification and different embodiments or examples
It closes and combines.
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art within the scope of the invention can be to above-mentioned
Embodiment is changed, modifies, replacement and variant.
SEQUENCE LISTING
<110>Hainan Medical College;Shenzhen Hua Da ocean science Co., Ltd;Hua Da ocean research institute, Shenzhen
<120>conotoxin polypeptide CTx-btg01 and its preparation method and application
<130> PIDC3174396
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> PRT
<213>artificial sequence
<400> 1
Gly Gly Cys Cys Ser His Pro Ala Cys Gly Val Asn His Pro Glu Leu
1 5 10 15
Cys
<210> 2
<211> 186
<212> DNA
<213>artificial sequence
<400> 2
atgttcaccg tgtttctgct ggttgtcttg gcaaccactg tggtttcctt cacttcaggt 60
cgtgcatttc gtggcaggaa tcccgcagcc aacgacaaaa ggtctgacct ggccgctctg 120
agcgtcaggg gaggatgctg ttcccatcct gcctgtggcg tgaatcatcc agagctttgt 180
ggctga 186
<210> 3
<211> 51
<212> DNA
<213>artificial sequence
<400> 3
ggaggatgct gttcccatcc tgcctgtggc gtgaatcatc cagagctttg t 51
Claims (10)
1. a kind of conotoxin polypeptide, which is characterized in that the conotoxin polypeptide is made of 17 amino acid, the cone shell poison
The amino acid full length sequence of plain polypeptide is GGCCSHPACGVNHPELC;
Optionally, the conotoxin polypeptide between left side number, the 3rd amino acid and the 9th amino acid, the 4th amino acid
Disulfide bond is respectively formed between the 17th amino acid.
2. a kind of DNA sequence dna, which is characterized in that the DNA sequence encoding conotoxin polypeptide described in claim 1.
3. purposes of the conotoxin polypeptide described in claim 1 in pharmaceutical preparation field, the drug includes being used for desinsection
Drug;
Optionally, the drug includes biological insecticides;
Optionally, the drug includes insect killer.
4. a kind of insecticidal materials, which is characterized in that the insecticidal materials are using conotoxin polypeptide described in claim 1 as medicine
Object activated centre,
The insecticidal materials further include pharmaceutically available excipient or pharmaceutic adjuvant.
5. insecticidal materials according to claim 4, which is characterized in that the dosage form of the insecticidal materials include selected from pulvis,
At least one of solution, pill or paste;
Optionally, the insecticidal materials are prepared into independent reagent unit, and the concentration of the reagent unit is at least 0.16nM.
6. a kind of pharmaceutical composition, which is characterized in that described pharmaceutical composition includes that conotoxin described in claim 1 is more
Peptide.
7. a kind of kit, which is characterized in that the kit includes conotoxin polypeptide described in claim 1;
Optionally, the kit includes independent reagent unit, and the reagent unit includes the conotoxin polypeptide, described
The concentration of conotoxin polypeptide is at least 0.16nM in reagent unit.
8. the preparation method of conotoxin polypeptide described in claim 1, which is characterized in that the preparation method includes:
The extraction and enrichment of conotoxin polypeptide;
Separation, mass spectrum sequencing and the sequence of conotoxin polypeptide are chosen;
The renaturation of solid-phase synthesis synthesis polypeptide and synthesis polypeptide.
9. preparation method according to claim 8, which is characterized in that the extraction of the conotoxin polypeptide includes:
Poison pipe is taken out from barrel-shaped cone shell, is placed in polypeptide extracting solution, and mixing centrifuge separation takes supernatant freezing to drain, wherein
The polypeptide extracting solution includes that the trifluoroacetic acid of 20~40 volume % acetonitriles and 0.1~0.5 volume % and protease inhibit
Agent.
10. preparation method according to claim 8 or claim 9, which is characterized in that the separation of the conotoxin polypeptide, mass spectrum
Sequencing and sequence are chosen the conotoxin polypeptide for including: to obtain enrichment and are carried out using strong cation exchange high performance liquid chromatography
Separation, then polypeptide Mass Spectrometer Method is carried out using high performance liquid chromatography-mass spectrometry instrument, the mass spectrometric data generated according to Mass Spectrometer Method
Data parsing and analysis of biological information are carried out, the complete amino acid sequence of conotoxin polypeptide is obtained;
Optionally, the renaturation of the solid-phase synthesis synthesis polypeptide and synthesis polypeptide includes: that chemical synthesis process synthesizes its total order
Column, polypeptide is determined using ESI-MS progress molecular weight after synthesis, and the polypeptide of synthesis is then carried out renaturation, restores natural activity
The polypeptide of the structure of effect, renaturation carries out annealing efficiency detection, the polypeptide after renaturation is then further purified.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711384611.0A CN109942691A (en) | 2017-12-20 | 2017-12-20 | Conotoxin polypeptide CTx-btg01 and its preparation method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711384611.0A CN109942691A (en) | 2017-12-20 | 2017-12-20 | Conotoxin polypeptide CTx-btg01 and its preparation method and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109942691A true CN109942691A (en) | 2019-06-28 |
Family
ID=67005122
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201711384611.0A Withdrawn CN109942691A (en) | 2017-12-20 | 2017-12-20 | Conotoxin polypeptide CTx-btg01 and its preparation method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109942691A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113735953A (en) * | 2021-07-06 | 2021-12-03 | 海南医学院 | Sea anemone polypeptide toxin Ap-GT as well as preparation method and application thereof |
CN115850427A (en) * | 2022-12-09 | 2023-03-28 | 广东大百汇海洋科技集团有限公司 | Conus double-alpha-helix antibacterial peptide, preparation method and application thereof |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5885780A (en) * | 1991-07-19 | 1999-03-23 | University Of Utah | Method of obtaining small conformationally rigid conopeptides |
CN103483439A (en) * | 2012-06-15 | 2014-01-01 | 海南大学 | Alpha O-superfamily conotoxin peptide, and medicinal composition and use thereof |
US20150299276A1 (en) * | 2012-08-07 | 2015-10-22 | Hainan University | Alpha-CONOTOXIN PEPTIDE, PHARMACEUTICAL COMPOSITION AND USE THEREOF |
CN106795207A (en) * | 2014-09-30 | 2017-05-31 | 深圳华大基因科技有限公司 | Conotoxin polypeptide κ CPTx bt105, its preparation method and application |
CN107074909A (en) * | 2014-09-30 | 2017-08-18 | 深圳华大基因科技有限公司 | Conotoxin polypeptide κ CPTx btl01, its preparation method and application |
CN107108695A (en) * | 2014-12-26 | 2017-08-29 | 深圳华大基因研究院 | Conotoxin peptide κ CPTx btl01, its preparation method and application |
-
2017
- 2017-12-20 CN CN201711384611.0A patent/CN109942691A/en not_active Withdrawn
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5885780A (en) * | 1991-07-19 | 1999-03-23 | University Of Utah | Method of obtaining small conformationally rigid conopeptides |
CN103483439A (en) * | 2012-06-15 | 2014-01-01 | 海南大学 | Alpha O-superfamily conotoxin peptide, and medicinal composition and use thereof |
US20150299276A1 (en) * | 2012-08-07 | 2015-10-22 | Hainan University | Alpha-CONOTOXIN PEPTIDE, PHARMACEUTICAL COMPOSITION AND USE THEREOF |
CN106795207A (en) * | 2014-09-30 | 2017-05-31 | 深圳华大基因科技有限公司 | Conotoxin polypeptide κ CPTx bt105, its preparation method and application |
CN107074909A (en) * | 2014-09-30 | 2017-08-18 | 深圳华大基因科技有限公司 | Conotoxin polypeptide κ CPTx btl01, its preparation method and application |
CN107108695A (en) * | 2014-12-26 | 2017-08-29 | 深圳华大基因研究院 | Conotoxin peptide κ CPTx btl01, its preparation method and application |
Non-Patent Citations (3)
Title |
---|
BINGMIAO GAO等: "Screening and Validation of Highly-Efficient Insecticidal Conotoxins from a Transcriptome-Based Dataset of Chinese Tubular Cone Snail", 《TOXINS》 * |
CHAO PENG等: "High-throughput identification of novel conotoxins from the Chinese tubular cone snail (Conus betulinus) by multi-transcriptome sequencing", 《GIGASCIENCE》 * |
冯桂学: "中国南海三种芋螺毒素的分离及鉴定", 《中国优秀博硕士学位论文全文数据库(硕士) 基础科学辑》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113735953A (en) * | 2021-07-06 | 2021-12-03 | 海南医学院 | Sea anemone polypeptide toxin Ap-GT as well as preparation method and application thereof |
CN113735953B (en) * | 2021-07-06 | 2023-04-14 | 海南医学院 | Sea anemone polypeptide toxin Ap-GT as well as preparation method and application thereof |
CN115850427A (en) * | 2022-12-09 | 2023-03-28 | 广东大百汇海洋科技集团有限公司 | Conus double-alpha-helix antibacterial peptide, preparation method and application thereof |
CN115850427B (en) * | 2022-12-09 | 2023-09-01 | 广东大百汇海洋科技集团有限公司 | Conus double-alpha helix antibacterial peptide, preparation method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Daly et al. | Discovery, structure and biological activities of cyclotides | |
Nguyen et al. | Novel cyclotides and uncyclotides with highly shortened precursors from Chassalia chartacea and effects of methionine oxidation on bioactivities | |
Dias et al. | Peptidome profiling of venom from the social wasp Polybia paulista | |
PT2132221E (en) | Template-fixed peptidomimetics | |
Ojeda et al. | Pharmaceutical applications of cyclotides | |
Narayani et al. | Production of bioactive cyclotides: A comprehensive overview | |
CN109942691A (en) | Conotoxin polypeptide CTx-btg01 and its preparation method and application | |
Fernandez-Bobey et al. | Cytotoxic cyclotides from Anchietea pyrifolia, a South American plant species | |
Ha et al. | Isolation and structure determination of a paralytic peptide from the hemolymph of the silkworm, Bombyx mori | |
CN109942690A (en) | Conotoxin polypeptide CTx-btg02 and its preparation method and application | |
Attah et al. | Detection of cysteine-rich peptides in Tragia benthamii Baker (Euphorbiaceae) and in vivo antiinflammatory effect in a chick model | |
CN107001416B (en) | Conotoxin kappa-CPTx-btl 04, and preparation method and application thereof | |
Göransson et al. | Cyclotides in the Violaceae | |
Zhang et al. | A survey of the venom of the spider Lycosa vittata by biochemical, pharmacological and transcriptomic analyses | |
Gowd et al. | Novel peptides of therapeutic promise from Indian Conidae | |
CN113735953B (en) | Sea anemone polypeptide toxin Ap-GT as well as preparation method and application thereof | |
Stöcklin et al. | Structural identification by mass spectrometry of a novel antimicrobial peptide from the venom of the solitary bee Osmia rufa (Hymenoptera: Megachilidae) | |
Boghozian et al. | Toxicity and protein composition of venoms of Hottentotta saulcyi, Hottentotta schach and Androctonus crassicauda, three scorpion species collected in Iran | |
Li et al. | Positive allelopathic stimulation and underlying molecular mechanism of achyranthe under continuous monoculture | |
CN107001433B (en) | Conotoxin kappa-CPTx-btl 03, and preparation method and application thereof | |
CN107001421B (en) | Conotoxin kappa-CPTx-btl 02, and preparation method and application thereof | |
Li et al. | A comparative study of the molecular composition and electrophysiological activity of the venoms from two fishing spiders Dolomedes mizhoanus and Dolomedes sulfurous | |
CN107074909B (en) | Conotoxin polypeptide kappa-CPTx-btl 01, and preparation method and application thereof | |
CN107531756B (en) | Two conotoxin peptides, preparation method and application thereof | |
CN107074920A (en) | Conotoxin polypeptide κ CPTx btl03, its preparation method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190628 |