CN109868320A - Composition and application thereof for detecting cancer of the esophagus - Google Patents
Composition and application thereof for detecting cancer of the esophagus Download PDFInfo
- Publication number
- CN109868320A CN109868320A CN201711248825.5A CN201711248825A CN109868320A CN 109868320 A CN109868320 A CN 109868320A CN 201711248825 A CN201711248825 A CN 201711248825A CN 109868320 A CN109868320 A CN 109868320A
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- target gene
- cancer
- esophagus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of composition and application thereof for detecting the cancer of the esophagus, the composition includes: the nucleic acid for detecting target gene methylation state, wherein the target gene is one or both of MT1A gene and EPO gene.The present invention also provides the kits including the composition.And purposes of the composition in the kit that preparation is used for the vitro detection cancer of the esophagus.
Description
Technical field
The invention belongs to field of biotechnology, are related to a kind of composition and its purposes in disease detection, specifically relate to
And a kind of composition for detecting the cancer of the esophagus and its corresponding kit and purposes.
Background technique
The cancer of the esophagus is a kind of common tumor in digestive tract, and there are about 300,000 people to die of the cancer of the esophagus every year in the whole world.China is generation
The half in the patient of the cancer of the esophagus is died of from China in one of Esophageal Cancer area in boundary, the whole world.National treatment and prevention of tumour office
The number of chambers is according to display: 2015, China's Incidence of esophageal cancer was 478/100,000 people, and the death rate is 375/ten thousand people, was occupied respectively
The 4th in China's common cancer and third position.The case fatality rate of the cancer of the esophagus is a kind of very high cancer of grade malignancy close to 80%
Disease.An important factor for leading to cancer of the esophagus high mortality is that the diagnosis rate of the early stage cancer of the esophagus is low.The cure rate of the early stage cancer of the esophagus is far high
In middle and advanced stage, but since the early stage cancer of the esophagus lacks obviously and special symptom, developed when Most patients are made a definite diagnosis into
Enter middle and advanced stage.Clinical research discovery, cancer, which is initially formed from lesion to the process average that clinical symptoms occurs in patient, needs the several years
Time；This be discovery the early stage cancer of the esophagus, improve the early stage cancer of the esophagus diagnosis rate provide an effective window phase.It makes full use of
This window phase is expected to improve esophageal carcinoma therapy effect, reduces esophagus mortality of carcinoma.
The application clinically applied to the technology of esophagus cancer diagnosis in terms of the detection of early esophageal cancer and screening has at present
Limit, is primarily due to: 1) organizing biopsy invasive strong, be unsuitable for early cancer screening；2) iconography detection technique (such as: examine by esophagogram
Look into and endoscopy) equipment cost, operating technology and in terms of on limitation, it is also difficult to as screening for cancer skill
Art and promote on a large scale；3) traditional blood serum tumor marker (such as AFP, CEA, CA125 and CA199) detects the cancer of the esophagus
Sensitivity is lower, is unable to fully meet the requirement of early cancer screening.
In recent years researches show that epigenetics to play an important role in the generation, development of cancer.As epigenetic
A kind of important mechanisms learned, the DNA methylation of kinds cancer regulate and control to be furtherd investigate.Data is shown: gene methyl
The biological mechanisms such as the regulation of change and chromatin Structure and gene expression regulation are related；The variation of cytogene methylation occurs
The early stage that tumour is formed, and run through the occurrence and development process of cancer；The methylation of tumor suppressor gene is Precancerous Lesion conversion
For the important molecule mechanism of malignant cell.But at present lack for the cancer of the esophagus methylated genes detection detection technique,
Method and product.Therefore, methylated genes marker currently high to the sensibility height and specificity that detect for the cancer of the esophagus is deposited
In demand.
Summary of the invention
Based on this, for the problem that detection is inconvenient existing for existing cancer of the esophagus detection technique, sensitivity is low and at high cost,
The present invention provides a kind of for detecting the composition of cancer of the esophagus, and composition provided by the invention can be sensitive and specifically detects
The cancer of the esophagus, the present invention also provides the kit comprising the composition and its purposes in the detection cancer of the esophagus.The present invention
The kit of offer have good cancer of the esophagus detection sensitivity, can it is convenient, fast, the cancer of the esophagus is effectively detected.
The composition that the present invention provides a kind of for the vitro detection cancer of the esophagus, kit and application thereof, and based on should
Kit is come the method that executes detection, and for detecting the cancer of the esophagus.
In particular it relates to the following contents:
1. a kind of composition for the vitro detection cancer of the esophagus, the composition include:
For detecting the nucleic acid of target gene methylation state,
Wherein, the target gene is one or both of MT1A gene and EPO gene.
2. according to composition described in item 1, wherein the target sequence of the MT1A gene is as shown in SEQ ID NO:1.
3. according to composition described in item 1, wherein the target sequence of the EPO gene is as shown in SEQ ID NO:3.
4. the composition according to any one of item 1~3, wherein described for detecting target gene methylation state
Nucleic acid include:
The segment of at least nine nucleotide in the target sequence of the target gene,
The segment includes at least one CpG dinucleotides sequence.
5. the composition according to any one of item 1~4, wherein described for detecting target gene methylation state
Nucleic acid include further include:
The piece of at least 15 nucleotide of the hybridization in the target gene target sequence under moderate stringency or stringent condition
Section,
The segment includes at least one CpG dinucleotides sequence.
6. the composition according to any one of item 1~5, further include:
Convert 5 non-methylated cytosine bases of target gene target sequence to the reagent of uracil.
7. the composition according to any one of item 1~6, wherein described for detecting target gene methylation state
Nucleic acid further include:
The preferentially blocking agent in conjunction with the target sequence in non-methylation state.
8. according to composition described in item 7, wherein
The segment of at least nine nucleotide, the sequence for being SEQ ID NO:5 and SEQ ID NO:6 or its be
The sequence of SEQ ID NO:9 and SEQ ID NO:10,
The segment of at least 15 nucleotide, be SEQ ID NO:7 sequence or SEQ ID NO:11 sequence,
Blocking agent is the sequence of SEQ ID NO:8 or the sequence of SEQ ID NO:12.
9. a kind of oligonucleotides for the vitro detection cancer of the esophagus comprising:
The SEQ ID NO:1 or at least nine nucleotide in its complementary series and include at least one CpG dinucleotides
The segment of sequence；And/or
The SEQ ID NO:3 or at least nine nucleotide in its complementary series and include at least one CpG dinucleotides
The segment of sequence.
10. according to oligonucleotides described in item 9, further include:
At least 15 cores of the hybridization in the SEQ ID NO:1 or its complementary series under moderate stringency or stringent condition
Thuja acid and include at least one CpG dinucleotides sequence segment；And/or
At least 15 cores of the hybridization in the SEQ ID NO:3 or its complementary series under moderate stringency or stringent condition
Thuja acid and include at least one CpG dinucleotides sequence segment.
11. according to oligonucleotides described in item 10, further include:
The preferentially blocking agent in conjunction with the target sequence in non-methylation state.
12. a kind of oligonucleotides for the vitro detection cancer of the esophagus comprising:
The sequence of SEQ ID NO:5 and SEQ ID NO:6.
13. according to oligonucleotides described in item 12, further include:
The sequence of SEQ ID NO:7.
14. according to oligonucleotides described in item 13, further include:
The sequence of SEQ ID NO:8.
15. a kind of oligonucleotides for the vitro detection cancer of the esophagus comprising:
The sequence of SEQ ID NO:9 and SEQ ID NO:10.
16. according to oligonucleotides described in item 15, further include:
The sequence of SEQ ID NO:11.
17. according to oligonucleotides described in item 16, further include:
The sequence of SEQ ID NO:12.
Purposes of the 18.MT1A gene in the kit that preparation is used for the vitro detection cancer of the esophagus.
Purposes of the 19.EPO gene in the kit that preparation is used for the vitro detection cancer of the esophagus.
20. a kind of kit comprising composition described in any one of item 1~8 or including any one of item 9~17 institute
The oligonucleotides stated.
21. also including selected from following at least one other components according to kit described in item 20:
Buffer needed for nucleoside triphosphate, archaeal dna polymerase and the archaeal dna polymerase function.
22. the kit according to item 20 or 21, also includes: specification.
23. oligonucleotides described in any one of composition or 9~item of item 17 according to any one of item 1~8 exists
The purposes being used to prepare in the kit for the vitro detection cancer of the esophagus.
24. the purposes according to any one of item 18,19 and 23, wherein described for the vitro detection cancer of the esophagus
Kit detects the cancer of the esophagus by the method included the following steps:
1) separating in biological sample to be measured includes target gene target sequence or the DNA sample of its segment；
2) methylation state of the target gene target sequence is determined；
3) state of biological sample is judged by the testing result of the methylation state of the target gene target sequence, thus
Realize the vitro detection to the cancer of the esophagus.
25. according to purposes described in item 24, wherein described method includes following steps:
Extract the genomic DNA of biological sample to be measured；
Using reagent handle extract genomic DNA, make 5 unmethylated cytosine bases be converted into uracil or its
Its base；
The processed DNA sample of reagent is contacted with the primer of archaeal dna polymerase and target gene target sequence, and preferentially with
DNA polymerization reaction is carried out in the presence of the blocking agent that target sequence in non-methylation state combines；
With probe in detecting amplified production；And
It whether there is based on the amplified production, determine at least one CpG dinucleotides of the target gene target sequence
Methylation state.
26. according to purposes described in item 25, wherein the reagent is bisulfite agent.
27. a kind of method for detecting the cancer of the esophagus comprising following steps:
Separating in biological sample to be measured includes target gene target sequence or the DNA sample of its segment；
Determine the methylation state of the target gene target sequence；And
The state of biological sample is judged by the testing result of the methylation state of the target gene target sequence, thus real
Now to the vitro detection of the cancer of the esophagus.
28. a kind of method for detecting the cancer of the esophagus comprising following steps:
Extract the genomic DNA of biological sample to be measured；
Using reagent handle extract genomic DNA, make 5 unmethylated cytosine bases be converted into uracil or its
Its base；
The processed DNA sample of reagent is contacted with the primer of archaeal dna polymerase and target gene target sequence, and preferentially with
DNA polymerization reaction is carried out in the presence of the blocking agent that target sequence in non-methylation state combines；
With probe in detecting amplified production；And
It whether there is based on the amplified production, determine at least one CpG dinucleotides of the target gene target sequence
Methylation state.
29. the method according to item 27 or 28, wherein
The target gene is one or both of MT1A gene and EPO gene.
30. according to method described in item 29, wherein the target sequence of the MT1A gene is as shown in SEQ ID NO:1.
31. according to method described in item 29, wherein the target sequence of the EPO gene is as shown in SEQ ID NO:3.
32. according to method described in item 28, wherein the reagent is bisulfite agent.
33. according to method described in item 28, wherein the primer are as follows:
The SEQ ID NO:1 or at least nine nucleotide in its complementary series and include at least one CpG dinucleotides
The segment of sequence；And/or
The SEQ ID NO:3 or at least nine nucleotide in its complementary series and include at least one CpG dinucleotides
The segment of sequence.
33. according to method described in item 28, wherein the blocking agent be preferentially be in non-methylation state target sequence
In conjunction with blocking agent.
34. according to method described in item 28, wherein the probe are as follows:
At least 15 cores of the hybridization in the SEQ ID NO:1 or its complementary series under moderate stringency or stringent condition
Thuja acid and include at least one CpG dinucleotides sequence segment；And/or
At least 15 cores of the hybridization in the SEQ ID NO:3 or its complementary series under moderate stringency or stringent condition
Thuja acid and include at least one CpG dinucleotides sequence segment.
35. according to method described in item 33, wherein the primer is the sequence of SEQ ID NO:5 and SEQ ID NO:6,
Or it is the sequence of SEQ ID NO:9 and SEQ ID NO:10.
36. according to method described in item 33, wherein the blocking agent is the sequence or SEQ ID NO of SEQ ID NO:8:
12 sequence
37. according to method described in item 34, wherein the probe is the sequence or SEQ ID NO:11 of SEQ ID NO:7
Sequence.
The present inventor utilizes epigenomics and bioinformatics technique, passes through analysis human esophageal carcinoma and cancer
The full-length genome of other control tissue methylates data, finds two methylated genes relevant to the cancer of the esophagus, and determined this two
The target sequence of aberrant methylation occurs for a cancer of the esophagus methylated genes；Further, it was found by the inventors of the present invention that passing through the two
The target sequence of cancer of the esophagus methylated genes, can methylation state that is sensitive and specifically detecting the two genes, so as to
Detection for human peripheral blood dissociative DNA.It is aobvious by the detection to patient with esophageal carcinoma and the peripheral blood sample of normal control individuals
Show: the composition and detection method that the present invention describes can be sensitive and specifically detect the cancer of the esophagus, including two kinds of different cell classes
The common cancer of the esophagus of type: squamous carcinoma and gland cancer.Therefore, the present invention provides a kind of composition that can be used for the vitro detection cancer of the esophagus and
Detection method has important clinical value.
Other features and advantages of the invention will be explained in detail by following illustrating with claims.
Detailed description of the invention
Above and other feature of the invention will by with reference to the accompanying drawing and its detailed description be described further.It should
Understand, these attached drawings illustrate only several illustrative embodiments according to the present invention, therefore are not considered as pair
The limitation of the scope of the present invention.Unless stated otherwise, attached drawing is not necessarily to scale, and wherein similar label indicates class
As component.
The result figure of target gene of the invention is screened in Fig. 1 display.
Fig. 2 is to use composition provided by the invention and detection method dialogue cell genomic dna (target gene target sequence
The negative reference product of methylation state) and dnmt rna treated leucocyte genomic DNA (target gene target sequence
The positive reference product of methylation state) detection.As the result is shown: composition provided by the invention and detection method are to leucocyte base
Because the testing result of group DNA is feminine gender, the testing result to dnmt rna treated leucocyte genomic DNA is sun
Property.
Fig. 3 is using the composition and detection method, by detecting the methylation state of target gene target sequence, in fact
Now to the result figure of the external Non-invasive detection of the cancer of the esophagus.
Specific embodiment
On the one hand, the present invention provides a kind of composition for the vitro detection cancer of the esophagus, the composition includes being used for
Detect the nucleic acid of methylation state in the target sequence of target gene, wherein the target gene is in MT1A gene and EPO gene
One or two.
The present invention provides one group in the cancer of the esophagus issues the target gene target sequence of abnormal methylation, including MT1A gene
With the target sequence of EPO gene, the target sequence of MT1A gene is as shown in SEQ ID NO:1-2, the target sequence of EPO gene such as SEQ ID
Shown in NO:3-4.
The target sequence of MT1A gene is as shown in SEQ ID NO:1.
SEQ ID NO:1
CACCCAGGGGAGCTCAGTGGACTGTGCGCCTTGCCTTTCTGCTGCGCAAAGCCCAGTCCAGGTCATCAC
CTCGGGCGGGGCGGACTCGGCTGGGCGGACTCAGCGGGGCGGGCGCAGGCGCAGGGCGGGTCCTTTGCGTCCGGCCC
TCTTTCCCCTGACCATAAAAGCAGC
The complementary series of SEQ ID NO:1 is as shown in SEQ ID NO:2.
SEQ ID NO:2
GCTGCTTTTATGGTCAGGGGAAAGAGGGCCGGACGCAAAGGACCCGCCCTGCGCCTGCGCCCGCCCCGC
TGAGTCCGCCCAGCCGAGTCCGCCCCGCCCGAGGTGATGACCTGGACTGGGCTTTGCGCAGCAGAAAGGCAAGGCGC
ACAGTCCACTGAGCTCCCCTGGGTG
Preferably, the sequence of the target sequence of EPO gene is as shown in SEQ ID NO:3.
SEQ ID NO:3
CGCGCACGCACACATGCAGATAACAGCCCCGACCCCCGGCCAGAGCCGCAGAGTCCCTGGGCCACCCCG
GCCGCTCGCTGCGCTGCGCCGCACCGCGCTGTCCTCCCGGAGCCGGACCGGGGCCACCGCGCCCGCTCTGCTCCGAC
ACCGCGCCCCCTGGACAGCCGCCCTCTCCTCCAGGCCCGTGGGGCTGGCCCTGCACCGCCGAGCTTCCCGGGATGAG
GGCCCCCGGTGTGGTCACCCGGCGCGCCCCAGGTCG
The complementary series of SEQ ID NO:3 is as shown in SEQ ID NO:4.
CGACCTGGGGCGCGCCGGGTGACCACACCGGGGGCCCTCATCCCGGGAAGCTCGGCGGTGCAGGGCCAG
CCCCACGGGCCTGGAGGAGAGGGCGGCTGTCCAGGGGGCGCGGTGTCGGAGCAGAGCGGGCGCGGTGGCCCCGGTCC
GGCTCCGGGAGGACAGCGCGGTGCGGCGCAGCGCAGCGAGCGGCCGGGGTGGCCCAGGGACTCTGCGGCTCTGGCCG
GGGGTCGGGGCTGTTATCTGCATGTGTGCGTGCGCG
Preferably, the nucleic acid for detecting target gene methylation state includes at least nine in target gene target sequence
The segment of nucleotide, wherein the segment includes at least one CpG dinucleotides sequence.In certain preferred embodiments, such as
Sample to be tested DNA is converted using bisulfites, the nucleic acid for detecting target gene methylation state includes to mesh
The segment for marking at least nine nucleotide in the sequence after gene target sequence carries out bisulfite conversion, wherein the nucleotide
Segment include at least one CpG dinucleotides sequence.
It is highly preferred that the nucleic acid for detecting target gene methylation state be included in it is miscellaneous under moderate stringency or stringent condition
The segment of at least 15 nucleotide in the target gene target sequence is met at, wherein the segment of the nucleotide includes at least one
A CpG dinucleotides sequence.In certain preferred embodiments, such as sample to be tested DNA is converted using bisulfites,
Nucleic acid for detecting target gene methylation state is included under moderate stringency or stringent condition, hybridizes in target gene target sequence
The segment of at least 15 nucleotide after column progress bisulfite conversion in sequence, wherein the segment of the nucleotide includes extremely
A few CpG dinucleotides sequence.
Preferably, the composition further includes converting 5 non-methylated cytosine bases of target gene target sequence to
The reagent of uracil.It is highly preferred that the reagent is bisulfites.
Preferably, the nucleic acid for detecting target gene methylation state further includes preferentially and in non-methylation state
The blocking agent that DNA is combined.
Preferably, the composition includes one of following primer, probe and/or blocking agent or a variety of:
MT1A primers F
SEQ ID NO:5
CGGACGTAAAGGATTC
MT1A primer R
SEQ ID NO:6
GAAACGAACTCGACTAAACG
MT1A probe
SEQ ID NO:7
TGCGTTTGCGTTCGTTTCG
MT1A blocking agent
SEQ ID NO:8
CAAACTCAACTAAACAAACTCAACAAAACAAAC
EPO primers F
SEQ ID NO:9
AGTCGTAGAGTTTTTGGGTT
EPO primer R
SEQ ID NO:10
CAACGCGATACGACG
EPO probe
SEQ ID NO:11
CGCAACGAACGACCGA
EPO blocking agent
SEQ ID NO:12
GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
On the other hand, the present invention is provided to the oligonucleotides of the vitro detection cancer of the esophagus comprising: SEQ ID NO:1 or
At least nine nucleotide in its complementary series and include at least one CpG dinucleotides sequence segment；And/or SEQ ID
NO:3 or at least nine nucleotide in its complementary series and include at least one CpG dinucleotides sequence segment.
Preferably the oligonucleotides for being used for the vitro detection cancer of the esophagus include: to SEQ ID NO:1 or its complementary series into
The segment of at least nine nucleotide in sequence after row bisulfite conversion；And/or to SEQ ID NO:3 or its complementary sequence
It arranges at least nine nucleotide in the sequence after carrying out bisulfite conversion and includes at least one CpG dinucleotides sequence
Segment.
Oligonucleotides for the vitro detection cancer of the esophagus of the invention, further include: under moderate stringency or stringent condition
Hybridize at least 15 nucleotide in the SEQ ID NO:1 or its complementary series and includes at least one CpG dinucleotides
The segment of sequence；And/or hybridize in the SEQ ID NO:3 or its complementary series extremely under moderate stringency or stringent condition
Lack 15 nucleotide and includes the segment of at least one CpG dinucleotides sequence.
Preferably the oligonucleotides for being used for the vitro detection cancer of the esophagus include: under moderate stringency or stringent condition hybridization in
At least 15 nucleotide in sequence after carrying out bisulfite conversion to SEQ ID NO:1 or its complementary series and include to
The segment of a few CpG dinucleotides sequence；And/or under moderate stringency or stringent condition hybridization in SEQ ID NO:3 or
Its complementary series carry out bisulfite conversion after sequence at least 15 nucleotide and include at least one CpG dinucleotide
The segment of acid sequence.
Oligonucleotides for the vitro detection cancer of the esophagus of the invention, further include: preferentially and in non-methylation state
DNA combine blocking agent.
In a specific embodiment, the oligonucleotides for the vitro detection cancer of the esophagus comprising: SEQ ID NO:
The sequence of 5 and SEQ ID NO:6.Its further include: the sequence of SEQ ID NO:7.Its further include: the sequence of SEQ ID NO:8.
In another particular embodiment of the invention, the oligonucleotides for the vitro detection cancer of the esophagus comprising: SEQ ID
The sequence of NO:9 and SEQ ID NO:10.Its further include: the sequence of SEQ ID NO:11.Its further include: SEQ ID NO:12's
Sequence.
On the other hand, the present invention provides the kits including the composition.The kit also includes selected from following
At least one other component: buffer needed for nucleoside triphosphate, archaeal dna polymerase and the archaeal dna polymerase function.
The invention further relates to MT1A genes and/or EPO gene in the kit that preparation is used for the vitro detection cancer of the esophagus
Purposes.
Wherein, the MT1A is Metallothionein 1 A, English name metallothionein 1A, positioned at the 16th of the mankind the
The region q13 of number chromosome, belongs to metallothionein gene family.Metallothionein is a kind of small molecular protein, is rich in half Guang
Propylhomoserin lacks the amino acid containing aromatic radical, can combine divalent heavy metal ions.Metallothionein is a kind of antioxidant,
The free radical damage containing hydroxyl can be protected cells from, the balance of metal ions in cells is maintained, while playing removal weight
The effect of ion toxicity.The forfeiture of metallothionein gene function will lead to the pathological phenomenons such as the generation of cancer.
The EPO gene is erythropoietin gene, English name erythropoietin, positioned at No. 7 of the mankind
The region q22.1 of chromosome.The albumen of the coded by said gene is a kind of glycosylated cytokine secreted by cell
(cytokine).After erythropoietin(EPO) is in conjunction with corresponding receptor, the synthesis of red blood cell can be promoted.
In another aspect, the described method comprises the following steps the present invention provides a kind of method of vitro detection cancer of the esophagus:
1) the target gene target sequence or its segment in biological sample to be measured are separated；
2) methylation state of the target gene target sequence is determined；
3) state of biological sample is judged by the testing result of the methylation state of the target gene target sequence, thus
Realize the vitro detection to the cancer of the esophagus.
According to certain preferred embodiments, the method also includes following steps:
1) genomic DNA of biological sample to be measured is extracted；
2) reagent processing step 1 is used) obtained DNA sample, so that 5 unmethylated cytosine bases is converted into urine phonetic
Pyridine or other bases, the i.e. unmethylated cytosine base in the 5 of target gene target sequence are converted into uracil or other bases,
Base after conversion is different from 5 unmethylated cytosine bases in terms of cross performance, and is detectable；
3) it will be contacted through the processed DNA sample of step 2) with the primer of archaeal dna polymerase and the target gene target sequence,
So that the processed target gene target sequence is amplified to generate amplified production or not be amplified；The processed target
Gene target sequence can generate amplified production in case of DNA polymerization reaction；If the processed target gene target sequence is not
DNA polymerization reaction occurs, then is not amplified；
4) probe in detecting amplified production is used；And
5) it whether there is based on the amplified production, determine at least one CpG dinucleotide of the target gene target sequence
The methylation state of acid.
Preferably, typical primer includes the segment of the target gene target sequence, the piece of the target gene target sequence
Section is comprising being respectively equivalent to, being complementary to or hybridize under moderate stringency or stringent condition in selected from SEQ ID NO:1-2 and SEQ
The segment of at least nine nucleotide in ID NO:3-4.
Preferably, the segment of target gene target sequence described in typical probe, the segment packet of the target gene target sequence
Containing be respectively equivalent to, be complementary to or under moderate stringency or stringent condition hybridization in selected from SEQID NO:1-2 and SEQ ID NO:
The segment of at least 15 nucleotide in 3-4.
Preferably, typical blocking agent its for preferentially in non-methylation state DNA in conjunction with blocking agent.
Preferably, one of the primer, probe and/or blocking agent or a variety of as follows:
MT1A primers F
SEQ ID NO:5
CGGACGTAAAGGATTC
MT1A primer R
SEQ ID NO:6
GAAACGAACTCGACTAAACG
MT1A probe
SEQ ID NO:7
TGCGTTTGCGTTCGTTTCG
MT1A blocking agent
SEQ ID NO:8
CAAACTCAACTAAACAAACTCAACAAAACAAAC
EPO primers F
SEQ ID NO:9
AGTCGTAGAGTTTTTGGGTT
EPO primer R
SEQ ID NO:10
CAACGCGATACGACG
EPO probe
SEQ ID NO:11
CGCAACGAACGACCGA
EPO blocking agent
SEQ ID NO:12
GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
Also, the contact or amplification include using at least one following method: using hot resistant DNA polymerase as institute
Amplification enzyme is stated, has and can examine using the polymerase of shortage 5-3 ' 5 prime excision enzyme activity, using polymerase chain reaction (PCR), generation
The amplified production nucleic acid molecules of mark note.
According to certain preferred embodiments, the methylation shape of at least one CpG dinucleotides in the target gene target sequence
State is determined by the cycle threshold Ct value of PCR reaction.Pass through the method using DNA in PCR response analysis biological sample, energy side
Just the cycle threshold realizing the detection for target gene target sequence methylation state, and capable of being reacted according to PCR come it is quick,
Easily judge whether examined samples are positive, thus provides a kind of noninvasive, quick cancer of the esophagus external detection method.
The biological sample is selected from cell line, Histological section, tissue biopsy/paraffin embedding tissue, body fluid, excrement
Just, colonic effluent, urine, blood plasma, serum, whole blood, the haemocyte of separation, the cell that is separated from blood, or combinations thereof.
Preferred biological sample is blood plasma.
The present invention also provides the kits including the composition.Typically, the kit includes for accommodating
The container of patient biological samples.Also, the kit also includes the explanation for using and explaining testing result.
The methylation state that the present invention provides a kind of by detecting target gene target sequence, the external Non-invasive detection cancer of the esophagus
Method.The inventors discovered that the methylation state of MT1A gene and EPO gene target sequence and positive often feeding in human esophageal carcinoma
There are significant differences for the methylation state of the gene target sequence of tubing: in human esophageal carcinoma, MT1A gene and EPO
Gene target sequence methylates, and in normal esophageal tissue, MT1A gene and EPO gene target sequence do not methylate.
Therefore this application provides a kind of MT1A genes by detection sample and EPO gene target sequence methylation state to the cancer of the esophagus
Carry out vitro detection method, method provided by the invention can it is noninvasive, rapidly detect the cancer of the esophagus.
Unless otherwise defined, term and those skilled in the art in relation to technology and scientific in this specification lead to
What is understood is equivalent in meaning.Although can be applied and the similar or identical method and material around here in experiment or practical application
Material, herein still hereinafter describes material and method.It include wherein fixed with this specification in conflicting situation
Subject to justice, in addition, material, method and example are only for explanation, and it is without limitation.
The present invention also provides a kind of compositions that can sensitive and specifically detect target gene target sequence methylation state；
A kind of and method and kit that can be used for the external Non-invasive detection cancer of the esophagus.
Embodiment described below for composition of the invention, kit, nucleic acid sequence and detection method.First group real
The scheme of applying discloses target gene and target gene target sequence；Second group of embodiment is disclosed for detecting target gene target sequence
The composition of column methylation state, including the nucleic acid for detecting target gene target sequence methylation state；Third group embodiment party
Case discloses a kind of method for carrying out the external Non-invasive detection cancer of the esophagus by detecting target gene target sequence methylation state.
In some embodiments, the composition further includes by 5 of gene unmethylated cytosine base conversions
For the reagent of uracil.Preferably, which is bisulfites.The bisulphite modified of DNA is used to assess to be known
The tool of CpG methylation state.In the DNA of eukaryocyte, 5-methylcytosine is the most common covalent base modification.5- first
Base cytimidine cannot be identified by being sequenced, because 5-methylcytosine and cytimidine have identical base pairing behavior.In addition,
During PCR amplification, the epigenetic information that 5-methylcytosine carries then is lost completely.It is most commonly used to 5- in analysis DNA
Method existing for methylcystein is the idiosyncrasy based on bisulfites and cytimidine；After subsequent basic hydrolysis, do not have
There is the cytimidine of methylation to be converted into the uracil for corresponding to thymidine on Pairing behavior；But 5- methyl under these conditions
Cytimidine holding is not modified.Thus original DNA is converted by this method, so that originally cannot be with born of the same parents in its hybridization behavior
The 5-methylcytosine that pyrimidine distinguishes can be used as only surplus cytimidine now and be detected by conventional known molecular biology techniques
It arrives, such as by expanding and hybridizing.All these technologies are all based on different base pairing characteristics, can be fully utilized now
?.Therefore, typically, being used in combination this application provides bisulfites technology and one or more methylation assays is used
In the methylation state for determining the CpG dinucleotides sequence in target gene target sequence.In addition, method of the invention is suitable for analysis
Low concentration tumour cell in heterogeneous biological sample, such as blood or excrement.Therefore, when bis- core of CpG in this sample of analysis
When the methylation state of nucleotide sequence, quantitative determination process is can be used to determine specific CpG dinucleotides in those skilled in the art
The methylation level (such as percentage, number, ratio, ratio or degree) of sequence, rather than methylation state.Correspondingly, art
Language methylation status or methylation state should also be considered as the value for referring to reflection CpG dinucleotides sequence methylation state.
In some embodiments, the present processes specifically include: 1) extracting the genomic DNA of biological sample to be measured；
2) reagent processing step 1 is used) obtained DNA sample, so that 5 unmethylated cytosine bases is converted into uracil or other
Base, the i.e. unmethylated cytosine base in the 5 of target gene target sequence are converted into uracil or other bases, after conversion
Base is different from 5 unmethylated cytosine bases in terms of cross performance, and is detectable；It 3) will be through step 2) place
The DNA sample managed is contacted with the primer of archaeal dna polymerase and the target gene target sequence, so that the processed target base
Because target sequence is amplified to generate amplified production or be not amplified；The processed target gene target sequence is in case of DNA
Polymerization reaction can generate amplified production；If DNA polymerization reaction does not occur for the processed target gene target sequence, no
It is amplified；4) probe in detecting amplified production is used；5) it and based on the amplified production whether there is, determine the target gene target
The methylation state of at least one CpG dinucleotides of sequence.
Typically, it is described contact or amplification include using at least one following method: use hot resistant DNA polymerase as
The amplification enzyme；Use the polymerase for lacking 5-3 ' 5 prime excision enzyme activity；Use PCR；The amplification with detectable label is generated to produce
Object nucleic acid molecules.Preferably, methylation state is measured with PCR mode, such as " fluorescence-based real time pcr ", methyl
Change sensitive mononucleotide primer extension (Ms-SNuPE), methylation status of PTEN promoter (MSP) and the amplification of methylated CpG island
(MCA) etc. measuring methods be used to measure the methylation state of at least one CpG dinucleotides of target gene target sequence.Its
In, " fluorescence-based real-time PCR " is measured as high-throughput quantification methylation assay, uses fluorescence-based real-time PCR
(TaqMan) technology does not need further to operate after PCR step.In short, " fluorescence-based real-time PCR " method is with base
Because the mixing sample of group DNA starts, which is converted into methylation in sodium hydrogensulfite reaction according to standard operation
The mixing pit of the sequence difference of dependence.Then in " (biased) of offset " reaction (using the known CpG dinucleotides of overlapping
PCR primer) in carry out fluorescence-based PCR.Sequence differences can be generated in level of amplification and in fluorescence detection level of amplification.
" fluorescence-based real-time PCR " measures the quantitative test that may be used as methylation state in genome DNA sample, wherein sequence area
Distribution is raw on probe Hybridization levels.In the quantitative manner, exist in the fluorescence probe for being overlapped specific CpG dinucleotides
Under, PCR reaction provides the amplification of methylation specific.For originating being provided without offset control by following reaction for amount of DNA: wherein
Primer and probe does not cover any CpG dinucleotides." fluorescence-based real-time PCR " method can be with any suitable probe one
It rises and uses, such as " TaqMan ", " Lightcycler ".TaqMan probe is fluorescent reporter (Reporter) and quencher molecule
(Quencher) double labelling, and be designed to be specific to opposite high GC content area, so that it is in PCR cycle than forward direction
Or high about 10 DEG C of the temperature of reverse primer melts.This make TaqMan probe PCR anneal/extend in step keep sufficiently it is miscellaneous
It hands over.When Taq polymerase new chain of enzymatic synthesis in PCR, the TaqMan probe of annealing is eventually encountered.Taq polymerase 5 to 3 '
Endonuclease activity then will by digest TaqMan probe replace it, thus discharge fluorescent reporter molecule for using in real time
Its signal for not being quenched now of fluorescence detecting system quantitative detection.Typical examination for " fluorescence-based real-time PCR " analysis
Agent may include, but be not limited to: be used for target gene target sequence PCR primer；Non-specific amplification blocking agent；TaqMan or
Lightcycler probe；The PCR buffer and deoxynucleotide of optimization；And Taq polymerase etc..
Embodiment
Embodiment 1
Pass through the full-length genome of 233 human esophageal carcinomas of analysis and 171 normal oesophageal tissues methylation chip
(the HumanMethylation450k chip of Illumina company) data, the inventors discovered that MT1A gene and EPO gene exist
Methylation level in esophageal cancer tissue is significantly higher than normal oesophageal tissue (analysis result is as shown in Figure 1).Further, this hair
Probe sequence and the corresponding methyl rate that bright people is methylated on chip by analyzing MT1A gene and EPO gene in full-length genome
Data, it was found that the most apparent tract of the two target genes methylation differential in esophageal cancer tissue and normal oesophageal tissue
Section, so that it is determined that being the target sequence of the two target genes.The target sequence of MT1A gene is as shown in SEQ ID NO:1.MT1A base
The complementary series of the target sequence of cause is as shown in SEQ ID NO:2.The target sequence of EPO gene is as shown in SEQ ID NO:3.EPO base
The complementary series of the target sequence of cause is as shown in SEQ ID NO:4.
Embodiment 2
Step 1: obtaining the DNA of biological sample to be analyzed.The source can be any suitable source, such as cell
System, Histological section, biopsy, the tissue of paraffin embedding, body fluid, excrement, urine, blood plasma, serum, whole blood, the blood of separation are thin
Born of the same parents, the cell separated from blood and its all possible combination.Then it is separated by any standard approach in the prior art,
DNA is separated from the sample.In short, the biological sample must be broken and pass through when DNA is wrapped in cell membrane
Enzyme, chemically or mechanically means are cleaved.Albumen and other pollutants are for example then removed by the digestion of protein kinase K.
Then DNA is recycled from solution.This can realize by various methods, including saltouts, organic extraction or DNA is integrated to solid phase
Support.The influence that will receive many factors to the selection of method, the amount including time, expense and required DNA.When the sample
When product DNA is not wrapped in cell membrane (such as Circulating DNA from blood sample), it can be used and separate in the prior art
And/or the standard method of purifying DNA.These methods include using protein degradation reagent, such as chaotropic salt, such as guanidine hydrochloride or
Urea；Or detergent, such as dodecyl sodium sulfate (SDS), cyanogen bromide.Other methods include but is not limited to that ethanol precipitation or propyl alcohol are heavy
It forms sediment, pass through vacuum concentration of centrifugation etc..Those skilled in the art also can use device, such as the filter of such as ultrafiltration, silicon table
Face or film, magnetic-particle, granules of polystyrene, polystyrene surface, positively charged surface and the film with positive charge, band
Electrolemma, powered surfaces, electrification conversion film charge transfer surface.Once nucleic acid is extracted, just DNA is used to analyze.
In the present embodiment, biological sample DNA is that treated is white for leucocyte genomic DNA and dnmt rna
Cell genomic dna.The target gene target sequence of leucocyte genomic DNA is non-methylation state, therefore leucocyte gene
Group DNA is the negative reference product of target gene target sequence methylation state.Dnmt rna treated leucocyte genome
The target gene target sequence of DNA is methylation state, therefore treated that leucocyte genomic DNA is mesh for dnmt rna
Mark the positive reference product of gene target sequence methylation state.
Step 2: above two DNA sample is handled respectively, so that being turned in 5 unmethylated cytosine bases
Become uracil, thymidine or another base that cytimidine is not used in hybridization behavior.Preferably, pass through bisulfites
Reagent processing is to realize.Term " bisulfite agent " refers to the examination including bisulfites, acid sulphite or combinations thereof
Agent can be used for distinguishing as disclosed herein methylation and unmethylated CpG dinucleotides sequence.Preferably, the sulfurous acid
Hydrogen salt processing carries out in the presence of denaturing solvent, the denaturing solvent such as, but not limited to alkyl glycol, especially diethyl two
Alcohol dimethyl ether (DME), or carried out in the presence of dioxanes or dioxane derivative.In preferred embodiments, described
Denaturing solvent is used with the concentration of 1% to 35% (v/v).Further preferably the bisulfite reaction carries out in the presence of scavenger,
Such as, but not limited to chromogen alkane derivatives, such as 6- hydroxyl -2,5,7,8,-tetramethyl chromogen alkane 2- carboxylic acid or trihydroxybenzoic acid and
Its derivative, such as gallic acid.Bisulfites transformation preferably carries out under 30 DEG C to 70 DEG C of reaction temperature, wherein
Temperature increaseds to over 85 DEG C in short time during reaction.DNA through bisulf iotate-treated preferably carries out before quantitative pure
Change.This can be carried out by any method well known in the prior art, such as, but not limited to ultrafiltration.
Step 3: using the segment of primer of the invention and the amplification processed DNA of enzymatic amplification.It can be in the same reaction
The amplification of several DNA fragmentations is carried out in container simultaneously.Preferably, the length of the amplified production is 100 to 2,000 base
It is right.When the genomic DNA of biological sample to be detected is the mixture in methylation and non-methylation state, especially
In the case where the DNA in methylation state is far less than the DNA in non-methylation state, such as: cancer patient's peripheral blood
Middle dissociative DNA, in order to improve the specific amplification of PCR amplification primer, present invention employs target is used in PCR reaction system
The special blocking agent of gene target sequence.3 ' the end cores of 5 ends of blocking agent nucleotide sequence and positive (F) or reversed (R) primer
Nucleotide sequence has the overlapping region more than or equal to 5 nucleotide；Blocking agent and positive (F) or reversed (R) Primers complementary in
The same chain of target gene target sequence DNA；It is more than (packet that the melting temperature of blocking agent, which is higher than positive (F) or reversed (R) primer,
Include) 5 DEG C；The nucleotide sequence of blocking agent include at least one CpG dinucleotides sequence, and with after bisulfite conversion not
The sequence of the target gene target sequence DNA to methylate is complementary.Therefore, when the genomic DNA of biological sample to be detected
When being the mixture in methylation and non-methylation state, especially it is far less than in the DNA in methylation state and is in
In the case where the DNA of non-methylation state, the DNA in non-methylation state after bisulfite conversion, can preferentially with resistance
Disconnected agent combines, to inhibit DNA profiling in conjunction with PCR primer, because without PCR amplification, and in methylation state
DNA is not combined with blocking agent, thus in conjunction with primer, PCR amplification occurs.Later, directly or indirectly detection passes through amplification
The segment of acquisition.Preferably marker be fluorescent marker, radionuclide or the molecule fragment that can adhere to form.
According to target gene target sequence SEQ ID NO:1-2 and SEQ ID NO:3-4, devised in the present invention for examining
Survey primer, probe and blocking agent sequence (the SEQ ID NO:5- of the two target gene target sequence methylation states of MT1A and EPO
12):
Preferably, one of the primer, probe and/or blocking agent or a variety of as follows:
MT1A primers F
SEQ ID NO:5
CGGACGTAAAGGATTC
MT1A primer R
SEQ ID NO:6
GAAACGAACTCGACTAAACG
MT1A probe
SEQ ID NO:7
TGCGTTTGCGTTCGTTTCG
MT1A blocking agent
SEQ ID NO:8
CAAACTCAACTAAACAAACTCAACAAAACAAAC
EPO primers F
SEQ ID NO:9
AGTCGTAGAGTTTTTGGGTT
EPO primer R
SEQ ID NO:10
CAACGCGATACGACG
EPO probe
SEQ ID NO:11
CGCAACGAACGACCGA
EPO blocking agent
SEQ ID NO:12
GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
In the present invention, it can use standard operation according to prior art in various business real-time PCR instrument equipment
Carry out the detection of real-time PCR.According to certain specific embodiments, carried out on LifeTechnologies instrument (7500Fast)
The detection of real-time PCR.PCR reaction mixture is by DNA profiling 25-40ng and the 300-600nM primer through bisulfite conversion
With blocking agent, 150-300nM probe, 1UTaq polymerase, 50-400 μM of each dNTP, 1 to 10mM MgCl2It is slow with 2XPCR
It rushes to the volume of final 2 μ l to 100 μ l.Continue 3-60 minutes at 85 to 99 DEG C, and then to exist with pre- cyclic amplification sample
The annealing of 50 to 72 DEG C of progress 1 to 30 second 35-55 circulations, anneals at 45 to 80 DEG C and extends 5 to 90 seconds, 85 to 99
It is denaturalized 5 to 90 seconds at DEG C.By only on the target gene target sequence of methylation observe amplification, with contain 5-methylcytosine
Target gene target sequence the island CpG region specificity probe in detecting described in genetic fragment.Also, in certain specific implementations
It, can be using β actin gene (ACTB) as the internal reference of PCR, by using complementary with β actin gene sequence in mode
Primer create β actin gene amplicon, and with specific probe in detecting β actin gene amplicon.Each
Sample carries out real-time PCR at least once, in some specific embodiments, carries out real-time PCR detection twice or thrice.
Experimental result is shown as described in Figure 2: using composition provided by the invention and detection method dialogue cellular genome
There is no PCR amplification, testing result is yin for the detection of DNA (the negative reference product of target gene target sequence methylation state)
Property, it may be assumed that by inspection DNA sample target gene target sequence there is no methylation；Use composition provided by the invention and detection
Method is to dnmt rna treated the leucocyte genomic DNA (positive reference of target gene target sequence methylation state
Product) detection occur PCR amplification, testing result be the positive, it may be assumed that by inspection DNA sample target gene target sequence methylate.
Thus judge, composition provided by the invention and detection method can specifically detect the methylation shape of target gene target sequence
State.
Embodiment 3
According to the specific embodiment of the application, the testing result based on a certain number of cancer of the esophagus samples and normal sample
Average Ct values, be determined to the Ct value of the effective district point cancer of the esophagus and normal target gene, it may be assumed that critical value.Target gene target
The methylation state of at least one CpG dinucleotides of sequence is determined by the cycle threshold Ct value of polymerase chain reaction, is led to
Cross compare institute's test sample sheet Ct value and preset critical value, determine the analysis based on target gene the result is that feminine gender (just
Often), or it is positive (cancer of the esophagus).
The present embodiment the following steps are included:
Firstly, obtaining the plasma sample of 20 patient with esophageal carcinoma and 22 normal persons.All samples are really public from Bo Er
Department.Then the peripheral blood dissociative DNA of tested sample is extracted, and the DNA sample is pre-processed so that unmethylated at 5
Cytosine base is converted into uracil, thymidine or another base that cytimidine is not used in hybridization behavior.In this reality
It applies in example, the pretreatment is realized by bisulfite agent processing.Extracting and processing for the DNA can use existing skill
Any standard approach in art carries out, specifically, in the present embodiment, the extraction of all sample DNAs and bisulfite
Salt DNA modification is extracted by using the plasma treatment kit of the sincere company of Bo Er.
Then, above-mentioned mesh is added in above-mentioned treated 20 esophageal cancer patients and the DNA sample of 22 normal persons
Gene primer, probe and blocking agent combination are marked, the methylation state of target gene target sequence is detected by PCR.Wherein, this experiment
The PCR taken in example is carried out on Life Technologies instrument (7500).PCR reaction mixture is by through bisulfites
DNA profiling 35ng, 450nM primer and blocking agent of conversion, 225nM probe, 1UTaq polymerase, 200 μM of each dNTP,
The MgCl2 and 2XPCR of 4.5mM is buffered to the volume of 50 final μ l.Continue 20 minutes, at 94 DEG C with pre- cyclic amplification sample
And then product carry out the annealing of 5 seconds 45 circulations at 62 DEG C, anneal and extend 35 seconds at 55.5 DEG C, be denaturalized at 93 DEG C
30 seconds.
Finally, measuring the DNA sample of 20 esophageal cancer patients and 22 normal persons respectively for target gene target sequence
The Ct value of real-time PCR.Testing result is as shown in Figure 3: 1) selecting specific critical value, preferably critical value Ct=37, by making
Food can effectively be detected to the detection of target gene target sequence methylation state with composition provided by the invention and detection method
Pipe cancer patient；In this embodiment, when being critical value with Ct value 37, the spirit of the target gene target sequence DNA methylation assay cancer of the esophagus
Sensitivity is 55% (MT1A) and 45% (EPO) respectively；2) methylation of target gene target sequence has good specificity, to just
The detection displaying target gene target sequence methylation of ordinary person is 95% (MT1A) and 95% to the specificity that normal person detects
(EPO)；3) combine MT1A gene and EPO gene methylation testing result, the sensitivity for detecting the cancer of the esophagus can be improved to 60%, and
It is specific inconvenient, it is still 95%.
It is above-mentioned the experimental results showed that the methylate DNA of target gene target sequence is a kind of marker of the cancer of the esophagus.Pass through
Target gene target sequence methylate DNA detection of the invention, may be implemented the external Non-invasive detection cancer of the esophagus, and can be improved oesophagus
The recall rate of cancer.
In conclusion the application utilizes compositions as described above, nucleic acid sequence, kit and application thereof and above-mentioned
Detection method realizes by the nucleic acid sequence of the methylation of detection target gene target sequence and its segment and utilizes target gene
Target sequence methylation biomarker to carry out vitro detection to the cancer of the esophagus, to effectively increase the spirit of cancer of the esophagus vitro detection
Sensitivity and specificity.By the method using real-time PCR analysis plasma sample dissociative DNA, can conveniently realize for target
The detection of gene target sequence methylation state, and can according to the CT value of real-time PCR come quickly and conveniently judgement sample whether
It is positive, provides a kind of noninvasive, convenient and fast cancer of the esophagus external detection method.
Although various aspects of the invention and embodiment are disclosed, other aspect and embodiment are for this field skill
It is also obvious for art personnel.Various aspects and embodiment disclosed herein are for illustration purposes only, rather than limit mesh
's.Protection scope of the present invention and purport are only determined by appended claims.
Sequence table
<110>Bo Er really (Beijing) Science and Technology Ltd.
<120>for detecting composition of cancer of the esophagus and application thereof
<130> PA00035
<141> 2017-12-01
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 171
<212> DNA
<213>mankind (Homo sapiens)
<400> 1
cacccagggg agctcagtgg actgtgcgcc ttgcctttct gctgcgcaaa gcccagtcca 60
ggtcatcacc tcgggcgggg cggactcggc tgggcggact cagcggggcg ggcgcaggcg 120
cagggcgggt cctttgcgtc cggccctctt tcccctgacc ataaaagcag c 171
<210> 2
<211> 171
<212> DNA
<213>mankind (Homo sapiens)
<400> 2
gctgctttta tggtcagggg aaagagggcc ggacgcaaag gacccgccct gcgcctgcgc 60
ccgccccgct gagtccgccc agccgagtcc gccccgcccg aggtgatgac ctggactggg 120
ctttgcgcag cagaaaggca aggcgcacag tccactgagc tcccctgggt g 171
<210> 3
<211> 259
<212> DNA
<213>mankind (Homo sapiens)
<400> 3
cgcgcacgca cacatgcaga taacagcccc gacccccggc cagagccgca gagtccctgg 60
gccaccccgg ccgctcgctg cgctgcgccg caccgcgctg tcctcccgga gccggaccgg 120
ggccaccgcg cccgctctgc tccgacaccg cgccccctgg acagccgccc tctcctccag 180
gcccgtgggg ctggccctgc accgccgagc ttcccgggat gagggccccc ggtgtggtca 240
cccggcgcgc cccaggtcg 259
<210> 4
<211> 259
<212> DNA
<213>mankind (Homo sapiens)
<400> 4
cgacctgggg cgcgccgggt gaccacaccg ggggccctca tcccgggaag ctcggcggtg 60
cagggccagc cccacgggcc tggaggagag ggcggctgtc cagggggcgc ggtgtcggag 120
cagagcgggc gcggtggccc cggtccggct ccgggaggac agcgcggtgc ggcgcagcgc 180
agcgagcggc cggggtggcc cagggactct gcggctctgg ccgggggtcg gggctgttat 240
ctgcatgtgt gcgtgcgcg 259
<210> 5
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cggacgtaaa ggattc 16
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gaaacgaact cgactaaacg 20
<210> 7
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tgcgtttgcg ttcgtttcg 19
<210> 8
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
caaactcaac taaacaaact caacaaaaca aac 33
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agtcgtagag tttttgggtt 20
<210> 10
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
caacgcgata cgacg 15
<210> 11
<211> 16
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cgcaacgaac gaccga 16
<210> 12
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gagtttttgg gttattttgg ttgtttgttg 30
Claims (12)
1. a kind of composition for the vitro detection cancer of the esophagus, the composition include:
For detecting the nucleic acid of target gene methylation state,
Wherein, the target gene is one or both of MT1A gene and EPO gene.
2. composition according to claim 1, wherein the target sequence of the MT1A gene is as shown in SEQ ID NO:1.
3. composition according to claim 1, wherein the target sequence of the EPO gene is as shown in SEQ ID NO:3.
4. composition described in any one of claim 1 to 3, wherein described for detecting target gene methylation shape
The nucleic acid of state includes:
The segment of at least nine nucleotide in the target sequence of the target gene,
The segment includes at least one CpG dinucleotides sequence.
5. composition according to any one of claims 1 to 4, wherein described for detecting target gene methylation shape
The nucleic acid of state includes:
The segment of at least 15 nucleotide of the hybridization in the target gene target sequence under moderate stringency or stringent condition,
The segment includes at least one CpG dinucleotides sequence.
6. composition according to any one of claims 1 to 5, further include:
Convert 5 non-methylated cytosine bases of target gene target sequence to the reagent of uracil.
7. composition described according to claim 1~any one of 6, wherein described for detecting target gene methylation shape
The nucleic acid of state further include:
The preferentially blocking agent in conjunction with the target sequence in non-methylation state.
8. composition according to claim 7, wherein
The segment of at least nine nucleotide, the sequence for being SEQ ID NO:5 and SEQ ID NO:6 or its be SEQ ID
The sequence of NO:9 and SEQ ID NO:10,
The segment of at least 15 nucleotide, be SEQ ID NO:7 sequence or SEQ ID NO:11 sequence,
Blocking agent is the sequence of SEQ ID NO:8 or the sequence of SEQ ID NO:12.
9. composition described according to claim 1~any one of 8 is being used to prepare the reagent for the vitro detection cancer of the esophagus
Purposes in box.
10. purposes according to claim 9, wherein it includes such as that the kit for the vitro detection cancer of the esophagus, which passes through,
The method of lower step detects the cancer of the esophagus:
Separating in biological sample to be measured includes target gene target sequence or the DNA sample of its segment；
Determine the methylation state of the target gene target sequence；And
The state of biological sample is judged by the testing result of the methylation state of the target gene target sequence, thus realization pair
The vitro detection of the cancer of the esophagus.
11. purposes according to claim 9, wherein described method includes following steps:
Extract the genomic DNA of biological sample to be measured；
The genomic DNA extracted is handled using reagent, and 5 unmethylated cytosine bases is made to be converted into uracil or other alkali
Base；
The processed DNA sample of reagent is contacted with the primer of archaeal dna polymerase and target gene target sequence, and preferentially be in
DNA polymerization reaction is carried out in the presence of the blocking agent that the target sequence of non-methylation state combines；
With probe in detecting amplified production；And
It whether there is based on the amplified production, determine the first of at least one CpG dinucleotides of the target gene target sequence
Base state.
12. purposes according to claim 11, wherein the reagent is bisulfite agent.
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210026506.4A CN114369660A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN201711248825.5A CN109868320B (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN202210605952.0A CN115261467A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| EP18882701.8A EP3744858A4 (en) | 2017-12-01 | 2018-09-05 | Composition for detecting esophageal cancer and use thereof |
| KR1020207018984A KR102512282B1 (en) | 2017-12-01 | 2018-09-05 | Composition for detecting esophageal cancer and use thereof |
| JP2020545787A JP6924335B2 (en) | 2017-12-01 | 2018-09-05 | Compositions for detecting esophageal cancer and their use |
| PCT/CN2018/104076 WO2019105090A1 (en) | 2017-12-01 | 2018-09-05 | Composition for detecting esophageal cancer and use thereof |
| JP2021096963A JP7331043B2 (en) | 2017-12-01 | 2021-06-09 | Compositions and uses thereof for detecting esophageal cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711248825.5A CN109868320B (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210026506.4A Division CN114369660A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN202210605952.0A Division CN115261467A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109868320A true CN109868320A (en) | 2019-06-11 |
| CN109868320B CN109868320B (en) | 2022-06-21 |
Family
ID=66914486
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210605952.0A Pending CN115261467A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN202210026506.4A Pending CN114369660A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN201711248825.5A Active CN109868320B (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210605952.0A Pending CN115261467A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
| CN202210026506.4A Pending CN114369660A (en) | 2017-12-01 | 2017-12-01 | Composition for detecting esophageal cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (3) | CN115261467A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112662764A (en) * | 2020-03-17 | 2021-04-16 | 博尔诚（北京）科技有限公司 | Probe composition for detecting 11 cancers |
| CN114032307A (en) * | 2018-08-28 | 2022-02-11 | 博尔诚（北京）科技有限公司 | Composition for detecting esophageal cancer and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101331148A (en) * | 2005-12-14 | 2008-12-24 | 霍夫曼-拉罗奇有限公司 | New method for bisulfite treatment |
| US20110300536A1 (en) * | 2010-06-03 | 2011-12-08 | China Medical University | Gene marker and method for detection of oral cancer |
| CN103667344A (en) * | 2012-09-18 | 2014-03-26 | 上海吉凯基因化学技术有限公司 | Method for activating expression of erythrogenin genes |
| CN104513851A (en) * | 2013-10-08 | 2015-04-15 | 陈永恩 | Novel epigenetic biomarker for detecting bladder cancer and method thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102851354B (en) * | 2012-01-16 | 2014-06-11 | 中国人民解放军总医院 | Primer pair and kit for detecting methylation state of DNA at cell DACH1 gene promoter region |
| JP6731942B2 (en) * | 2014-12-19 | 2020-07-29 | エピゲノミクスアーゲー | Method for detecting CpG methylation and method for diagnosing cancer |
-
2017
- 2017-12-01 CN CN202210605952.0A patent/CN115261467A/en active Pending
- 2017-12-01 CN CN202210026506.4A patent/CN114369660A/en active Pending
- 2017-12-01 CN CN201711248825.5A patent/CN109868320B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101331148A (en) * | 2005-12-14 | 2008-12-24 | 霍夫曼-拉罗奇有限公司 | New method for bisulfite treatment |
| US20110300536A1 (en) * | 2010-06-03 | 2011-12-08 | China Medical University | Gene marker and method for detection of oral cancer |
| CN103667344A (en) * | 2012-09-18 | 2014-03-26 | 上海吉凯基因化学技术有限公司 | Method for activating expression of erythrogenin genes |
| CN104513851A (en) * | 2013-10-08 | 2015-04-15 | 陈永恩 | Novel epigenetic biomarker for detecting bladder cancer and method thereof |
Non-Patent Citations (4)
| Title |
|---|
| DIRK RADES M.D. ET AL.: "the impact of tumor expression of erythropoietin receptors and erythropoietin on clinical outcome of esophageal cancer patients treated with chemoradiation", 《SCIENCEDIRECT》 * |
| FIRLI RAHMAH PRIMULA DEWI ET AL.: "Methylation impact analysis of erythropoietin (EPO) gene to hypoxia inducible factor-1α(HIF-1α)activity", 《BIOINFORMATION》 * |
| 田子强等: "金属硫蛋白3在食管癌组织中的表达及其与金属硫蛋白1和2表达的关系", 《癌症》 * |
| 白剑等: "DNA甲基化与食管癌的研究进展", 《重庆医学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114032307A (en) * | 2018-08-28 | 2022-02-11 | 博尔诚（北京）科技有限公司 | Composition for detecting esophageal cancer and application thereof |
| CN112662764A (en) * | 2020-03-17 | 2021-04-16 | 博尔诚（北京）科技有限公司 | Probe composition for detecting 11 cancers |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115261467A (en) | 2022-11-01 |
| CN114369660A (en) | 2022-04-19 |
| CN109868320B (en) | 2022-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11840739B2 (en) | Gene composition for detecting cell proliferative abnormality or grading disease degree and use thereof | |
| CN109609629A (en) | Composition and application thereof for detecting liver cancer | |
| US20180258487A1 (en) | Composite biomarkers for non-invasive screening, diagnosis and prognosis of colorectal cancer | |
| PT1871912E (en) | Method for determining dna methylation in blood or urine samples | |
| CN108220428B (en) | Composition for detecting gastric cancer, kit and application thereof | |
| CN107475366A (en) | A kind of composition and its kit and purposes for being used to detect disease | |
| AU2012388616A1 (en) | Method for screening cancer | |
| CN106834426A (en) | Composition and application thereof for detecting cancer of pancreas | |
| JP2024020392A (en) | Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof | |
| CN110484621A (en) | A kind of method of liver cancer early warning | |
| JP2023513039A (en) | Composition for diagnosing bladder cancer using changes in CpG methylation of specific gene and use thereof | |
| JP7331043B2 (en) | Compositions and uses thereof for detecting esophageal cancer | |
| CN107868822B (en) | Composition for detecting esophagus cancer, kit and application thereof | |
| US11535897B2 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN107400704A (en) | A kind of composition and its application for breast cancer examination | |
| KR20100105770A (en) | Detection of gstp1 hypermethylation in prostate cancer | |
| CN109868320A (en) | Composition and application thereof for detecting cancer of the esophagus | |
| CN117344010B (en) | DNA methylation biomarker for diagnosing gastric cancer, kit and application | |
| CN111826440B (en) | Composition for detecting esophageal cancer and application thereof | |
| KR20230037111A (en) | Metabolic syndrome-specific epigenetic methylation markers and uses thereof | |
| JP2023521799A (en) | Composition for diagnosing colon cancer, rectal cancer, or colorectal adenoma using changes in CpG methylation of GLRB gene, and use thereof | |
| CN117721203A (en) | Composition for detecting thyroid cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230906 Address after: 100176 No.18, Hongda South Road, Beijing Economic and Technological Development Zone, Daxing District, Beijing Patentee after: BIOCHAIN (BEIJING) SCIENCE & TECHNOLOGY Co.,Ltd. Patentee after: Air Force Medical University Address before: 100176 10th floor, building 3, No.18 yard, Hongda South Road, Beijing Economic and Technological Development Zone, Daxing District, Beijing Patentee before: BIOCHAIN (BEIJING) SCIENCE & TECHNOLOGY Co.,Ltd. |