CN109929915A - Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) - Google Patents
Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) Download PDFInfo
- Publication number
- CN109929915A CN109929915A CN201711347493.6A CN201711347493A CN109929915A CN 109929915 A CN109929915 A CN 109929915A CN 201711347493 A CN201711347493 A CN 201711347493A CN 109929915 A CN109929915 A CN 109929915A
- Authority
- CN
- China
- Prior art keywords
- tshr
- pcr
- mrna
- hormone receptors
- thyroid hormone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention is a kind of Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method).Pass through the method for RT-PCR, mRNA reverse transcription in sample is obtained into corresponding cDNA, the specific primer and probe of this kit is recycled, in conjunction with real-time fluorescence quantitative PCR detection technique, can accurately detect the expression quantity of Thyroid Hormone Receptors in sample (TSHR) mRNA.Such detection method can the expression of the peripheral blood to tumor patient and Thyroid Hormone Receptors (TSHR) mRNA in Zhong Liu Zu Zhi ﹑ marrow equal samples carry out quantitative analysis, clinically can be to the therapeutic effect of auxiliary diagnosis and evaluation prognosis.The present invention, come guiding clinical treatment, has certain clinical value by the medicine detection means in molecules.
Description
Technical field:
The invention belongs to biotechnology people fields, to obtain cDNA by reverse transcription (RT) mRNA sample, now in conjunction with real-time
Fluorescent quantitative PCR technique can detect the reagent of human thyroid stimulator's receptor (TSHR) mrna expression amount in sample with accurate quantification
Box.
Background technique:
Now, thyroid cancer is still the significant threat of human health.At present, operation excision, chemotherapy, radiotherapy and endocrine
Treatment is still the main method for the treatment of of thyroid carcinoma.While above-mentioned technology has reached quite mature and universal, Gao Fu
Hair and the rate of transform are also still the main problem that thyroid cancer patients face, the effective life cycle of the appearance of these problems to patient
Important influence is played, the postoperative quality of life of tumor patient is seriously endangered.So how in postoperative its tumour of detection of patient
Recurrence and translated into the research topic of numerous scholars.After 2000, many scholars lead molecular biology in research
Domain is applied in human health project, so far more than ten years, and the vitro detection technology developed therefrom is also continuous mature
In improving.Wherein TaqMan quantitative fluorescent PCR is exactly one such vitro diagnostic techniques.
Since TaqMan quantitative fluorescent PCR has reproducible, as a result accurate and reliable feature, so in medicine detection side
The problem of face, some common detection methods cann't be solved, can be solved with this.In general cytomorphology inspection can be direct
It observes tumour cell, but is only limitted to the pathological examination of tissue.Due to tumour small, this inspection that drops to the number in blood circulation
The sensibility and specificity looked into is poor, and positive rate is only 1%.The immunohistochemical method in later period improves recall rate, but
Technology production is complicated, and needs the antibody of specificity, and false positive rate is also high.TaqMan quantitative fluorescent PCR and these skills
Art is compared, and has clear advantage, is synthesized due to the transcribed specific mrna of some tumours, but without corresponding albumen, therefore fluorescence is fixed
It is extensive compared with albumen to measure PCR application range；In addition only it is to be understood that testing gene sequence, it is inverse can to design the progress of synthetic primer probe
Transcription and amplification, it is easy to operate；This method sensitivity with higher and repeatability simultaneously, ensure that results from medical tests
Accuracy.
By taking Thyroid Hormone Receptors (TSHR) mRNA detection as an example, Thyroid Hormone Receptors (TSHR) mRNA is thyroid cancer
Specificity biomarker, be the higher tumor associated antigen of primary thyroid carcinoma specificity, in healthy human peripheral blood
It can't detect Thyroid Hormone Receptors (TSHR) mRNA in cell, and in the thyroid cancer patients for recurring and shifting, if cancer
Cell detachment can detect in blood.At the same time, TaqMan fluorescent quantitative PCR technique have good sensitivity and
Specificity, targetedly to the Thyroid Hormone Receptors in thyroid cancer patients peripheral blood and Zhong Liu Zu Zhi ﹑ marrow equal samples
(TSHR) expression of mRNA is detected, and can the diagnosis such as thyroid carcinoma cell hematogenous spread be provided with important foundation.Institute
With the application of the technology, it will find the tumour cell in thyroid cancer patients blood circulation to early stage, find small outside thyroid gland
Transfer generates particularly important effect for guiding clinical treatment, improvement patient's prognosis.
Summary of the invention:
The present invention is a kind of Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe
Method), contain 4 kinds of components, is respectively as follows: One step RT-PCR reaction solution (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), feminine gender
Reference substance (50 μ L/ pipe), 2 × 106Copies/ μ l standard items (20 μ L/ pipe) main ingredient composition.
Water, reverse transcriptase, Taq enzyme containing DEPC processing in One step RT-PCR reaction solution, dNTPs, RT-PCR buffering
Liquid, oligomerization (dT)15-18、MgCL2(3mM), detection are visited with upstream primer (0.2 μM), detection with downstream primer (0.2 μM), fluorescence
Needle (0.3 μM), in which:
Detection upstream primer sequence are as follows: 5 '-CGGAGGATGGAGAAATAG -3 '
Detection downstream primer sequence are as follows: 5 '-CGTTGAATATCCTTGCAG -3 '
Fluorescence probe sequence: the 5 '-FAM-standard items sequence of CTGAAGTCCTCCTCCTGATGGC-TAMRA -3 ':
CGGAGGATGGAGAAATAGCCCCGAGTCCCGTGGAAAATGAGGCCGGCGGA
CTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGCGGAA
TGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGA GTCACCTGCAAGGATATTCAACG
Quality-control product is divided into positive reference substance and negative controls, and positive reference substance is to have Thyroid Hormone Receptors (TSHR)
The RNA sample of mRNA, negative controls are the RNA sample of athyreosis hormone receptor (TSHR) mRNA.
2×106Copies/ μ l standard items are the plasmid containing standard amplification sequence.
- 20 DEG C of freezen protectives of this kit, validity period are 6 months, and multigelation should be avoided.
The present invention establishes the method using TaqMan technology detection Thyroid Hormone Receptors (TSHR) expression, and through detecting
Patient's sample shows that this method is practical.Since this method uses real-time fluorescent PCR amplification technology, to outside Freshman
Total serum IgE is extracted in all blood and carries out reverse transcription, then with the specific primer of Thyroid Hormone Receptors (TSHR) mRNA and special
Property fluorescence probe, be equipped with PCR buffer, hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomers (dGTP, dATP, dCTP,
The ingredients such as dTTP), using the expression of real-time fluorescent PCR technology detection human peripheral Thyroid Hormone Receptors (TSHR) mRNA nucleic acid
Amount provides important foundation with the presence or absence of hematogenous spread to the tumour cell of primary thyroid carcinoma patient.
The application method of kit of the present invention:
Detection should set up positive and negative control every time.
One, Preparatory work of experiment
Total serum IgE in human peripheral is extracted, -20 DEG C save backup.
Two .RT-PCR
RNA initial denaturation: total rna solution being placed in 70 DEG C of water-baths and keeps the temperature 5 minutes, is placed rapidly after taking-up on ice, spare.
Reverse transcription system is prepared by table 1:
Table 1
PCR reaction tube is put into instrument sample slot.(instrument concrete operation method is carried out according to respective operation instructions)
RT-PCR reaction condition: 1) 40 DEG C 30 minutes；2) 95 DEG C 5 minutes；3) 95 DEG C 15 seconds → 60 DEG C 1 minute, 45 are followed
Ring.
Three, the amplification of standard items and reference substance
Take 2 × 10610 μ l of copies/ μ l standard items is 2 × 10 with deionized water gradient dilution5, 2 × 104, 2 × 103,
2×102, 2 × 101Copies/ μ l, together with 2 × 106Copies/ μ l standard items totally 6 concentration, respectively taking 5 μ l is template (other
Component is with table 1) PCR amplification is carried out together with sample to be tested, to draw standard curve.
Four, result judgement: the critical value that the positive of this kit judges is 102Copies/ml (whole blood copy number).
Detailed description of the invention: Fig. 1 is real-time fluorescence quantitative RT-PCR standard items testing result, and Fig. 2 is real time fluorescent quantitative RT-
PCR standard curve.
Specific embodiment
The present invention is described further with reference to the drawings and specific embodiments, it should be appreciated that these embodiments are merely to illustrate mesh
, without limiting the scope of the invention.
Embodiment 1 Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) detection
The application of the expression of TSHR-mRNA
One, material:
Reagent constituents material source: the RT-PCR buffer components in One step RT-PCR reaction solution are purchased from TAKARA
Company, detection probe, primer are synthesized by TAKARA company；The water of DEPC processing is self-control； 2×106Copies/ μ l standard items
To there is the plasmid solution of purpose segment；Positive reference substance is the RNA sample for having Thyroid Hormone Receptors (TSHR) mRNA, negative right
The RNA sample for being athyreosis hormone receptor (TSHR) mRNA according to product.
Two, instrument and equipment:
ABI7300 fluorescence quantitative PCR instrument
Three, primer and probe design and synthesis:
With Thyroid Hormone Receptors (TSHR) mRNA sequence (GenBank accession number: NM_001018036.2) for template, make
TaqMan primer and probe site is analyzed with 7300 type real-time fluorescence quantitative PCR instrument accompanying software of ABI, while considering thyroid gland
Hormone receptor (TSHR) mRNA genomic dna sequence situation, therefrom selects optimal combination.Primer and probe is closed by TAKARA company
At.The recombinant plasmid containing target gene in standard solution is by Bai Aosi biosynthesis.
Detection upstream primer sequence are as follows: 5 '-CGGAGGATGGAGAAATAG -3 '
Detection downstream primer sequence are as follows: 5 '-CGTTGAATATCCTTGCAG -3 '
Fluorescence probe sequence: 5 '-FAM-CTGAAGTCCTCCTCCTGATGGC-TAMRA -3 ' four, standard items preparation
Standard items are synthesized by the raw work in Shanghai, are then inserted into pCR2.1 cloning vector with cloning system, and positive colony is passed through
Sequence verification.Recycling is standard items after I digestion of EcoR, measures concentration and is converted into (copy number/volume).Five, experimental result
Through being sequenced, above-mentioned design standard product are consistent with expection completely, following (including the both ends of the standard items fragment sequence of recycling
I site EcoR):
GAATTCCGGAGGATGGAGAAATAGCCCCGAGTCCCGTGGAAAATGAGGCC
GGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGG
GCGGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGAC
TTCAGAGTCACCTGCAAGGATATTCAACG GAATTC
Embodiment 2 Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) faces
Bed application
One, samples sources
It is experimental group that 42, which are thyroid cancer patients through pathological diagnosis, wherein 28 for pathological diagnosis occurred lymph node or
Far-end transfer, 14 lymph node or far-end transfer do not occur for pathological diagnosis；20 Healthy Peoples and 24 benign thyroid diseases
(thyroid gland inflammation 10, hyperthyroidism 8, Thyroid Gland Swell 6) are control group.
Two, pattern detection:
It is sample that each subject, which takes the fresh anticoagulation cirumferential blood of 5ml, and through method appropriate, extracting takes the total serum IgE in sample.
Fluorescence quantitative RT-RCR amplification, RT-PCR reaction condition: 1) 40 DEG C 30 minutes are carried out using reagent of the invention；2) 95 DEG C 5 points
Clock；3) 95 DEG C 15 seconds → 60 DEG C 1 minute, 45 circulations.Simultaneously plus standard items and positive and negative reference substance, standard items are used to make
Standard curve.As a result calculate detection sample Thyroid Hormone Receptors (TSHR) mRNA's according to standard curve after instrument is handled
Content.
Three, pattern detection result
Standard items testing result is referring to Fig. 1, and standard curve is referring to fig. 2.
2 86 clinical case Thyroid Hormone Receptors (TSHR) mRNA copy number testing results of table
The results showed that the peripheral blood testing result positive rate of 42 thyroid cancer patients of experimental group reach 85% with
On, and 20 Healthy Peoples of control group and 24 thyroid diseases (6 Thyroid Gland Swells, 8 hyperthyroidisms, 10 thyroid gland inflammation)
In in addition to the detection of 1 thyroid gland inflammatory patients is positive, remaining is detected as feminine gender.
The above results show that kit of the invention can carry out more the amount of Thyroid Hormone Receptors (TSHR) mRNA
Accurate qualitative and quantitative analysis.
CGGAGGATGGAGAAATAGCCCCGAGTCCCGTGGAAAATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGC
TCGACCTGCCCAGGGACCTGGGCGGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGA
GTCACCTGCAAGGATATTCAACG
Claims (2)
1. the present invention is a kind of Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method),
Containing 4 kinds of components, it is respectively as follows: One step RT-PCR reaction solution (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), negative control
Product (50 μ L/ pipe), 2 × 106Copies/ μ l standard items (20 μ L/ pipe) main ingredient composition；
(1) water containing DEPC processing in One step RT-PCR reaction solution, reverse transcriptase, Taq enzyme, dNTPs, RT-PCR buffering
Liquid, oligomerization (dT)15-18、MgCL2(3mM), detection are visited with upstream primer (0.2 μM), detection with downstream primer (0.2 μM), fluorescence
Needle (0.3 μM)；
(2) reagent of the invention contains special primer, probe sequence and standard items sequence:
Detection upstream primer sequence are as follows: 5 '-CGGAGGATGGAGAAATAG -3 ',
Detection downstream primer sequence are as follows: 5 '-CGTTGAATATCCTTGCAG -3 ',
Fluorescence probe sequence: 5 '-FAM-CTGAAGTCCTCCTCCTGATGGC-TAMRA -3 '；
(3) quality-control product is divided into positive reference substance and negative controls, and positive reference substance is to have Thyroid Hormone Receptors (TSHR)
The RNA sample of mRNA, negative controls are the RNA sample of athyreosis hormone receptor (TSHR) mRNA；
(4) 2 × 106Copies/ μ l standard items are the plasmid containing standard amplification sequence, standard items sequence are as follows:
CGGAGGATGGAGAAATAGCCCCGAGTCCCGTGGAAAATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGA
CCTGCCCAGGGACCTGGGCGGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCA
CCTGCAAGGATATTCAACG。
2. Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence according to claim 1
Sonde method), it is characterized in that: kit specification of the present invention is 10 person-portions/box；The amount of each component in every box are as follows: One step RT-PCR
Reaction solution (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), negative controls (50 μ L/ pipe), 2 × 106Copies/ μ l standard
Product (20 μ L/ pipe).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711347493.6A CN109929915A (en) | 2017-12-15 | 2017-12-15 | Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711347493.6A CN109929915A (en) | 2017-12-15 | 2017-12-15 | Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109929915A true CN109929915A (en) | 2019-06-25 |
Family
ID=66979720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711347493.6A Pending CN109929915A (en) | 2017-12-15 | 2017-12-15 | Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109929915A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150132295A1 (en) * | 2013-11-12 | 2015-05-14 | Population Diagnostics Inc. | Methods and compositions for diagnosing, prognosing, and treating endometriosis |
| CN106636418A (en) * | 2016-12-30 | 2017-05-10 | 河北德路通生物科技有限公司 | Kit for detecting TSHR (thyroid stimulating hormone receptor) gene mRNA expression through fluorescence quantitation RT-PCR (real-time polymerase chain reaction) and use method of kit |
-
2017
- 2017-12-15 CN CN201711347493.6A patent/CN109929915A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150132295A1 (en) * | 2013-11-12 | 2015-05-14 | Population Diagnostics Inc. | Methods and compositions for diagnosing, prognosing, and treating endometriosis |
| CN106636418A (en) * | 2016-12-30 | 2017-05-10 | 河北德路通生物科技有限公司 | Kit for detecting TSHR (thyroid stimulating hormone receptor) gene mRNA expression through fluorescence quantitation RT-PCR (real-time polymerase chain reaction) and use method of kit |
Non-Patent Citations (2)
| Title |
|---|
| 姜威等: ""血液TSHR-mRNA作为分子肿瘤标志物在甲状腺癌诊断中的应用"", 《医学与哲学》 * |
| 彭瑞云等: "《现代实验病理技术》", 31 August 2012, 军事医学科学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | CircRNA circ_0067934 overexpression correlates with poor prognosis and promotes thyroid carcinoma progression | |
| Devis et al. | Activated leukocyte cell adhesion molecule (ALCAM) is a marker of recurrence and promotes cell migration, invasion, and metastasis in early‐stage endometrioid endometrial cancer | |
| US20130143753A1 (en) | Methods for predicting outcome of breast cancer, and/or risk of relapse, response or survival of a patient suffering therefrom | |
| Shui et al. | Hormone receptor and human epidermal growth factor receptor 2 detection in invasive breast carcinoma: a retrospective study of 12,467 patients from 19 Chinese representative clinical centers | |
| Puliani et al. | NETest: a systematic review focusing on the prognostic and predictive role | |
| Qin et al. | LncRNA HCP5: a potential biomarker for diagnosing gastric cancer | |
| Song et al. | Combined detection of HER2, Ki67, and GSTP1 genes on the diagnosis and prognosis of breast cancer | |
| Uemura et al. | Hypoxia-inducible adrenomedullin in colorectal cancer | |
| Li et al. | The increase of miR-27a affects the role of cisplatin on proliferation and migration capacities of liver cancer cells. | |
| CN105296481B (en) | A kind of method of the HLA B27 Genotypings based on gene sequencing method | |
| Kaira et al. | 18F-FDG uptake on PET in primary mediastinal non-thymic neoplasm: a clinicopathological study | |
| Peng et al. | The role of circulating microRNAs for the diagnosis of hepatitis B virus-associated hepatocellular carcinoma with low alpha-fetoprotein level: a systematic review and meta-analysis | |
| Qiu et al. | Analysis on expression level and diagnostic value of miR-19 and miR-21 in peripheral blood of patients with undifferentiated lung cancer | |
| JP7187081B2 (en) | Methods for early diagnosis and post-treatment monitoring of breast cancer using liquid biopsy multiplex oncogene biomarkers | |
| Li et al. | CXCR4 expression in bladder transitional cell carcinoma and its relationship with clinicopathological features | |
| Previs et al. | Evaluation of in vitro chemoresponse profiles in women with Type I and Type II epithelial ovarian cancers: An observational study ancillary analysis | |
| Limpakan et al. | Interleukin-8 associated with chemosensitivity and poor chemotherapeutic response to gastric cancer | |
| CN110331208A (en) | Application of the molecular target in adenocarcinoma of lung Combining diagnosis | |
| CN109929915A (en) | Thyroid Hormone Receptors (TSHR) mRNA nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| CN109957609A (en) | Utilize the kit of PCR- fluorescence probe method detection 155 nucleic acid quantification of MicroRNA | |
| CN109929921A (en) | MicroRNA 21 (MIR21) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| Torresan et al. | Liquid biopsy in colorectal cancer: onward and upward | |
| CN107815494A (en) | Detect method, kit and the oligonucleotides of PCM1 JAK2 relative expression quantities | |
| CN1410761A (en) | Real time fluorescent quantitative RT-PCR detecting human cell keratin 19 reagent box | |
| Chen et al. | Super-ARMS: A new method for plasma ESR1 mutation detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190625 |
|
| WD01 | Invention patent application deemed withdrawn after publication |