CN109880909A - Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder - Google Patents
Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder Download PDFInfo
- Publication number
- CN109880909A CN109880909A CN201910283065.4A CN201910283065A CN109880909A CN 109880909 A CN109880909 A CN 109880909A CN 201910283065 A CN201910283065 A CN 201910283065A CN 109880909 A CN109880909 A CN 109880909A
- Authority
- CN
- China
- Prior art keywords
- room temperature
- mirna
- urine
- diagnosis
- adsorption column
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
For the urine Microrna target gene database compare-value model method for building up of Diagnosis of Bladder, method and step are as follows: model data information collection；Urine specimen is collected and is saved；The preparation of total serum IgE in sample；The synthesis of first chain cDNA sequence；Fluorescence quantitative PCR detection；Ratio (the Ct of miRNA testing result Ct182‑5p/Ct 152‑3p) it is used as diagnosis index.More reliable judgment basis can be provided with bladder cancer early screening provided by the present invention for urine Microrna compare-value model, the kit of bladder cancer early screening, pass through the objective indicator of the compare-value model of miR-182-5p and miR-152-3p, overall merit is carried out with other tumour early screening markers, improve accuracy rate of diagnosis, Cultivation process plays significant role in bladder cancer diagnosis and treatment.
Description
Technical field
The present invention relates to medicine technology field more particularly to a kind of urine Microrna target base for for Diagnosis of Bladder
Because of database compare-value model method for building up.
Background technique
Bladder cancer is one of most common cancer in the world, and survival rate is low and DISTANT METASTASES IN is frequent.In general, bladder cancer is examined
It is disconnected to need intrusive cystoscopy and biopsy, generally entail adverse reaction and artificial inconvenience.Currently used for
The method sensitivity range of clinical diagnosis bladder cancer is 57-82% to 74-88%, with the stage of cancer and the increase of degree,
Sensitivity also will increase.Urine cytology is also being widely used as non-invasive labelling technique, but is easy missing inspection inferior grade
Bladder cancer.As tumorigenesis, treatment related mechanism is further described in the development of molecular level, there is an urgent need to
Exploitation is for the initial diagnosis of BC and the new diagnostic methods of monitoring.Liquid biopsy identifies the life in urinary system malignant tumour
Object marker Recent study is more, and the marker based on DNA and RNA target gene database exists in body fluid (such as blood and urine)
It is promising potential marker in terms of diagnosis, prognosis, prediction and monitoring urinary system malignant tumour.Therefore, non-invasive, Gao Ling
Sensitivity, the diagnostic techniques based on urine are the emphasis of the art research from now on.
Microrna (miRNA) is a kind of non-coding RNA with adjusting function, and the gene of coding miRNA is likely located at
Functional gene code area, noncoding region, possible cluster expression or independent expression.The single-stranded small molecule of this body endogenous expression
RNA is located at Genome noncoding regions, has well-conserved, timing and tissue specificity.MiRNA is widely present in various
In eukaryocyte, any protein is not encoded, and length is only 20~24nt.There is a phosphate group at the mature end miRNA 5 ',
3 ' hold as hydroxyl, are formed after the processing of Dicer enzyme by the single stranded RNA precursor of about 70~90nt with hairpin like fold.At
Ripe miRNA forms gene silencing complex (RNA-induced silencing complex, the RISC) effect of RNA induction
Expression in target spot mRNA, by the way that its translation process and controlling gene are sheared or inhibited to mRNA.MiRNA is as bioelectric detecting point
Son can serve as oncogene or tumor suppressor, and the abnormal expression in tumour, this expression pattern can be used as miRNA
Early diagnosis of tumor or a kind of marker by stages.
In recent years, about the existing many reports of the relationship research between miRNA and tumour, clear miRNA, which has had, is adjusted
Save the functions such as tumor cell proliferation, apoptosis, vascularization, metabolism and drug resistance.Researches show that miRNA liver cancer, colorectal cancer,
Breast cancer, non-tiny cell lung cancer etc. have diagnostic value.It can be found that reflection bladder in the urine sample of bladder cancer patients
The Microrna of cancer characteristic.They can be extracted from a variety of biological samples, such as blood plasma, urine, excrement or biopsy sample
Product, and it is usually stable and various conditions of storage can be resisted.High sensitivity can be used and standardized technology is non-
The variation of miRNA is detected invasively and is quantified in body fluid.MiRNA is diagnosis, the molecular marker of prognosis and Clinical Follow-up
Good candidate, discovery and the relevant miRNA marker of screening bladder cancer from the urine of bladder cancer patients establish diagnosis side
Method has great importance and is worth to early diagnosis bladder cancer.
Summary of the invention
The purpose of the present invention is to provide a kind of urine Microrna compare-value model method for building up, are established by this method
Model has very high reference and application value for the diagnosis of bladder cancer.
Present invention discover that each sample is standardized according to the content of U6 in urine specimen, further detection discovery
Relative to normal population urine specimen, miR-182-5p Ct value mixes differential expression in urine specimen in bladder cancer, has statistics
Learn meaning.MiR-152-3p expression is stablized, not statistically significant between group.The differential expression situation of miRNA can be used in urine
As bladder cancer distinctive mark object, it can predict that a situation arises for bladder cancer, establish a kind of metering method, bladder cancer can be done
It diagnoses out.
Realize the technical solution of the object of the invention are as follows: the urine Microrna target gene database ratio for Diagnosis of Bladder
It is worth method for establishing model, steps are as follows for the method for building up of the compare-value model:
(1) model data information collection: acquisition has-miR-182-5p is related in miRBase database to has-miR-152-3p
Information；
(2) urine specimen is collected and saved: the collection of sample uses the sterile no enzyme centrifuge tube of 15ml, collects urina sanguinis freshly voided urine
7ml, wherein 3.54g guanidinium isothiocyanate (sigma) is added, completely rear be added HEPES salting liquid (Thermo) to be dissolved adjusts urine
The pH value of liquid sample is finally settled to total volume 10ml, HEPES concentration is 0.5 mol/l, guanidinium isothiocyanate concentration at this time to 7
For 3mol/l, sample saves under the conditions of being unified in -80 DEG C；
(3) in sample total serum IgE preparation:
A. the urine specimen of collection is thawed, sufficiently mixed fortune cracks 5 minutes at room temperature；
B. 5ml chloroform is added, acutely shakes, after solution forms layering after room temperature is static, 12000rpm is centrifuged 15 points under the conditions of 4 DEG C
Clock, mixing liquid is layered as lower layer's phenol chloroform phase after centrifugation, and middle layer albumin layer, upper layer colourless aqueous phase, RNA is all assigned and water
Xiang Zhong；
C. the volume for measuring transfer liquid is slowly added to the dehydrated alcohol of transfer liquid 1/3 volume of product (such as: the transfer liquid of 300 μ l
Add 100 μ l dehydrated alcohols), (at this time it is possible that precipitating) is mixed, obtained solution and precipitating are transferred to adsorption column together
MiRspin is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, adsorption column miRspin is discarded after centrifugation, retains
Efflux；
D. the volume for measuring efflux, the dehydrated alcohol for being slowly added to 2/3 volume of effluent volume mix.By obtained solution and
Precipitating is transferred to adsorption column miRelute together, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, abandons after centrifugation
Fall efflux, retains adsorption column miRelute；
E. 500 μ l protein liquid removal MRD are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature
30 sec are centrifuged, waste liquid is abandoned；
F. 500 μ l rinsing liquid RW are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature centrifugation
30 sec abandon waste liquid；
G. repetitive operation step 6；
H. adsorption column miRelute is put into 2 ml collecting pipes, 12,000 rpm of room temperature is centrifuged 1 min, removes residual solution
Body；
R. adsorption column miRelute is transferred in a new 1.5 ml centrifuge tube of RNase-Free, adds 20 μ l RNase-Free
ddH2O, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 2 min, obtains total miRNA, miRNA solution is stored in -80
DEG C refrigerator.
The synthesis of (4) first chain cDNA sequences:
PCR pipe is taken to configure reverse transcription system, reverse transcription system are as follows: 2 × miRNA RT Reaction Buffer, 10 μ l:,
MiRNA RT Enzyme Mix 2 μ l, the 8 μ l of total miRNA solution, 20 μ l of total volume that upper step is extracted.Reaction condition are as follows: 42 DEG C
60min, 95 DEG C of 3min.Reverse transcription is carried out using Analytik Jena PCR amplification instrument PowerCycler, cDNA is placed in -20
It DEG C stores for future use；
(5) fluorescence quantitative PCR detection:
The cDNA sample obtained using reverse transcription is detected.Reaction system are as follows: 2 × miRcute Plus miRNA PreMix:
10 μ l, Reverse Primer, 0.4 μ l, Forward Primer, 0.4 the first chain cDNA of μ l, miRNA 2 μ l, ddH2O
20 μ l are complemented to, real-time PCR reactions condition: 95 DEG C of 15min；94 DEG C of 20sec, 63 DEG C of 30sec, 72 DEG C of 34sec, 5 circulations；
94 DEG C of 20sec, 60 DEG C of 34sec, 40 circulations.Each hole sets 3 repetitions, is averaged and is calculated, each pair of primer setting yin
Property control, using ddH2O is as negative Template Controls, and amplified reaction is in real-time fluorescence quantitative PCR instrument LightCyler480
Upper progress；
(6) calculation:
Ratio (the Ct of miRNA testing result Ct182-5p/Ct 152-3p) it is used as diagnosis index.
Reagent the present invention provides has-miR-182-5p and has-miR-152-3p in preparation for bladder cancer screening
Application in box.The kit detects the miRNA of bladder cancer urine specimen using the method for three-step approach real-time fluorescence quantitative PCR,
Kit is mainly by reverse transcriptase, buffer, water, amplimer, archaeal dna polymerase, the composition such as dNTP.
The present invention provides the applications that the compare-value model of miR-182-5p and miR-152-3p detects in bladder cancer urine.
The utility model has the advantages that
1, the present invention confirms that objective in bladder cancer urine of the compare-value model of miR-182-5p and miR-152-3p is deposited for the first time
, and the detection of quantitative fluorescent PCR can be carried out.
2, there is height provided by the present invention for the urine Microrna compare-value model of bladder cancer early screening, kit
Stability, specificity and sensibility, sensitivity 91.67%, specificity 80.95%, clinical reference value with higher.
It 3, can be with bladder provided by the present invention for urine Microrna compare-value model, the kit of bladder cancer early screening
Cancer early screening provides more reliable judgment basis, passes through the objective finger of the compare-value model of miR-182-5p and miR-152-3p
Mark carries out overall merit with other tumour early screening markers, improves accuracy rate of diagnosis, Cultivation process, in bladder cancer
Significant role is played in diagnosis and treatment.
Detailed description of the invention
Fig. 1 is box of the compare-value model of Ct miR-182-5p of the present invention and Ct miR-152-3p in different crowd
Formula figure.
Fig. 2 is the ROC curve figure of the compare-value model of Ct miR-182-5p of the present invention and Ct miR-152-3p.
Box respectively indicates lower quartile, median, upper quartile group, error line table from top to bottom as shown in Figure 1:
Show the 95th and the 5th percentile.
It is as shown in Figure 2: normal control+urinary tract infections compared to bladder cancer T1-T3 phase tumour, area under the curve AUC=
0.8869, value > 0.7 are the Specific marker that indicates detection target spot and can detect as this kind；Variance is 0.05236,
95% confidence interval is 0.7843 to 0.9895,PValue < 0.0001, detection sensitivity is up to 91.67%, and specificity is up to 80.95%.
Specific embodiment
A specific embodiment of the invention is as follows: the urine Microrna target gene database ratio for Diagnosis of Bladder
Method for establishing model, steps are as follows for the method for building up of the compare-value model:
(1) model data information collection: acquisition has-miR-182-5p is related in miRBase database to has-miR-152-3p
Information；
1 has-miR-182-5p and has-miR-152-3p sequence information of table and primer
| Gene | Accession number | Mature body sequence information (5' → 3') | Upstream primer sequence (5' → 3') |
| has-miR-182-5p | MIMAT0000259 | UUUGGCAAUGGUAGAACUCACACU | TTTGGCAATGGTAGAACTCACACT |
| has-miR-152-3p | MIMAT0000438 | UCAGUGCAUGACAGAACUUGG | TCAGTGCATGACAGAACTTGG |
(2) urine specimen is collected and saved: the collection of sample uses the sterile no enzyme centrifuge tube of 15ml, collects urina sanguinis freshly voided urine
7ml, wherein 3.54g guanidinium isothiocyanate (sigma) is added, completely rear be added HEPES salting liquid (Thermo) to be dissolved adjusts urine
The pH value of liquid sample is finally settled to total volume 10ml, HEPES concentration is 0.5 mol/l, guanidinium isothiocyanate concentration at this time to 7
For 3mol/l, sample saves under the conditions of being unified in -80 DEG C；
(3) in sample total serum IgE preparation:
A. the urine specimen of collection is thawed, sufficiently mixed fortune cracks 5 minutes at room temperature；
B. 5ml chloroform is added, acutely shakes, after solution forms layering after room temperature is static, 12000rpm is centrifuged 15 points under the conditions of 4 DEG C
Clock, mixing liquid is layered as lower layer's phenol chloroform phase after centrifugation, and middle layer albumin layer, upper layer colourless aqueous phase, RNA is all assigned and water
Xiang Zhong；
C. the volume for measuring transfer liquid is slowly added to the dehydrated alcohol of transfer liquid 1/3 volume of product (such as: the transfer liquid of 300 μ l
Add 100 μ l dehydrated alcohols), (at this time it is possible that precipitating) is mixed, obtained solution and precipitating are transferred to adsorption column together
MiRspin is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, adsorption column miRspin is discarded after centrifugation, retains
Efflux；
D. the volume for measuring efflux, the dehydrated alcohol for being slowly added to 2/3 volume of effluent volume mix.By obtained solution and
Precipitating is transferred to adsorption column miRelute together, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, abandons after centrifugation
Fall efflux, retains adsorption column miRelute；
E. 500 μ l protein liquid removal MRD are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature
30 sec are centrifuged, waste liquid is abandoned；
F. 500 μ l rinsing liquid RW are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature centrifugation
30 sec abandon waste liquid；
G. repetitive operation step 6；
H. adsorption column miRelute is put into 2 ml collecting pipes, 12,000 rpm of room temperature is centrifuged 1 min, removes residual solution
Body；
R. adsorption column miRelute is transferred in a new 1.5 ml centrifuge tube of RNase-Free, adds 20 μ l RNase-Free
ddH2O, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 2 min, obtains total miRNA, miRNA solution is stored in -80
DEG C refrigerator.
The synthesis of (4) first chain cDNA sequences:
PCR pipe is taken to configure reverse transcription system, reverse transcription system are as follows: 2 × miRNA RT Reaction Buffer, 10 μ l:,
MiRNA RT Enzyme Mix 2 μ l, the 8 μ l of total miRNA solution, 20 μ l of total volume that upper step is extracted.Reaction condition are as follows: 42 DEG C
60min, 95 DEG C of 3min.Reverse transcription is carried out using Analytik Jena PCR amplification instrument PowerCycler, cDNA is placed in -20
It DEG C stores for future use；
(5) fluorescence quantitative PCR detection:
The cDNA sample obtained using reverse transcription is detected.Reaction system are as follows: 2 × miRcute Plus miRNA PreMix:
10 μ l, Reverse Primer, 0.4 μ l, Forward Primer, 0.4 the first chain cDNA of μ l, miRNA 2 μ l, ddH2O
20 μ l are complemented to, real-time PCR reactions condition: 95 DEG C of 15min；94 DEG C of 20sec, 63 DEG C of 30sec, 72 DEG C of 34sec, 5 circulations；
94 DEG C of 20sec, 60 DEG C of 34sec, 40 circulations.Each hole sets 3 repetitions, is averaged and is calculated, each pair of primer setting yin
Property control, using ddH2O is as negative Template Controls, and amplified reaction is in real-time fluorescence quantitative PCR instrument LightCyler480
Upper progress；
(6) calculation:
Ratio (the Ct of miRNA testing result Ct182-5p/Ct 152-3p) it is used as diagnosis index.
The present invention provides a kind of Collection and conservation method that miRNA is extracted for urine, and said material and reagent are all abilities
Known to field technique personnel.
Provided by the present invention for diagnosing bladder cancer miRNA molecule has-miR-182-5p and has-miR-152-3p all
For the miRNA title of related target gene database, can retrieve to obtain in the database.
The reference gene that has-miR-152-3p provided by the invention can be used for when transitional cell bladder carcinoma miRNA detection,
For uniforming each sample, the fluorogenic quantitative detection of miRNA is carried out between sample.
Reagent the present invention provides has-miR-182-5p and has-miR-152-3p in preparation for bladder cancer screening
Application in box.The kit detects the miRNA of bladder cancer urine specimen using the method for three-step approach real-time fluorescence quantitative PCR,
Kit is mainly by reverse transcriptase, buffer, water, amplimer, archaeal dna polymerase, the composition such as dNTP.
The present invention provides the applications that the compare-value model of miR-182-5p and miR-152-3p detects in bladder cancer urine.
Claims (1)
1. a kind of urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder, it is characterised in that:
Steps are as follows for the method for building up of the compare-value model:
(1) model data information collection: acquisition has-miR-182-5p is related in miRBase database to has-miR-152-3p
Information；
(2) urine specimen is collected and saved: the collection of sample uses the sterile no enzyme centrifuge tube of 15ml, collects urina sanguinis freshly voided urine
7ml, wherein 3.54g guanidinium isothiocyanate (sigma) is added, completely rear be added HEPES salting liquid (Thermo) to be dissolved adjusts urine
The pH value of liquid sample is finally settled to total volume 10ml, HEPES concentration is 0.5 mol/l, guanidinium isothiocyanate concentration at this time to 7
For 3mol/l, sample saves under the conditions of being unified in -80 DEG C；
(3) in sample total serum IgE preparation:
A. the urine specimen of collection is thawed, sufficiently mixed fortune cracks 5 minutes at room temperature；
B. 5ml chloroform is added, acutely shakes, after solution forms layering after room temperature is static, 12000rpm is centrifuged 15 points under the conditions of 4 DEG C
Clock, mixing liquid is layered as lower layer's phenol chloroform phase after centrifugation, and middle layer albumin layer, upper layer colourless aqueous phase, RNA is all assigned and water
Xiang Zhong；
C. the volume for measuring transfer liquid is slowly added to the dehydrated alcohol of transfer liquid 1/3 volume of product (such as: the transfer liquid of 300 μ l
Add 100 μ l dehydrated alcohols), (at this time it is possible that precipitating) is mixed, obtained solution and precipitating are transferred to adsorption column together
MiRspin is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, adsorption column miRspin is discarded after centrifugation, retains
Efflux；
D. the volume for measuring efflux, the dehydrated alcohol for being slowly added to 2/3 volume of effluent volume mix.By obtained solution and
Precipitating is transferred to adsorption column miRelute together, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 30 sec, abandons after centrifugation
Fall efflux, retains adsorption column miRelute；
E. 500 μ l protein liquid removal MRD are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature
30 sec are centrifuged, waste liquid is abandoned；
F. 500 μ l rinsing liquid RW are added into adsorption column miRelute, are stored at room temperature 2 min, 12,000 rpm of room temperature centrifugation
30 sec abandon waste liquid；
G. repetitive operation step 6；
H. adsorption column miRelute is put into 2 ml collecting pipes, 12,000 rpm of room temperature is centrifuged 1 min, removes residual solution
Body；
R. adsorption column miRelute is transferred in a new 1.5 ml centrifuge tube of RNase-Free, adds 20 μ l RNase-Free
ddH2O, is placed at room temperature for 2 min, and 12,000 rpm of room temperature is centrifuged 2 min, obtains total miRNA, miRNA solution is stored in -80
DEG C refrigerator.
The synthesis of (4) first chain cDNA sequences:
PCR pipe is taken to configure reverse transcription system, reverse transcription system are as follows: 2 × miRNA RT Reaction Buffer, 10 μ l:,
MiRNA RT Enzyme Mix 2 μ l, the 8 μ l of total miRNA solution, 20 μ l of total volume that upper step is extracted.Reaction condition are as follows: 42 DEG C
60min, 95 DEG C of 3min.Reverse transcription is carried out using Analytik Jena PCR amplification instrument PowerCycler, cDNA is placed in -20
It DEG C stores for future use；
(5) fluorescence quantitative PCR detection:
The cDNA sample obtained using reverse transcription is detected.Reaction system are as follows: 2 × miRcute Plus miRNA PreMix:
10 μ l, Reverse Primer, 0.4 μ l, Forward Primer, 0.4 the first chain cDNA of μ l, miRNA 2 μ l, ddH2O
20 μ l are complemented to, real-time PCR reactions condition: 95 DEG C of 15min；94 DEG C of 20sec, 63 DEG C of 30sec, 72 DEG C of 34sec, 5 circulations；
94 DEG C of 20sec, 60 DEG C of 34sec, 40 circulations.Each hole sets 3 repetitions, is averaged and is calculated, each pair of primer setting yin
Property control, using ddH2O is as negative Template Controls, and amplified reaction is in real-time fluorescence quantitative PCR instrument LightCyler480
Upper progress；
(6) calculation:
Ratio (the Ct of miRNA testing result Ct182-5p/Ct 152-3p) it is used as diagnosis index.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910283065.4A CN109880909A (en) | 2019-04-10 | 2019-04-10 | Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910283065.4A CN109880909A (en) | 2019-04-10 | 2019-04-10 | Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109880909A true CN109880909A (en) | 2019-06-14 |
Family
ID=66936695
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910283065.4A Pending CN109880909A (en) | 2019-04-10 | 2019-04-10 | Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109880909A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2756255C1 (en) * | 2020-11-06 | 2021-09-28 | Федеральное Государственное Бюджетное Образовательное Учреждение Высшего Образования "Красноярский Государственный Медицинский Университет Имени Профессора В.Ф. Войно-Ясенецкого" Министерства Здравоохранения Российской Федерации | Method for early detection of bladder cancer using cytofluorimetric analysis of the urinary cellular sediment |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110178163A1 (en) * | 2010-01-14 | 2011-07-21 | Dipanjan Chowdhury | Mir-182 in the diagnosis and treatment of cancer |
| CN103320504A (en) * | 2013-01-28 | 2013-09-25 | 深圳市人民医院 | Detection of microRNAs in excreta as early diagnosis biomarker of lung cancer, colorectal cancer and bladder cancer |
| CN108728439A (en) * | 2017-04-19 | 2018-11-02 | 上海翔琼生物技术有限公司 | The finger-print of tiny RNA composition and its application in Diagnosis of Bladder |
-
2019
- 2019-04-10 CN CN201910283065.4A patent/CN109880909A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110178163A1 (en) * | 2010-01-14 | 2011-07-21 | Dipanjan Chowdhury | Mir-182 in the diagnosis and treatment of cancer |
| CN103320504A (en) * | 2013-01-28 | 2013-09-25 | 深圳市人民医院 | Detection of microRNAs in excreta as early diagnosis biomarker of lung cancer, colorectal cancer and bladder cancer |
| CN108728439A (en) * | 2017-04-19 | 2018-11-02 | 上海翔琼生物技术有限公司 | The finger-print of tiny RNA composition and its application in Diagnosis of Bladder |
Non-Patent Citations (3)
| Title |
|---|
| MERLE HANKE ET AL.: ""A robust methodology to study urine microRNA as tumor marker: microRNA-126 and microRNA-182 are related to urinary bladder cancer"", 《UROLOGIC ONCOLOGY: SEMINARS AND ORIGINAL INVESTIGATIONS》 * |
| ZHANGUO CHEN ET AL.: ""Evaluation of miR-182/miR-100 Ratio for Diagnosis and Survival Prediction in Bladder Cancer"", 《ARCHIVES OF IRANIAN MEDICINE》 * |
| 王真等: "《动物病原菌检测技术指南》", 31 July 2016, 中国农业大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2756255C1 (en) * | 2020-11-06 | 2021-09-28 | Федеральное Государственное Бюджетное Образовательное Учреждение Высшего Образования "Красноярский Государственный Медицинский Университет Имени Профессора В.Ф. Войно-Ясенецкого" Министерства Здравоохранения Российской Федерации | Method for early detection of bladder cancer using cytofluorimetric analysis of the urinary cellular sediment |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Day et al. | PCA3: from basic molecular science to the clinical lab | |
| CN108624688B (en) | Application of hsa _ circ _0012755 as prostate cancer molecular target in preparation of medicines and kits | |
| CN104164474A (en) | Fluorescent quantitative PCR method for detecting expression quantities of PCA3 gene and PSA gene in urine and diagnosis kit thereof | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN111621566B (en) | Serum miRNA marker for diagnosing liver cancer and predicting liver cancer metastasis and detection kit thereof | |
| CN114150063A (en) | Urine miRNA marker for bladder cancer diagnosis, diagnostic reagent and kit | |
| CN102925444A (en) | Serum micro ribonucleic acid (miRNA) biomarker of bladder cancer and detection method of expression quantity thereof | |
| CN109880909A (en) | Urine Microrna target gene database compare-value model method for building up for Diagnosis of Bladder | |
| CN111518908B (en) | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent | |
| CN102242204B (en) | Method for identifying single cells in molecular biology | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| CN103958698A (en) | Method for quantifying renal markers by assaying urine | |
| CN108753981A (en) | Application of the quantitative detection of HOXB8 genes in colorectal cancer Index for diagnosis | |
| CN112501294B (en) | Colorectal cancer biomarker and application thereof | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN111808966B (en) | Application of miRNA in diagnosis of breast cancer disease risk | |
| CN107858425A (en) | Applications and detection method of the miRNA 4741 as primary hepatic carcinoma diagnosis mark | |
| CN114045344A (en) | Urine miRNA marker for prostate cancer diagnosis, diagnostic reagent and kit | |
| CN110172509A (en) | A kind of excretion body molecular marker is preparing the application in diagnosing cancer of liver product | |
| CN112176060B (en) | Plasma non-coding RNA and primer set for detecting expression level thereof and colorectal cancer detection kit | |
| CN116121245B (en) | Small molecule RNA and application thereof in early diagnosis of endometriosis | |
| CN103275979B (en) | MicroRNA (Ribose Nucleic Acid) marker for detecting breast cancer and application thereof in kit | |
| CN109371129A (en) | Application of the hsa_circRNA_0000798 as hepatocarcinoma early diagnosis or prognosis evaluation biomarker | |
| CN106636418A (en) | Kit for detecting TSHR (thyroid stimulating hormone receptor) gene mRNA expression through fluorescence quantitation RT-PCR (real-time polymerase chain reaction) and use method of kit | |
| TWI690597B (en) | Detection kit and detection method for urothelial carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190614 |
|
| WD01 | Invention patent application deemed withdrawn after publication |