CN109880791B - In-vitro construction method of hepatic fibrosis organoid model - Google Patents
In-vitro construction method of hepatic fibrosis organoid model Download PDFInfo
- Publication number
- CN109880791B CN109880791B CN201910124700.4A CN201910124700A CN109880791B CN 109880791 B CN109880791 B CN 109880791B CN 201910124700 A CN201910124700 A CN 201910124700A CN 109880791 B CN109880791 B CN 109880791B
- Authority
- CN
- China
- Prior art keywords
- culture medium
- mug
- hepatic
- cells
- medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an in vitro construction method of a hepatic fibrosis organoid model, which is characterized in that hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells are suspended in a culture medium A; culturing to 4 days, and changing to culture medium B for maintaining culture; starting on day 10, medium C was changed and the culture was continued for six days. The invention quickly constructs a 3D liver fibrosis organ in vitro model with uniform size and structure and obvious fibrosis representation based on the proportion of cell components in the liver. The liver fibrosis organ model constructed by the invention has the advantages of clear principle, stable structure, simple method, quick construction and strong operability, is suitable for the research of liver fibrosis occurrence and development mechanism, the high-throughput screening of anti-fibrosis drugs and the like, and has industrial significance.
Description
Technical Field
The invention relates to an in vitro construction method of a hepatic fibrosis organoid model.
Background
Hepatic fibrosis is a complex inflammatory response, caused by chronic liver injury for a long time, and has a great risk of developing cirrhosis and even liver cancer. Etiology indicates that various factors are associated with liver fibrosis, such as hepatitis virus infection, excessive drinking, autoimmune diseases, obesity, and the like. Liver fibrosis can be defined as a widespread scarring process with changes in internal composition and function. Among them, abnormal extracellular matrix secretion caused by hepatic stellate cell activation plays an extremely important role in hepatic fibrosis. Therefore, previous in vitro models of liver fibrosis are often based on ordinary 2D culture of hepatic stellate cells. Although the culture medium has a certain reference value for research on a fibrosis mechanism and drug screening, the normal monolayer culture cannot well simulate the microenvironment under physiological and pathological conditions of the liver, such as the lack of cell-cell and cell-extracellular matrix interactions. Therefore, considering the complexity of the components in liver tissue, a new 3D model simulating the liver fibrosis microenvironment is urgently needed to be developed.
Organoid technology is an in vitro model that mimics in vivo properties and has multiple cell types, constructed using the properties of mammalian pluripotent stem cells, adult tissue-derived stem cells, or adult cells. Recently, many studies have reported that these organoids with complex internal structures have approached the corresponding internal structures in terms of function and structure. The technology provides an ideal platform for researching the physiological and pathological states of tissues and organs and screening drugs.
Disclosure of Invention
The invention aims to provide a quick and simple in-vitro construction method of a hepatic fibrosis organoid model, the hepatic fibrosis organoid model with uniform size and structure and definite fibrosis characterization can be obtained in a short time by the method, and a platform is provided for further hepatic fibrosis mechanism research and drug screening.
The technical solution of the invention is as follows:
an in vitro construction method of a hepatic fibrosis organoid model is characterized in that: comprises the following steps:
suspending the hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in a culture medium A; culturing to 4 days, and changing to culture medium B for maintaining culture; starting from day 10, changing to culture medium C, and continuously culturing for six days;
the culture medium A comprises: bovine insulin, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), hydrocortisone, glutamine (GlutaMAX), fetal bovine serum, type I rat tail collagen, and phenol red-free Williams' E Medium.
The culture medium B comprises: gentamicin, transferrin (Transferrin), vitamin C, bovine insulin, fetal bovine serum, sodium selenite, linoleic acid, hydrocortisone, 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), glutamine (GlutaMAX), human Epidermal Growth Factor (HEGF), and HBM hepatocyte basal medium;
the culture medium C comprises: gentamicin, transferrin (Transferrin), vitamin C, bovine insulin, fetal bovine serum, sodium selenite, hydrocortisone, 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), glutamine (GlutaMAX), transforming growth factor-beta (TGF-beta), human Epidermal Growth Factor (HEGF), and HBM hepatocyte basal medium.
Hepatocytes, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells were counted using a counter and suspended in the culture medium a at a ratio of 7.
Uniformly mixing hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in a specific ratio to A, and uniformly inoculating 1200 cells in each hole to an ultra-low adsorption round bottom cell plate by using a row gun after counting, wherein the volume of the cell suspension inoculated in each hole is 100 mu L.
Suspending the hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in the culture medium A in proportion, inoculating the suspension in an ultra-low adsorption round-bottom cell plate, then placing the plate in a 37 ℃ carbon dioxide incubator, standing for 3 days, and avoiding movement as much as possible.
Culturing to 4 days, using a micro-pipette, clinging to the liquid surface of the culture medium, and sucking out the old culture medium; and slowly adding 100 muL of culture medium B along the hole wall, sucking and discarding 50 muL of culture medium in the hole every other day, adding an equivalent amount of culture medium B, and continuously culturing for 6 days.
After culturing to 10 days, using a micro-pipette to cling to the liquid surface of the culture medium, and sucking out the old culture medium; and slowly adding 100 muL of the culture medium C along the hole wall, sucking and discarding 50 muL of the culture medium every other day, adding an equal amount of the culture medium C, and continuously culturing for 6 days.
The culture medium A comprises: 2 mug/mL type I rat tail collagen, 10% fetal bovine serum, 8 mug/mL bovine insulin, 10ng/mL hydrocortisone, 2 mug/mL glutamine (GlutaMAX), 2 mug/mL 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES), phenol-free red Williams E Medium; the culture medium B comprises: 100 mug/mL gentamicin, 10% fetal bovine serum, 10 mug/mL Transferrin (transferrins), 10 mug/mL sodium selenite, 10 mug/mL linoleic acid, 1 mug/mL vitamin C,8 mug/mL bovine insulin, 10ng/mL hydrocortisone, 2 mug mol/mL glutamine (GlutaMAX), 2 mug mol/mL 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES), 2ng/mL Human Epidermal Growth Factor (HEGF), HBM hepatocyte basal medium; the culture medium C comprises: 5ng/mL of transforming growth factor-beta (TGF-beta), 2% fetal bovine serum, 100 mug/mL of gentamicin, 10 mug/mL of Transferrin (Transferrin), 10 mug/mL of sodium selenite, 1 mug/mL of vitamin C,8 mug/mL of bovine insulin, 10ng/mL of hydrocortisone, 2 mug/mL of glutamine (GlutaMAX), 2ng/mL of Human Epidermal Growth Factor (HEGF), 2 mug/mL of 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES), and HBM (hepatitis B virus) hepatocyte basal medium.
Experimental results show that the invention can rapidly construct a hepatic fibrosis organoid model in 16 days, and the model has uniform shape and about 200 mu m size, thereby avoiding the situation of oxygen-deficient necrosis of central cells with overlarge volume. Meanwhile, the organs can secrete albumin and express specific liver markers such as CYP4A3, CYP450 and the like. Stable fibrotic phenotypes in liver organoids, such as expression of the fibrotic markers α -actin and type I collagen at the protein and gene levels, were achieved using medium C for six days of induction after the tenth day.
The invention quickly constructs the 3D liver fibrosis organ in vitro model with uniform size and structure and obvious fibrosis representation based on the ratio of cell components in the liver. The liver fibrosis organ model constructed by the invention has the advantages of clear principle, stable structure, simple method, quick construction and strong operability, is suitable for the research of liver fibrosis occurrence and development mechanism, the high-throughput screening of anti-fibrosis drugs and the like, and has industrial significance.
Drawings
The invention is further illustrated by the following figures and examples.
FIG. 1 is a flow chart of a process for preparing liver fibrosis organoids.
Fig. 2 is a photograph of a lens taken at different times.
FIG. 3 is a schematic representation of the expression of liver specific markers for confocal detection of liver fibrosis organoids.
FIG. 4 is a schematic diagram of Live/dead fluorescence detection of growth status of liver fibrosis organoids.
FIG. 5 is a schematic diagram of ELISA to detect the levels of albumin (A) and inflammatory factors (B and C) secretion in the liver fibrosis organoid model.
FIG. 6 is a diagram of RT-PCR detection of mRNA levels of hepatic fibrosis organoid model albumin (A) and fibrosis markers (B and C).
FIG. 7 is a schematic representation of the expression of a confocal detection of liver fibrosis organoid fibrosis marker.
FIG. 8 is a schematic representation of immunohistochemical detection of expression of markers for liver fibrosis organoid fibrosis.
Detailed Description
Referring to fig. 1, fig. 1 is a flow chart of a preparation process of liver fibrosis organoids provided by the present invention.
Step one, primarily sorting various liver component cells, and preserving the seeds by freezing liquid nitrogen; or directly purchasing various frozen liver component cells. Hepatocytes, hepatic stellate cells, kupffer cells, hepatic sinus endothelial cells were carefully resuscitated using an automated cell resuscitation system, centrifuged at 800rps, resuspended in medium a, and counted separately using a cell counter. The ultra-low adsorption round bottom cell culture plates were carefully and evenly seeded using a row gun at a ratio of 7. The culture medium A comprises the following components: type I rat tail collagen 2 mug/mL, fetal bovine serum 10%, bovine insulin 8 mug/mL, hydrocortisone 10ng/mL, glutamine 2 mug/mL (GlutaMAX), 4-hydroxyethylpiperazineethanesulfonic acid 2 mug mol/mL (HEPES), phenol red-free William's E Medium.
Step two, placing the inoculated medium A at 37 ℃ and 5% CO 2 Culturing in an incubator, standing for 3 days, and observing the cell clusters with uniform pore sizes. Medium B was replaced on day 4 and the culture was continued under the same conditions. Culture medium B components include 100. Mu.g/mL gentamicin, 10. Mu.g/mL Transferrin (transferrinn), 10% fetal bovine serum, 10. Mu.g/mL sodium selenite, 10. Mu.g/mL linoleic acid, 1. Mu.g/mL vitamin C, 8. Mu.g/mL bovine insulin, 10ng/mL hydrocortisone, 2. Mu. Mol/mL glutamine (GlutaMAX), 2. Mu. Mol/mL 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 2ng/mL Human Epidermal Growth Factor (HEGF), HBM hepatocyte basal medium.
And thirdly, using a micro-pipette to cling to the liquid surface of the culture medium, sucking 50 muL of the old culture medium in the hole every other day, slowly adding the equivalent culture medium B, and continuously culturing for 6 days. Organoids with a size of about 200 μm were visible in each well of the cell culture plate. On day 10, medium C was changed, and culture was continued for six days under the same conditions, with half the change every other day. The culture medium C comprises: 5ng/mL of transformation growth factor-beta (TGF-beta), 100 mug/mL of gentamicin, 10 mug/mL of Transferrin (Transferrin), 2% fetal bovine serum, 10 mug/mL of sodium selenite, 1 mug/mL of vitamin C,8 mug/mL of bovine insulin, 10ng/mL of hydrocortisone, 2 mug/mL of glutamine (GlutaMAX), 2ng/mL of Human Epidermal Growth Factor (HEGF), 2 mug/mL of 4-hydroxyethyl piperazine ethanesulfonic acid (HEPES), and HBM (hepatitis B M) hepatocyte basal medium.
Referring to fig. 2, fig. 2 is a light mirror image of the organoid model taken at different time nodes from day 4h to day 16 according to steps one through three. Culturing in culture medium A for 3 days, culturing in culture medium B for organoid model formation and maturation at day 4, inducing fibrosis at day 10, and forming hepatic fibrosis organoid model at day 16. Human liver is divided into parenchymal liver cells and non-parenchymal cells, wherein the non-parenchymal cells mainly comprise hepatic stellate cells, hepatic sinus endothelial cells and kupffer cells. The four cell-simulated liver cells are mixed and inoculated in an ultra-low adsorption circular 96-well plate in proportion, and after an organoid model is formed through self-assembly, morphological characteristics can be well maintained in the following culture period. The liver organoid constructed by the invention is stabilized within 200 mu m in diameter, so that cell necrosis caused by oxygen deficiency in the center due to overlarge volume can be better avoided. Meanwhile, no abnormal change was observed in morphology after the induction of fibrosis using medium C.
Referring to fig. 3, at day 10 of culture, liver-specific marker albumin, and specific enzymes CYP4A3 and CYP450 were identified in organoids using immunofluorescence. Specifically, organoid spheres were carefully aspirated using a pipette, fixed in 4% volume paraformaldehyde for 30min, and then permeabilized with 0.1% Triton-X for 15 min. Blocking was performed by adding 5% BSA solution for 2h and then incubating in the specific primary antibody overnight at 4 ℃. The cells were washed 3 times every other day with PBS and then added with the corresponding fluorescent secondary antibody, incubated for one hour at room temperature in the dark. After 3 washes with PBS, DAPI staining was performed at room temperature in the dark for 30min. Under specific exciting light, the fluorescence expression intensity of the three is detected by confocal detection. On day 10, the liver marker albumin, as well as the metabolic enzymes CYP4A3 and CYP450 were specifically expressed in the liver organoid model, suggesting that the liver organoid model has liver tissue-like properties.
Referring to FIG. 4, according to the process flow, parts of liver organoids were taken out on days 10 and 16 of culture, respectively, and the survival status was analyzed using the Live/dead method. Specifically, two sets of organoid spheres were carefully aspirated using a pipette and rinsed 3 times with PBS. A staining solution (calcein AM/ethidium homomodimer-1, 1. As shown in fig. 4, after the induction of fibrosis by medium C, the number of dead cells in liver organoids was slightly increased compared to day 10, but the overall survival state was not significantly different, and significant hepatocyte death was not observed. This is also consistent with the concept that liver fibrosis is a chronic liver injury disease.
Referring to fig. 5, culture supernatants of liver organoids at day 10 and day 16 were collected and tested for secretion of albumin and inflammatory factors from liver fibrotic organoids by immunoenzyme-linked immunosorbent assay (ELISA). Specifically, 100 muL of liver organoid supernatant of a standard substance and different time points is added into a specific hole, and the mixture is incubated for 2.5h at room temperature. Washing with 300 μ L washing buffer solution for 4 times, each for 5min, and beating the inverted test plate to remove residual solution. And adding 100 mu L of antibody diluent, and incubating for 1h at room temperature. After washing 4 times with 300 μ L of washing buffer, 100 μ L of streptavidin was added and incubated for 45min at room temperature. And continuously washing for 4 times by using 300 mu L of washing buffer solution, and adding the TMB substrate solution to incubate for 30min in a dark place at room temperature. 50 muL of stop solution was added to each well and detected on a plate reader at a wavelength of 450 nm. As shown in fig. 5, after continuous induction culture for 6 days using medium C, the content of albumin, a liver-specific marker, in the supernatant was significantly decreased, indicating that the albumin secretion function of liver organoids was inhibited, and it was presumed that hepatocytes in liver organoids were somewhat damaged. At the same time, the secretion of TNF-alpha and IL-1 beta, which are organoid inflammatory factors, is increased significantly. The invention prompts that the hepatic fibrosis organoid in vitro model constructed by the invention can have the characteristics of liver damage and inflammation in a short time.
Referring to fig. 6, RT-PCR was used to detect albumin and fibrosis marker mRNA expression levels in liver organoids. Total liver organoid RNA was extracted at day 10 and day 16 using RNeasy Mini kit (Qiagen) and Reverse transcribed into cDNA using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). RT-PCR was performed on a real-time quantitative PCR instrument using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) according to primers (ACTA 2, F: AAAAGACAGCTACGTGGTGA; R: GCCATGTCTATCGGGTACTTC. ALB; F: TGCAACTCTTCGTGAAACCTATG; R: ACATCAACCTCTGGTCCC. COL1A 1; F: GAGGCCAAGACGAAGACATC; R: CAGATCACGTCATCGCACAAC. GAPDH; F: GGAGCGAGATCCTCCAAAT; R: GGCTGTTGTCATACTTCTGTCAG). As shown in fig. 6, in agreement with the ELISA results, the ALB gene expression encoding albumin was significantly down-regulated after 6 days of continuous culture using medium C. Meanwhile, the ACAT2 gene coding the fibrosis marker alpha actin and the COL1A1 gene coding the type I collagen are obviously increased in expression, which indicates that the hepatic fibrosis organoid in vitro model constructed by the invention has fibrosis characterization in a short time.
Referring to fig. 7, immunofluorescence/laser confocal was used to identify the fibrotic markers α actin and type I collagen expression in organoids. The specific method is the same as that of FIG. 3. As shown in FIG. 7, the expression of fibrosis markers alpha-actin and type I collagen is obviously increased after continuous culture for 6 days by using the culture medium C, which indicates that the liver fibrosis organoid constructed by the invention has a typical fibrosis phenotype.
Referring to fig. 8, immunohistochemistry was used to detect the expression of the fibrotic markers α actin and type I collagen in organoids. Liver organoids on day 10 and day 16 were taken, fixed with 4% formalin for 1h, embedded in paraffin, and cut into 5 μm sections. Dewaxing and hydrating, and adding 3% hydrogen peroxide to reduce endogenous catalase. Antigen retrieval with citrate buffer at 100 ℃ for 30min and blocking in BSA solution at room temperature for 1h. The primary antibody dilution was incubated overnight in a wet box at 4 ℃ and after three washes with TBST, the secondary antibody dilution was added and incubated for 1h at room temperature. After DAB solution treatment, hematoxylin counterstaining was used. Mounting and taking pictures under microscope. Consistent with the confocal fluorescence analysis, as shown in fig. 8, in immunohistochemical staining, the expression of fibrosis markers alpha-actin and type I-collagen is obviously increased after the culture medium C is continuously induced and cultured for 6 days, further illustrating that the invention successfully constructs a liver fibrosis organoid model.
The above description is only a preferred embodiment of the present invention, and several modifications can be made while following the principle of the present invention, and these modifications should also be regarded as the protection scope of the present invention.
Claims (5)
1. An in vitro construction method of a hepatic fibrosis organoid model is characterized in that: comprises the following steps:
suspending the hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in a culture medium A; culturing to 4 days, and changing to culture medium B for maintaining culture; starting on day 10, changing to culture medium C, and continuously culturing for six days;
the culture medium A comprises: bovine insulin, 4-hydroxyethyl piperazine ethanesulfonic acid, hydrocortisone, glutamine, fetal bovine serum, type I rat tail collagen and phenol red-free Williams' E medium;
the culture medium B comprises: gentamicin, transferrin, vitamin C, bovine insulin, fetal bovine serum, sodium selenite, linoleic acid, hydrocortisone, 4-hydroxyethyl piperazine ethanesulfonic acid, glutamine, human epidermal growth factor and HBM hepatocyte basal medium;
the culture medium C comprises: gentamicin, transferrin, vitamin C, bovine insulin, fetal bovine serum, sodium selenite, hydrocortisone, 4-hydroxyethyl piperazine ethanesulfonic acid, glutamine, transforming growth factor-beta, human epidermal growth factor and HBM hepatocyte basal medium;
the hepatocytes, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells were suspended in the medium a at a ratio of 7;
the culture medium A comprises: 2 mug/mL type I rat tail collagen, 10% fetal bovine serum, 8 mug/mL bovine insulin, 10ng/mL hydrocortisone, 2 mumol/mL glutamine, 2 mumol/mL 4-hydroxyethylpiperazine ethanesulfonic acid, no phenol red williams E medium; the culture medium B comprises: 100 mug/mL gentamicin, 10% fetal calf serum, 10 mug/mL transferrin, 10 mug/mL sodium selenite, 10 mug/mL linoleic acid, 1 mug/mL vitamin C,8 mug/mL bovine insulin, 10ng/mL hydrocortisone, 2 mug mol/mL glutamine, 2 mug mol/mL 4-hydroxyethyl piperazine ethanesulfonic acid, 2ng/mL human epidermal growth factor, HBM hepatocyte basal medium; the culture medium C comprises: 5ng/mL transformation growth factor-beta, 2% fetal bovine serum, 100 mug/mL gentamicin, 10 mug/mL transferrin, 10 mug/mL sodium selenite, 1 mug/mL vitamin C,8 mug/mL bovine insulin, 10ng/mL hydrocortisone, 2 mug mol/mL glutamine, 2ng/mL human epidermal growth factor, 2 mug mol/mL 4-hydroxyethyl piperazine ethanesulfonic acid, HBM hepatocyte basal medium.
2. The method for constructing a hepatic fibrosis organoid model according to claim 1, wherein: uniformly mixing hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in a culture medium A according to a specific ratio, and uniformly inoculating 1200 cells in each hole after counting on an ultra-low adsorption round bottom cell plate by using a row gun, wherein the volume of the cell suspension inoculated in each hole is 100 mu L.
3. The in vitro construction method of a hepatic fibrosis organoid model according to claim 2, which is characterized by: suspending the hepatic cells, hepatic stellate cells, kupffer cells and hepatic sinus endothelial cells in the culture medium A in proportion, inoculating the suspension in an ultra-low adsorption round-bottom cell plate, then placing the plate in a 37 ℃ carbon dioxide incubator, standing for 3 days, and avoiding movement as much as possible.
4. The method for in vitro constructing a liver fibrosis organoid model according to any one of claims 1, 2 or 3, wherein: culturing to 4 days, using a micro-pipette, clinging to the liquid level of the culture medium, and sucking out the old culture medium; and slowly adding 100 muL of culture medium B along the hole wall, sucking and discarding 50 muL of culture medium in the hole every other day, adding an equivalent amount of culture medium B, and continuously culturing for 6 days.
5. The method for in vitro constructing a liver fibrosis organoid model according to any one of claims 1, 2 or 3, wherein: after culturing to 10 days, using a micro-pipette to cling to the liquid surface of the culture medium, and sucking out the old culture medium; and slowly adding 100 muL of the culture medium C along the hole wall, sucking and discarding 50 muL of the culture medium every other day, adding an equal amount of the culture medium C, and continuously culturing for 6 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910124700.4A CN109880791B (en) | 2019-02-20 | 2019-02-20 | In-vitro construction method of hepatic fibrosis organoid model |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910124700.4A CN109880791B (en) | 2019-02-20 | 2019-02-20 | In-vitro construction method of hepatic fibrosis organoid model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109880791A CN109880791A (en) | 2019-06-14 |
| CN109880791B true CN109880791B (en) | 2023-02-03 |
Family
ID=66928475
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910124700.4A Active CN109880791B (en) | 2019-02-20 | 2019-02-20 | In-vitro construction method of hepatic fibrosis organoid model |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109880791B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111411084A (en) * | 2020-04-28 | 2020-07-14 | 江苏信安佳医疗科技有限公司 | Culture medium and culture method for constructing liver tumor stent-free organoid |
| CN113337454B (en) * | 2021-07-21 | 2023-02-21 | 中国人民解放军总医院第五医学中心 | Construction method and application of 3D hepatic fibrosis model |
| CN113667633B (en) * | 2021-07-29 | 2022-05-24 | 四川大学华西医院 | Method for constructing cortical organoid model of schizophrenia dysplasia |
| CN113717925B (en) * | 2021-08-19 | 2024-03-12 | 清华大学 | Artificial liver organoid and preparation method and application thereof |
| CN113717928B (en) * | 2021-09-03 | 2024-01-26 | 苏州朴衡科技有限公司 | Method for constructing 3D liver bud organoid based on framework nucleic acid material and application |
| CN115029240A (en) * | 2022-04-28 | 2022-09-09 | 苏州大学 | Hepatic fibrosis chip and application thereof in developing medicine for treating hepatic fibrosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018115533A1 (en) * | 2016-12-23 | 2018-06-28 | Insphero Ag | Screenable liver disease models and methods |
| CN109337860A (en) * | 2018-10-29 | 2019-02-15 | 妙顺（上海）生物科技有限公司 | A kind of hepatic fibrosis in vitro 3D model building method |
-
2019
- 2019-02-20 CN CN201910124700.4A patent/CN109880791B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018115533A1 (en) * | 2016-12-23 | 2018-06-28 | Insphero Ag | Screenable liver disease models and methods |
| CN109337860A (en) * | 2018-10-29 | 2019-02-15 | 妙顺（上海）生物科技有限公司 | A kind of hepatic fibrosis in vitro 3D model building method |
Non-Patent Citations (1)
| Title |
|---|
| pro-fibrotic compounds induce stellate cell activation, ECM-remodelling and Nrf2 activation in a human 3D-multicellular model of liver fibrosis;vincenzo prestigiacomo et al;《PLOS ONE》;20170630;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109880791A (en) | 2019-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109880791B (en) | In-vitro construction method of hepatic fibrosis organoid model | |
| US9151744B2 (en) | Lung tissue model | |
| KR101195838B1 (en) | Isolated pluripotent adult stem cells and methods for isolating and cultivating the same | |
| AU2010244121B2 (en) | Lung tissue model | |
| Rabata et al. | 3D cell culture models demonstrate a role for FGF and WNT signaling in regulation of lung epithelial cell fate and morphogenesis | |
| Shamis et al. | Organ-specific scaffolds for in vitro expansion, differentiation, and organization of primary lung cells | |
| CN113388569B (en) | Preparation method of liver organoid | |
| US20100183566A1 (en) | METHOD FOR EFFICIENT TRANSFER OF HUMAN BLASTOCYST-DERIVED STEM CELLS (hBS CELLS) FROM A FEEDER-SUPPORTED TO A FEEDER-FREE CULTURE SYSTEM | |
| AU2015248875B2 (en) | Method of preparing cells for 3D tissue culture | |
| CN108779439A (en) | Utilize the production method for making liver stem cells/precursor by mature hepatocytes of low molecular compound | |
| JP2023101792A (en) | Artificial fat tissue and method for producing the same, method for producing artificial skin and agent for adipocyte culture | |
| CN112888778A (en) | Method for producing stem/progenitor cells from cells derived from an endosymbiont tissue or organ by means of a low-molecular compound | |
| US11685900B2 (en) | Nanofiber-based long-term primary hepatocyte three-dimensional culture system and culturing method | |
| Lu et al. | Conjunctival reconstruction with progenitor cell-derived autologous epidermal sheets in rhesus monkey | |
| KR20190127041A (en) | liver organoid and method of preparing the same | |
| Chen et al. | In vitro expansion and differentiation of rat pancreatic duct-derived stem cells into insulin secreting cells using a dynamic three-dimensional cell culture system | |
| JP5522340B2 (en) | Cultured cell constructs containing fetal hepatocyte spheroids | |
| Dale et al. | Rock Inhibitor Y‐27632 Enables Feeder‐Free, Unlimited Expansion of Sus scrofa domesticus Swine Airway Stem Cells to Facilitate Respiratory Research | |
| WO2011016485A1 (en) | METHOD FOR INDUCING DIFFERENTIATION OF iPS CELLS INTO HEPATIC PARENCHYMAL CELLS | |
| KR102183101B1 (en) | Method for preparing lung organoid containing alveolar epithelial cells and macrophages and use thereof | |
| US20170107497A1 (en) | Improved reliability of assays using a multi-divot platform and multi-source, multi-cell type clusters | |
| Maekawa et al. | Long-term culture of rat hepatocytes using human amniotic membrane as a culture substrate | |
| Gerwinn et al. | Spheroids of bladder smooth muscle cells for bladder tissue engineering | |
| US20200010807A1 (en) | Stepwise method for inducing cholangiocyte progenitors from hepatoblasts | |
| EP2546334A1 (en) | Method for the in vitro proliferation of cells derived from tissues of endormal origin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190614 Assignee: Beijing Life Oasis Public Welfare Service Center Assignor: AFFILIATED HOSPITAL OF NANTONG University Contract record no.: X2023990000502 Denomination of invention: An in vitro construction method for a liver fibrosis like organ model Granted publication date: 20230203 License type: Common License Record date: 20230515 |
|
| EE01 | Entry into force of recordation of patent licensing contract |