CN109868313A - Application of the HMGA2 gene in Stein-Leventhal syndrome disease - Google Patents
Application of the HMGA2 gene in Stein-Leventhal syndrome disease Download PDFInfo
- Publication number
- CN109868313A CN109868313A CN201810662426.1A CN201810662426A CN109868313A CN 109868313 A CN109868313 A CN 109868313A CN 201810662426 A CN201810662426 A CN 201810662426A CN 109868313 A CN109868313 A CN 109868313A
- Authority
- CN
- China
- Prior art keywords
- imp2
- hmga2
- reagent
- expression
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides pass through detecting come the method or kit of diagnosis of polycystic ovary syndrome to HMGA2-IMP2 approach.The present invention also provides pass through detecting come the method or kit of Diagnosis of Female granular cell exception to HMGA2-IMP2 approach.
Description
Technical field
The present invention relates to molecular biology and disease gene research and diagnostic fields.Specifically, the present invention relates to more capsule ovum
The relevant gene of nest syndrome and the gene are for studying or the application of diagnosis of polycystic ovary syndrome.
Background technique
Stein-Leventhal syndrome (Polycystic ovary syndrome, PCOS) is in a kind of complexity of the women of child-bearing age
Disease is secreted, whole world illness rate is 6% to 8% (Ehrmann DA etc., Diabetes care 1999;22:141-146).
The characteristics of Stein-Leventhal syndrome is hyperandrogenism, irregular menstruation and polycystic ovary form.The pathogenesis of PCOS is also not
Be fully apparent from, genetic predisposition has long been recognized, but exist between h and E factor complicated interaction (Chen ZJ etc.,
Nature genetics 2011;43:55-59).
High mobility group protein A2, i.e. HMGA2 (high mobility group AT-hook 2), are HMGA gene men
The member of race, containing there are three DNA binding structural domain (segment in AT-hook, with the ditch of DNA rich in AT interacts)
With the end C- tail (Reeves R etc., The Journal of biological chemistry 1990;265:8573-
8582).HMGA2 and adult stature (Weedon MN etc., Nature genetics 2007 has been displayed;39:1245-1250) and 2
Patients with type Ⅰ DM (T2D) (Voight BF etc., Nature genetics 2010;It is 42:579-589) related.In addition, having been reported that
The risk that PCOS women suffers from diabetes B increases (Wild S etc., Human fertility (Cambridge, England)
2000;3:101-105).HMGA2 is highly expressed in embryonic development and various cancers, it is meant that it may increase in control cell
Play a role (Zhou X etc., The Keio journal of medicine 1998 in growing;47:73-77).Existing research
Show that HMGA2 is related with cell Proliferation and breeding, but there is no HMGA2 report relevant to PCOS.
IGF2mRNA binding protein 2, i.e. IMP2 (IGF2mRNA-binding protein 2), are the early embryonic development phases
Between HMGA2 target gene (Brants JR etc., FEBS letters 2004;569:277-283).IMP2 contains RNA combination
6 features of module, including 2 N-terminal RNA identifications motif (RRM1 and RRM2) and 4 C-terminal hnRNP K- homologys
(KH1-KH4) structural domain (Christiansen J etc., Journal of molecular endocrinology2009;43:
187-195).Genome-wide association study (genome-wide association study, GWAS) has determined that IMP2 loses
It passes and is associated with (Saxena R etc., Science 2007 between variance and diabetes B risk;316:1331-1336).
Imp2-/- mouse obtains improved glucose tolerance, the resistance of insulin sensitivity and the obesity to diet induced.However,
IMP2 was not reported before the effect in granular cell (GC) proliferation.
During entire Oocyte Development, egg mother cell and surrounding granular cell (granulosa cell,
GC there are relation of interdependence between).Proof is had been reported that, granular cell provides nutrition and growth regulating for egg mother cell
Agent, and egg mother cell promotes the growth and differentiation of granular cell.Granulosa cell proliferation may cause abnormal ovulation extremely
(Erickson GF etc., Human reproduction 1992;7:293-299).It is found in primate PCOS model, PCOS
Each stage all growth folliculus (Hughesdon PE.Obstetrical& containing extra quantity of the ovary in development
gynecological survey 1982;37:59-77), and the growth folliculus of extra quantity is related to the increase that GC is proliferated
(Vendola KA etc., The Journal of clinical investigation 1998;101:2622-2629).It is clinical
Research also shows that the GC in the ovary of No-clay weak interbed PCOS women is proliferated increases (Stubbs SA compared with normal No-clay weak interbed PCOS
Deng The Journal of clinical endocrinology and metabolism 2007;92:4418-4426).
This field also needs a kind of pair of Stein-Leventhal syndrome (PCOS) to be detected or diagnosed, e.g. more acurrate and fast
The method and kit that fast ground detects PCOS or diagnosed by protein expression level in granular cell.
Summary of the invention
Present invention firstly discovers that HMGA2-IMP2 approach takes part in the ovarian granulosa of Stein-Leventhal syndrome (PCOS) women
The proliferation of cell (granulosa cell, GC).Inventor has found overexpression of the HMGA2 or IMP2 in gonad granulocyte
Granulosa cell proliferation is caused to increase, so as to cause more capsule phenotypes.Present invention finds the PCOS that HMGA2-IMP2 approach mediates
The mechanism of dysfunction thus provides the method and drug or kit for the treatment of and diagnosis of polycystic ovary syndrome (PCOS),
The method of PCOS is detected or diagnosed especially in subject's granular cell sample and for the kit of these methods.
In one aspect of the invention, the present invention provides detection or the method for diagnosis of polycystic ovary syndrome,
In include detection subject HMGA2-IMP2 approach exception.In wherein another aspect of the invention, provide detection by
The abnormal reagent of the HMGA2-IMP2 approach of examination person is used to prepare the use of the kit of detection or diagnosis of polycystic ovary syndrome
On the way.Preferably, the detection or diagnosis are carried out to the granular cell sample of subject.The kit may include extract/point
Explanation and reagent from granular cell.
In terms of another one of the invention, the present invention provides detection or Diagnosis of Female granular cell it is abnormal (such as
Proliferative disorder) method, including detection subject HMGA2-IMP2 approach exception.It is of the invention wherein another
Aspect, the abnormal reagent for providing the HMGA2-IMP2 approach of detection subject is used to prepare detection or Diagnosis of Female particle is thin
The purposes of the kit of born of the same parents' abnormal (such as abnormality proliferation).Preferably, the detection or diagnosis are the granular cells to subject
Sample carries out.The kit may include extraction/separation granular cell explanation and reagent.
HMGA2 (high mobility group AT-hook 2), i.e. high mobility group protein A2 is HMGA gene man
Member (Reeves R etc., The Journal of the biological chemistry 1990 of race;265:8573-8582),
It is encoded by HMGA2 gene (HGNC:5009).IMP2 (IGF2mRNA-binding protein 2), i.e. IGF2mRNA combination egg
White 2, (Christiansen J etc., Journal of molecular is encoded by IGF2BP2 gene (HGNC:28867)
endocrinology 2009;43:187-195).
HMGA2-IMP2 approach or HMGA2-IMP2 signal system, the Intracellular signals for referring to HMGA2 and IMP2 pass
Guiding systems participate in mediated cell proliferation and differentiation (Brants JR etc., FEBS letters 2004;569:277-283;With
And Cleynen I etc., Molecular cancer research:MCR 2007;5:363-372).IMP2 is the target of HMGA2
(Zhang L etc., The American journal of surgical pathology 2011;35:868-872).HMGA2
The expression of IMP2 can be adjusted by transcription factor etc. (Cleynen I etc., Molecular cancer research:
MCR 2007;5:363-372).More broadly, HMGA2-IMP2 approach refers to including HMGA2 and IMP2 in the present invention
Participate in the cellular elements network that granular cell cell Proliferation is adjusted comprising albumen or nucleic acid tune in addition to HMGA2 and IMP2
Control the factor, such as CCND2 and SERBP1 (Hafner M etc., Cell 2010;141:129-141) etc..
CCND2 (G1/S-Specific Cyclin D2) belongs to cyclin family, by CCND2 gene (HGNC:
1583) it encodes, is the cycle regulating element of G1/S conversion, and by working in conjunction with cell cycle protein dependent kinase.
SERBP1 (SERPINE1MRNA Binding Protein 1), i.e. SERPINE1mRNA Binding Protein 1, by SERBP1 gene
(HGNC:17860) encode, by with PGRMC1 (PgR membrane complex -1) (Peluso JJ etc., Biology of
reproduction 2005;73:261-270) combine the Anti-G value for participating in mediating progesterone.
It include comparing subject in different times (such as in different onset rank to the detection of HMGA2-IMP2 approach exception
Section, or before the onset or treatment after) HMGA2-IMP2 approach involved in gene or its regulatory factor activity, or
The expression of albumen involved in HMGA2-IMP2 approach, or the gene or albumen with normal person in general or special group
The case where be compared, there are significant changes, be judged as existing abnormal.
In wherein another aspect of the invention, the detection to HMGA2-IMP2 approach includes detection HMGA2-IMP2 approach
Involved in gene or its regulatory factor activity or HMGA2-IMP2 approach involved in albumen expression.Of the invention
Wherein another aspect, the detection include detecting the expression of one or more of following albumen:
(a)HMGA2;
(b)IMP2;
(c)CCND2;Or
(d)SERBP1。
In one of embodiment of the invention, the detection includes the expression of detection IMP2.
In one of embodiment of the invention, the detection includes the expression of detection CCND2.
In one of embodiment of the invention, the detection includes the expression of detection SERBP1.
Any test sample known in the art can be passed through in the expression of one aspect of the invention, the albumen
The method of middle protein (expression) is detected.The method can check the existence or non-existence of the albumen.The method
It can also be with the amount of the expression of albumen described in quantitative detection.
The method of protein (expression) includes immunoassays in available test sample in the present invention
(immunoassay).Such as ELISA or Western blotting are carried out by the antibody of albumen described in specific recognition.Antibody can be with
It is monoclonal or polyclonal.Antibody can be humanization or chimeric.
The method of protein (expression) further includes detecting the mRNA of the albumen in available test sample in the present invention
Presence or its quantity, such as pass through the mRNA of albumen described in RT-PCR test sample or the amount of its segment.Detect albumen
The RT-PCR method and condition of mRNA is known to those skilled in the art or is easy to get.
The present invention also provides for studying or detecting or the kit or device of diagnosis of polycystic ovary syndrome, wherein wrapping
Include the abnormal reagent of the HMGA2-IMP2 approach of detection subject.In another aspect of the invention, the kit or dress
It sets for Stein-Leventhal syndrome to be studied or detected in granular cell sample.
The present invention also provides for studying or detecting or Diagnosis of Female granular cell abnormal (such as abnormality proliferation) proliferation
Kit or device, including the abnormal reagent of the HMGA2-IMP2 approach of detection subject.Of the invention another
A aspect, the kit or device are used to that Stein-Leventhal syndrome to be studied or detected in granular cell sample.The reagent
Box may include extraction/separation granular cell explanation and reagent.
In the present invention, it additionally provides through the adjusting of the HMGA2-IMP2 approach to patient and treats polycystic ovary synthesis
The method and drug or pharmaceutical composition of sign or women granular cell abnormal (such as proliferative disorder).In one of them of the invention
Aspect provides through the adjusting of the HMGA2-IMP2 approach of the granular cell to patient and treats Stein-Leventhal syndrome or female
Property granular cell abnormal (such as proliferative disorder) method and drug or pharmaceutical composition.The present invention provides for adjusting patient
The reagent of the HMGA2-IMP2 approach of granulocyte be used to prepare treatment Stein-Leventhal syndrome or women granular cell it is abnormal (such as
Proliferative disorder) method and drug or pharmaceutical composition.
Herein, albumen symbol does not have to italic, and all Caps;Gene symbol uses italic.But sometimes herein
Gene symbol does not use italic yet.Such as gene " HMGA2 " sometimes herein is also written as " HMGA2 ".
Present inventor has studied the biology of Stein-Leventhal syndrome (PCOS) pathogenesis of HMGA2 mediation for the first time
Function and mechanism are learned, and finds and prove that HMGA2 is highly expressed in the granular cell of PCOS and granular cell is promoted to increase for the first time
It grows.The proliferation of granular cell and differentiation are important follicular development.Before making the present invention, increase about granular cell in PCOS
The research report for growing approach is limited.Inventor has found that the activation of HMGA2/IMP2 approach promotes granulosa cell proliferation for the first time.Also,
Inventor has found that IMP2 is overexpressed in the GC of PCOS women for the first time.It is not bound by by constraining, it has been recognised by the inventors that in the PCOS,
The activation of HMGA2-IMP2 approach leads to the high expression of CCND2 and SERBP1 in granular cell, then increases the increasing of granular cell
It grows.
From clinical angle, serum FSH raising leads to successfully induced ovulation.And the undue growth of granular cell and early stage are raw
Long ovarian follicle ratio increases consistent (Webber LJ etc., Lancet (London, England) 2003;362:1017-1021).?
The hyper-proliferative of granulocyte may cause high-caliber serum estradiol, this may interfere Hypothalamus-Pituitary-Ovaries to believe in turn
Number axis (hypothalamic-pituitary-ovarian axis, HPOA).On the contrary, caused by high estrogen feeds back to hypophysis
The decline of FSH level causes ovulation to fail.The discovery of applicant further demonstrates the increase of PCOS female patient granulosa cell proliferation
Fresh evidence.
Currently, the result table including the external functional analysis in the gene expression and animal model in clinical sample
Bright, granulosa cell proliferation rate height leads to the abnormal folliculogenesis of PCOS women.
Without being bound by theory, applicant thinks present invention discover that the activation of HMGA2-IMP2 approach and insulin signaling pass
Lead correlation.HMGA2 may play the role of proliferation and Adipocyte Differentiation.In addition, HMGA2-IMP2 approach may also be in PCOS
It is activated in the adipose tissue of women.
To sum up, the present invention shows that HMGA2-IMP2 approach takes part in the ovary of Stein-Leventhal syndrome women for the first time
The Physiology and biochemistry mechanism of action of granulocyte.Moreover, the expression of inducible up regulation the target gene such as CCND2 and SERBP of IMP2 expression, from
And granulosa cell proliferation is caused to increase.In addition, overexpression of the HMGA2 in gonad granulocyte causes granulosa cell proliferation to increase
Add, so as to cause more capsule phenotypes.Present invention discloses the mechanism of Stein-Leventhal syndrome dysfunction, and thus provide and grind
Study carefully, diagnose or treat the method for Stein-Leventhal syndrome dysfunction.
Detailed description of the invention
Fig. 1 shows the expression of HMGA2 in PCOS patient's granular cell.A. in GC HMGA2 positioning.HMGA2 albumen is fixed
Positioned at the nucleus of mouse granulosa cells.Left figure is dyed with anti-HMGA2;Middle figure, is dyed with DAPI;Right figure merges dyeing.Than
Example ruler, 25 millimeters.B and C: the comparison of HMGA2 albumen (B) and mRNA (C) expression in the granular cell of control and PCOS patient.
PCOS patient HMGA2 is higher than control group.Data are standardized according to GAPDH.*, p < 0.05, * *, p < 0.01.
Fig. 2 shows the influence that siRNA and adenovirus express HMGA2 in KGN and SVOG cell.A and B: with control cell
It compares, HMGA2's strikes the low expression for reducing HMGA2mRNA (A) and protein (B) in KGN cell.Data according to GAPDH into
Row standardization.*, p < 0.05, * *, p < 0.01.The overexpression of C and D:HMGA2 gene increases in KGN and SVOG cell
HMGA2 protein level.
Fig. 3 shows the influence that HMGA2 is proliferated GC.A and B: the CCK8 of control and experimental cell measures, wherein under HMGA2
It adjusts or raises.It strikes low HMGA2 and reduces cell Proliferation (A), and the overexpression of HMGA2 increases cell Proliferation (B).*, p <
0.05, * *, p < 0.01.C-E: in control (D) and the Flow cytometry of the cell cycle of GC under low condition (E) is struck.It strikes low
HMGA2 expression causes G1 phase cell proportion to increase, the decline of S phase cell proportion.*, p < 0.05, * *, p < 0.01.
Fig. 4 shows that IMP2 strikes the influence that efficiency that is low and being overexpressed expresses IMP2.A and B: compared with NT siRNA,
IMP2's strikes the expression for subtracting and reducing IMP2mRNA (A) and protein (B) in KGN cell.Data carry out standard according to GAPDH
Change.*, p < 0.05, * *, p < 0.01.Overexpression of the C and D:IMP2 in KGN and SVOG cell increases IMP2 protein level.
The expression correlation of Fig. 5 HMGA2 and IMP2 in PCOS granular cell.A: in PCOS patient's granular cell
HMGA2 is horizontal related to IMP2mRNA.R2=0.6773.B and C: IMP2mRNA and protein table in control and PCOS GCs
It reaches.IMP2 level is higher than control cell in PCOS.Data are standardized *, p < 0.05, * *, p < 0.01 to GAPDH.D and E:
The western blot that HMGA2 is lowered in KGN cell or upper timing IMP2 is expressed.It strikes and subtracts HMGA2 and reduce IMP2, and HMGA2
Overexpression improves IMP2 level.
Fig. 6 shows the influence that IMP2 is proliferated GC.Localization of the IMP2 in GC.IMP2 albumen is positioned at the thin of mouse GC
In cytoplasm.Left figure is dyed with anti-IMP2;Centre panel is dyed with DAPI;Right figure merges dyeing.Scale bar, 25 millimeters.Christian era
Before.The CCK8 for the control and experimental cell that wherein IMP2 is lowered or raised is measured.Striking for IMP2 reduces cell Proliferation (B),
And the overexpression of IMP2 increases cell Proliferation (C).*, p < 0.05, * *, p < 0.01.D. in the case where compareing and striking low condition GC cell
The Flow Cytometry Assay in period.Strike subtract IMP2 expression cause G1 phase cell proportion increase and S phase cell proportion reduce.*, p <
0.05, * *, p < 0.01.
The flow cytometry of IMP2 on Fig. 7 KGN cell.A and B: in control (A) and the thin of GC under low condition (B) is struck
The Flow Cytometry Assay in born of the same parents' period.Striking low HMGA2 expression causes G1 phase cell proportion to increase, the decline of S phase cell proportion.*, p <
0.05, * *, p < 0.01.C:HMGA2 is overexpressed the influence to CCND2/SERBP1 protein expression in KGN cell.HMGA2's is excessive
Expression increases CCND2 and SERBP1 protein level.
Fig. 8 shows influence of the HMGA2 and IMP2 to SVOG cell Proliferation.HMGA2 (A) and IMP2 in A and B:SVGA cell
(B) overexpression increases cell Proliferation.*, p < 0.05, * *, p < 0.01
Fig. 9 is shown in CCND2 and SERBP1 expression in HMGA2-IMP2 approach.In A and B:CCND2 and SERBP1
IMP2 binding site.IMP2 is in conjunction with CCND2 and SERBP1mRNA.C: the RIP experiment in 293 cells.Use IMP2 antibody
CCND2 and SERBP1 protein is pulled down into (grey bar).IgG is added as negative control.GAPDH is used as control.D:HMGA2 strikes
The low influence to CCND2/SERBP1 protein expression in KGN cell.It strikes low HMGA2 and reduces CCND2 and SERBP1 protein level.
The influence that E:IMP2 expresses CCND2/SERBP1.Strike CCND2 the and SERBP1 protein water in low IMP2 reduction KGN cell
It is flat.IMP2 and downstream gene (CCND2, F in F and G:KGN cell;SERBP1, G) luciferase assay.Observe CCND2 and
The luciferase activity of SERBP1 increases with the increase that IMP2 is expressed in dose dependent.*, p < 0.05, * *, p < 0.01.
Figure 10 display control and CCND2 and SERBP1mRNA and protein expression in PCOS patient's granular cell.A and B:
CCND2mRNA and protein expression in control and PCOS patient's granular cell.They are higher than control cell in PCOS.Data
It is standardized according to GAPDH.*, p < 0.05, * *, p < 0.01.C and D: SERBP1mRNA in control group and PCOS GCs and
Protein expression.They are higher than control cell in PCOS.Data are standardized according to GAPDH.*, p < 0.05, * *, p <
0.01
Specific embodiment
Further illustrate that substantive content and beneficial effect of the invention, the embodiment are only used for below in conjunction with embodiment
Bright of the invention rather than limitation of the present invention.
Embodiment 1
Patient's collection
154 Han womens are recruited from Reproductive Medicine Center, Shandong University, wherein 96 people are PCOS patient, in addition 58 people are
Control.Every patient endorsed formal written consent.According to Rotterdam's diagnostic criteria (Rotterdam criteria (25))
PCOS patient is selected: few-and/or No-clay weak interbed (oligo-and/or anovulation);Hyperandrogenism faces
Bed and/or biochemical indicator;With the polycystic ovary for excluding other hyperandrogenism reasons, such as hyperprolactinemia is secreted male sharp
The tumour of element, Cushing syndrome and atypia adrenal,congenital hyperplasia.The age of all women between 20 to 35 years old,
Every>=1 month at least two serum sample FSH concentration<10IU/L and AMH>1ng/mL.Control subject is age-matched
Women, has the regular period, and normal Endocrine basis parameter and bilateral antral follicle count count (single antral follicle count counting
=6-10), and there is no family's diabetic history or glucose disorders.Exclusion criteria includes at present or in the recent period using sugared cortical hormone
Element, adrenal,congenital hyperplasia, hyperprolactinemia, dysthyreosis, gestation or recruit preceding 3 months in take take orally keep away
Pregnant medicine.With IR scoring (HOMA-IR=fasting insulin × fasting blood-glucose/22.5) >=2.57 in Homeostasis model assessment
Body is classified as insulin resistant group (26).
The research of the application obtains the examination & approval of Shandong University's reproductive medicine research institute (Jinan China) ethics.It is described herein
All methods are carried out according to the guide and regulations of the approval of reproductive medicine research institute, Shandong University.
2 experimental method of embodiment and reagent
The acquisition of ovarian stimulation and granular cell
Ovarian stimulation and egg mother cell acquisition (27) are carried out using Long-acting GnRH agonist scheme.With
In the ultrasound of follicular development and carrying out once for blood sampling every 1-3 days to estradiol (E2) and progesterone (P4) level.Ovarian follicle is abundant
After development, apply human chorionic gonadotrophin (hCG).It is pierced by the needle that Transvaginal Ultrasound guides within 36 hours after hCG administration
Diameter > 15mm ovarian follicle is carried out taking ovum.It, will be in no more than 3 embryo implantation uterine cavity after taking ovum in 3 days.From extraction ovum
Start on the day of mother cell, women receives hCG or P4 treatment.Urine and the serologic test of hCG are carried out within 14 days after embryo transfer.?
Ultrasonic examination is carried out in the case that hCG is positive, after 2 weeks to determine clinical pregnancy.When taking ovum, folliculi liquor aspirate is collected
In sterile tube and it is centrifuged.According to reported method (28), with Ficoll-Percoll (Solarbio-Life-Sciences,
Beijing, China) separation GCs.
Cell culture
Animal conservation is in Shandong University's Experimental Animal Center.Mouse primary ovary GC divides on the 21st day from ovary after birth
From progress PMSG (pregnant mother's priatin) processing after 24 hours.
By HEK293 cell line be supplemented with 10% fetal calf serum (BI, 04-001-1ACS) and 100U/mL benzyl penicillin and
The high glucose DMEM (HyClone, SH30243.01B) of 0.1mg/mL streptomycin sulphate (HyClone, SV30010), at 37 DEG C
And 5%CO2Humidified incubator in cultivate.SVOG (is provided) by University of British Columbia Peter professor C.K.Leung.
The cell that the big T- antigen of the SV40 separated from the women that IVF is treated transfects obtains immortalization people GC cell strain (29), people
Granular tumor cell line KGN (come from RIKEN BioResource Center, Ibaraki, Japan) is at 37 DEG C, 5%CO2,
It is being supplemented with 10% fetal calf serum (Hyclone Laboratories), 100U/mL benzyl penicillin and 0.1mg/mL streptomycin sulphate
(Invitrogen) (30) are cultivated in DMEM/F12 culture medium (HyClone).
Immunofluorescence
Immunofluorescence assay is carried out using the GC of culture.It is fixed with 4% paraformaldehyde and is closed with 5%BSA.By cell with
Anti- HMGA2 antibody (Abcam, #ab184616), anti-IMP2 antibody (Cell Signaling, #14672) is with 1:100 in 4 DEG C of temperature
It educates overnight.Then, the secondary antibody of cell and fluorescent marker is incubated for 1 hour.
The building of adenovirus and slow virus carrier
The adenovirus (VH893703) for expressing HMGA2, expresses slow virus (CH884509) and the green fluorescent protein of IMP2
(CV0001) purchased from Vigene Bioscience Company (Jinan, China).
SiRNA and transfection
For HMGA2, ON-TARGET plus SMART pool siRNA and the CONTROL NON- of IMP2
TARGETING pool siRNA (Dharmacon, GE Healthcare Life Technologies) is transfected with 50nM.Make
It is transfected cell 48 hours with X-treme GENE siRNA transfection reagent (Roche, Penzberg, Germany) siRNA.
Real-time RT-PCR
Total serum IgE is extracted from the GC of culture using TRIzol reagent (Takara Bio Inc., Dalian, China), and is used
The kit of Prime Script RT reagent with gDNA Eraser (Takara Bio Inc., Dalian, China) is inverse by its
It is transcribed into cDNA.PCR is carried out using SYBR Premix Ex Taq.Primer sequence is as follows:
Real-time PCR is carried out using Roche LightCycle 480 (Roche, Penzberg, Germany).House-keeping gene β-flesh
The expression of filamentous actin is used for gene expression normalization.The phase of genetic transcription object is calculated based on Ct value using comparison loop threshold method
To level.The expression of HMGA2mRNA and protein is measured using RT-PCR.
Western blotting Western Blot
After processing, GC and the cracking in the RIPA buffer (PMSF) containing 1mM phenylmethylsulfonyl fluoride are harvested.Equal protein
Matter electrophoresis on 10%SDS-PAGE, and band is transferred to PVDF membrane (Millipore, USA).Film is closed,
Then it is incubated together with relevant Primary antibodies.After washing, secondary antibody (middle mountain, the BeiJing, China) temperature of film and peroxidase conjugated
It educates 1 hour.It is detected and is analyzed immune with BIO-RAD ChemiDoc MP imaging system and Image Lab Software (U.S.)
React band.Anti- HMGA2 antibody (Abcam, #ab184616), anti-IMP2 antibody (Cell Signaling, #14672) resist
CCND2 antibody (Cell Signaling, #3741), anti-GAPDH antibody (Proteintech, #60004-1-Ig), anti-SERBP1
Antibody (Proteintech, #10729-1-AP).
Enhanced Cell counting Kit -8 (CCK8) analysis
It is seeded in 96 orifice plates with the cell that virus or siRNA transfect 24 hours with 1500 cells/wells, final volume is
100uL is simultaneously incubated overnight.CCK8 (BeyotimeBiotechnology, Shanghai, China, C0042) measurement is used according to manufacturer
The influence that HMGA2/IMP2 grows cell and is proliferated.
Flow cytometry
Using in BD Cycletest Plus DNA kit (BD Biosciences, #340242) analysis cell suspension
Core DNA.It is incubated 72 hours by the cell inoculation of siRNA transfection in 6 orifice plates and at 37 DEG C.Then cell is collected, with buffering
Solution washs 3 times.Use propidium iodide (PI) dyeing and flow cytometry cell cycle distribution.
Rna binding protein immunoprecipitation
RNA is carried out using Magna RIPTM rna binding protein immunoprecipitation kit (Millipore) according to manufacturer
Immunoprecipitation (RIP).IMP2 antibody for RIP derives from Proteintech Group (#11601-1-AP).By using
The RNA of qRT-PCR detection co-precipitation.Using Magna RIP rna binding protein to rna binding protein immunoprecipitation (RBP-IP)
Main target precipitated.Use the antibody and a-protein magnetic bead progress immunoprecipitation for IMP2 or normal person IgG.Magnetic
The compound that pearl combines is fixed with magnet, and unbonded substance is rinsed with cleaning buffer solution.It will be immunized altogether with IMP2 antibody or IgG
The RNA of precipitating is eluted, reverse transcription, and passes through quantitative real-time PCR analysis.
Luciferase report gene measurement
By PCR amplification contain IMP2 binding site (CCND2:ACATTCCCATCACAACATTCCTCAG, SERBP1:
CTATAGAAAACACCTGCTACTCAAAACACAACTTCTCAGT the 3'-UTR sequence of CCND2 and SERBP1), and by its gram
It is grand to before the Gaussia luciferase genes site of pEZX-GA02 carrier (Genecopoeia).Use X-tremeGENE HP
DNA transfection reagent (Roche, Penzberg, Germany) and IMP2 expression vector (IMP2-pCDH) or control vector (pCDH)
293 cell of cotransfection.Using the bis- luminescent assay kits of Secrete-Pair TM (Genecopoeia, Guangzhou,
China.The luciferase activity of culture supernatant #SPGA-G010) is measured within 48 hours and 72 hours after transfection.By Gaussia
Luciferase (GLuc) activity criteria turns to secreted alkaline phosphatase luciferase (SEAP) activity to obtain transfection efficiency.It is empty
The activity of carrier is than being arbitrarily set as 1.0.Compare different groups of relative Luciferase activity (R.L.A).Each value represents extremely
The average value of few independent experiment three times.
Statistical analysis
Data are expressed as from at least three times average value ± SEM of independent experiment.Statistical comparison is using single factor test variance point
Analysis then carries out Tukey multiple comparative test.Statistical difference is set as P < 0.05.
Embodiment 3PCOS patient and control subject basis clinical indices
Measure the relevant Clinical symptoms of PCOS (table 1) in control group and clinical samples.Average BMI (the kg/ of PCOS patient
M2) it is 24.89, is higher than control group (21.76;p<0.05).In PCOS women, luteinising hormone (LH), total testosterone (TT) resists
Miao Le Shi hormone (AMH), fasting blood-glucose (FPG), fasting insulin (FINS), the indexs such as HOMA-IR are above control group, and ovum
Steeping stimulin (FSH) reduces.Progesterone does not have statistical difference between PCOS patient group and control group.
1 control group of table and clinical characteristic
All data are average value ± SD value
BMI, body mass index;E2, estradiol;P4, progesterone;PRL, prolactin;T, testosterone;FPG, fasting blood-glucose;FINS,
Fasting insulin;HOMA-IR, the Homeostasis model assessment of insulin resistant
aP < 0.05 compared with the control group
Embodiment 4HMGA2 is highly expressed in the granular cell of PCOS patient
HMGA albumen can by change chromatin Structure and/or by recruit other albumen to transcriptional regulatory compound come
It adjusts gene expression (31).In order to study whether HMGA2 albumen plays structure transcription factor, have detected in mouse GC
HMGA2 expression.Inventor has found that HMGA2 only expresses (A of Fig. 1) in the nucleus of GC.
By the analysis (C of the B and Fig. 1 of Fig. 1) of albumen and mRNA to HMGA2, find compared with control subject,
HMGA2 is highly expressed in the GC of PCOS patient women.
Embodiment 5HMGA2, which is overexpressed, promotes granulosa cell proliferation
In order to study whether the high expression of HMGA2 promotes granulosa cell proliferation and/or survival, KGN cell is transfected with siRNA
And carry out CCK8 experiment.
If the A and B of Fig. 2 are shown, compared with NT siRNA, the SiRNA in KGN cell realizes 60% HMGA2mRNA
It is low with striking for albumen.The overexpression of HMGA2 gene increases the HMGA2 protein level in KGN and SVOG cell.
As proved by CCK8 measurement, striking low HMGA2 causes to inhibit cell Proliferation (A of Fig. 3).In addition, using table
HMGA2 up to adenovirus is overexpressed HMGA2.Overexpression of the HMGA2 in KGN cell increases the level of HMGA2 protein expression
(C and D of Fig. 2) and the proliferation (B of Fig. 3) for increasing GC.
The influence of HMGA2 cell cycle distribution has been determined using flow cytometry.Compared with the control group, 72h after transfection,
G1 phase cell proportion increases, and S phase cell proportion declines (C, D and the E of Fig. 3;P<0.5).When being tested in SVOG cell
Have found similar result (B and C of Fig. 4).
Embodiment 6HMGA2 raises the IMP2 expression in PCOS patient's granular cell
HMGA2 mediates the mechanism of GC proliferation in order to better understand, has studied downstream gene access relevant to HMGA2.
In order to study IMP2 whether be HMGA2 target gene, analyze the mRNA level in-site of the IMP2 from clinical sample.
Inventors have found that HMGA2 and IMP2mRNA level is related to the GC of PCOS women (A of Fig. 5).
In addition, inventors have found that compared with the control, IMP2mRNA higher level (Fig. 5 in the granular cell of PCOS women
B);Compared with the control, the IMP2 protein level in the granular cell of PCOS women is also higher (C of Fig. 5).
Inventor also found, in KGN cell, HMGA2 strike it is low after, IMP2mRNA and protein all reduce (D of Fig. 3).
The overexpression of HMGA2 increases the expression (E of Fig. 3) of IMP2 in KGN cell.
The result shows that IMP2 is regulated and controled by HMGA2 in the GC of PCOS women.
The overexpression of embodiment 7IMP2 promotes granulosa cell proliferation
In order to study whether IMP2 participates in PCOS, following experiment has been carried out.
Firstly, positioning IMP2 albumen in mouse granulosa cells using immunofluorescence.It was found that IMP2 albumen concentrates on mouse
The cytoplasm (A of Fig. 6) of granular cell.
Secondly, determining whether the expression of IMP2 participates in cell Proliferation using CCK8 measuring method.As a result prove that striking for IMP2 subtracts
The proliferation (B of Fig. 6) in KGN cell is reduced, and the overexpression of IMP2 (slow virus of expression IMP2) increases cell Proliferation
(C of Fig. 6).
In addition, carrying out cell cycle analysis by flow cytometry.The results show that when IMP2 is struck low, S phase cell hundred
Divide than reducing, and G1 cell percentages increase (A and B of the D of Fig. 6, Fig. 7).Class is had found when being tested in SVOG cell
As result (A and B of Fig. 8).
Embodiment 8CCND2 and SERBP1 are regulated and controled by IMP2
To understand the mechanism that IMP2 adjusts GCs proliferation, the RNA (34) combined using HEK293 cell analysis by IMP2.
It was found that the protein stabilized said target mrna of IMP2 (A and B of Fig. 9) in conjunction with the 3'-UTR of CCND2 and SERBP1mRNA, IMP2.
In order to which Study on Endogenous IMP2 is whether in conjunction with CCND2 and SERBP1, RBP-IP reality has been carried out in 293 cells
It tests.RIP sequence in 293 cells is analysis shows that CCND2 and SERBP1mRNA surrounds (C of Fig. 9) by IMP2 antibody.HMGA2
Overexpression increase CCND2 and SERBP1 protein level (C of Fig. 7), and HMGA2 strikes low reduce in KGN cell
CCND2 and SERBP1 is horizontal (D of Fig. 9).In addition, low IMP2 reduction CCND2 and SERBP1 level is struck, and HMGA2 expression
Remain unchanged (E of Fig. 9).
In order to determine whether IMP2 passes through in conjunction with 3'-UTR regulating mRNA stability, with luciferase-CCND2 3'-UTR
Fusion constructs, luciferase-SerBP13'-UTR fusion constructs and IMP2 expression construct cotransfection HEK293 cell.
IMP2 overexpression cause the dose dependent of luciferase activity to increase (F and G of Fig. 9), show IMP2 combination CCND2 with
The 3'-UTR of SERBP1mRNA simultaneously increases protein expression.
Embodiment 9CCND2 and SERBP1 in the granular cell of PCOS patient highly expression using qRT-PCR and
Western Blot method has detected the expression of CCND2 and SERBP1 in PCOS women's granular cell.CCND2 and
SERBP1mRNA (A and C of Figure 10) and protein (B and D of Figure 10) increase in the granular cell of PCOS women.As it can be seen that
The high expression of CCND2 and SERBP1 increases the proliferation of GC and reduces Apoptosis.
The present invention shows that HMGA2-IMP2 approach takes part in the gonad granulocyte of Stein-Leventhal syndrome women for the first time
Physiology and biochemistry mechanism of action.Moreover, IMP2 expression inducible up regulation target gene such as CCND2 and SERBP expression, so as to cause
Granulocyte proliferation increases.In addition, overexpression of the HMGA2 in gonad granulocyte causes granulosa cell proliferation to increase, thus
Lead to more capsule phenotypes.Present invention discloses the mechanism of Stein-Leventhal syndrome dysfunction, and thus provide research, diagnosis
Or the method for the treatment of Stein-Leventhal syndrome dysfunction.
The above is the explanation carried out to the present invention, cannot be regarded as the limitation carried out to the present invention.Unless in addition referring to
Out, practice of the invention will use the routine techniques of organic chemistry, polymer chemistry, biotechnology etc., it is clear that except stating upper
Except being particularly described in bright and embodiment, the present invention can also be realized otherwise.Other aspects within the scope of the present invention
It will be apparent to those skilled in the art in the invention with improving.Introduction according to the present invention, many changes and variation are
It is feasible, therefore it is within the scope of the present invention.
DEG C if without particularly showing, the unit " degree " of herein presented temperature refers to degree Celsius, i.e.,.
The bibliography mentioned in this specification carries out disclosure by being cited in full text in this application.
Claims (10)
1. the reagent that the abnormal reagent for detecting the HMGA2-IMP2 approach of subject is used to prepare diagnosis of polycystic ovary syndrome
The purposes of box, or it is used to prepare the purposes of the kit of Diagnosis of Female granular cell abnormal (such as proliferative disorder).
2. the purposes of claim 1, including the reagent for the expression for detecting following albumen:
(a)HMGA2;
(b)IMP2;
(c)CCND2;Or
(d)SERBP1。
3. the purposes of claims 1 or 2, wherein the kit is for detecting the granular cell sample of subject.
4. the purposes of claims 1 or 2 including the reagent by immunoassays, such as passes through egg described in specific recognition
White antibody carries out ELISA or Western blotting to detect the reagent of the expression of the albumen;
Or
Including the reagent for detecting the expression of the albumen by the presence or its quantity of the mRNA for detecting the albumen, example
Such as pass through the reagent of the amount of the mRNA of encoding said proteins in RT-PCR test sample.
5. for diagnosis of polycystic ovary syndrome or the kit of Diagnosis of Female granular cell abnormal (such as proliferative disorder),
In include detection subject HMGA2-IMP2 approach abnormal reagent.
6. the kit of claim 5, including the reagent for the expression for detecting following albumen:
(a)HMGA2;
(b)IMP2;
(c)CCND2;Or
(d)SERBP1。
7. the kit of claim 5 or 6 is used to detect the granular cell sample of subject.
8. the kit of claim 5 or 6, wherein comprising the reagent by immunoassays, such as by described in specific recognition
The antibody of albumen carries out ELISA or Western blotting to detect the reagent of the expression of the albumen;
Or
It wherein include presence or its quantity by detecting the mRNA of the albumen to detect the reagent of the expression of the albumen, example
Such as pass through the reagent of the amount of the mRNA of encoding said proteins in RT-PCR test sample.
9. the reagent for detecting IMP2 expression in the granular cell sample of subject is used to prepare diagnosis of polycystic ovary syndrome or examines
The purposes of the kit of disconnected women granular cell abnormal (such as proliferative disorder).
10. the purposes of claim 9 including the reagent by immunoassays, such as passes through the anti-of specific recognition IMP2
Body carries out ELISA or Western blotting to detect the reagent of the expression of IMP2;
Or
The reagent of the expression of IMP2 is detected including by the presence or its quantity of the mRNA for detecting IMP2, such as is passed through
The reagent of the amount of the mRNA of IMP2 is encoded in RT-PCR test sample.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810662426.1A CN109868313A (en) | 2018-06-25 | 2018-06-25 | Application of the HMGA2 gene in Stein-Leventhal syndrome disease |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810662426.1A CN109868313A (en) | 2018-06-25 | 2018-06-25 | Application of the HMGA2 gene in Stein-Leventhal syndrome disease |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109868313A true CN109868313A (en) | 2019-06-11 |
Family
ID=66915404
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810662426.1A Pending CN109868313A (en) | 2018-06-25 | 2018-06-25 | Application of the HMGA2 gene in Stein-Leventhal syndrome disease |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109868313A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113049838A (en) * | 2019-12-27 | 2021-06-29 | 山东大学 | Polycystic ovarian morphology threshold and application thereof in diagnosis of polycystic ovarian syndrome |
CN113584145A (en) * | 2021-06-09 | 2021-11-02 | 广东省妇幼保健院 | Application of reagent for detecting PGRMC1 content in preparation of kit for diagnosing and predicting polycystic ovarian syndrome |
CN114931652A (en) * | 2022-06-23 | 2022-08-23 | 中国人民解放军陆军军医大学第一附属医院 | Application of Hmga2 gene in repairing damaged retina |
RU2807808C1 (en) * | 2023-03-31 | 2023-11-21 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Курский государственный медицинский университет" Министерства здравоохранения Российской Федерации | Set of primers and probes for genotyping of rs12566098 (cg) polymorphic locus of serbp1 gene in human using real-time pcr |
-
2018
- 2018-06-25 CN CN201810662426.1A patent/CN109868313A/en active Pending
Non-Patent Citations (6)
Title |
---|
CHEN H等: "Defective CFTR-regulated granulosa cell proliferation in PCOS", 《REPRODUCTION》 * |
CLEYNEN I等: "HMGA2 regulates transcription of the IMP2 gene via an intronic regulatory element in cooperation with nuclear factor-κB", 《MOL CANCER RES》 * |
JOHN J PELUSO等: "Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability", 《BIOL REPROD》 * |
LUCIE TOSCA等: "Metformin-Induced Stimulation of Adenosine 5’ Monophosphate-Activated Protein Kinase (PRKA) Impairs Progesterone Secretion in Rat Granulosa Cells", 《BIOLOGY OF REPRODUCTION》 * |
YING YANG等: "MicroRNA-33b-5p is overexpressed and inhibits GLUT4 by targeting HMGA2 in polycystic ovarian syndrome: An in vivo and in vitro study", 《ONCOL REP》 * |
曹永芝等: "Pcos易感基因HMGA2在小鼠子宫蜕膜化中的表达与调节", 《中国实验动物学报》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113049838A (en) * | 2019-12-27 | 2021-06-29 | 山东大学 | Polycystic ovarian morphology threshold and application thereof in diagnosis of polycystic ovarian syndrome |
CN113584145A (en) * | 2021-06-09 | 2021-11-02 | 广东省妇幼保健院 | Application of reagent for detecting PGRMC1 content in preparation of kit for diagnosing and predicting polycystic ovarian syndrome |
CN114931652A (en) * | 2022-06-23 | 2022-08-23 | 中国人民解放军陆军军医大学第一附属医院 | Application of Hmga2 gene in repairing damaged retina |
CN114931652B (en) * | 2022-06-23 | 2024-01-26 | 中国人民解放军陆军军医大学第一附属医院 | Application of Hmga2 gene in repairing damaged retina |
RU2807808C1 (en) * | 2023-03-31 | 2023-11-21 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Курский государственный медицинский университет" Министерства здравоохранения Российской Федерации | Set of primers and probes for genotyping of rs12566098 (cg) polymorphic locus of serbp1 gene in human using real-time pcr |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wang et al. | Ablation of LGR4 promotes energy expenditure by driving white-to-brown fat switch | |
Comstock et al. | Does an increased body mass index affect endometrial gene expression patterns in infertile patients? A functional genomics analysis | |
Rochester | Bisphenol A and human health: a review of the literature | |
Wei et al. | Reduced expression of biomarkers associated with the implantation window in women with endometriosis | |
Marlatt et al. | Distinct structural plasticity in the hippocampus and amygdala of the middle-aged common marmoset (Callithrix jacchus) | |
He et al. | H19 regulates trophoblastic spheroid adhesion by competitively binding to let-7 | |
CN109868313A (en) | Application of the HMGA2 gene in Stein-Leventhal syndrome disease | |
Zhang et al. | Progesterone regulates glucose metabolism through glucose transporter 1 to promote endometrial receptivity | |
CN112961913B (en) | Application of lncRNA in diagnosis and treatment of recurrent abortion | |
Lim et al. | TRADD, TRAF 2, RIP 1 and TAK 1 are required for TNF‐α‐induced pro‐labour mediators in human primary myometrial cells | |
CN105779589A (en) | miRNA biomarker for diagnosis of polycystic ovarian syndromes and application thereof | |
Stavrou et al. | TAAR1 induces a disturbed GSK3β phosphorylation in recurrent miscarriages through the ODC | |
Luo et al. | Binding of microRNA-135a (miR-135a) to homeobox protein A10 (HOXA10) mRNA in a high-progesterone environment modulates the embryonic implantation factors beta3-integrin (ITGβ3) and empty spiracles homeobox-2 (EMX2) | |
Yang et al. | Uterine expression of NDRG4 is induced by estrogen and up-regulated during embryo implantation process in mice | |
Zhang et al. | Regulatory effect of IL-38 on NF-κB pathway in systemic lupus erythematosus | |
Li et al. | Gonadotrophin‐releasing hormone receptor autoantibodies induce polycystic ovary syndrome‐like features in a rat model | |
CN115873937A (en) | Biomarker for predicting occurrence of repeated planting failure and application thereof | |
Yang et al. | TSH/miR-17-5p/ZNF367 axis is related to spontaneous abortion in patients with TSH above 2.5 mIU/L | |
CN113186275A (en) | Application of serum amyloid A1 in preparation of biomarker for diagnosing polycystic ovarian syndrome | |
US20210038688A1 (en) | Icam-1 marker and application thereof | |
Wang et al. | Effects of high-glucose and high-fat condition on estrogen receptor-and sexual precocity-related genes in GT1-7 cells | |
Wang et al. | Transcription Factor Yin Yang 1 Involves in Insulin Resistance-Polycystic Ovarian Syndrome by Regulating Sex Hormone Synthesis and Wnt/β-Catenin Signaling Pathway | |
Kalakota et al. | Endometrial adhesion G protein-coupled receptors are dynamically expressed across the menstrual cycle and expression is altered by ovarian stimulation | |
CN114438199B (en) | Application of BBOX1-AS1 AS recurrent abortion diagnosis marker and therapeutic target | |
Shen et al. | Effect of BMI on the value of serum progesterone to predict clinical pregnancy outcome in IVF/ICSI cycles: a retrospective cohort study |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |