CN109868306A

CN109868306A - A kind of the rapid amplifying kit and amplification method of CYP2C19 gene

Info

Publication number: CN109868306A
Application number: CN201711267084.5A
Authority: CN
Inventors: 不公告发明人
Original assignee: Xinkaiyuan Honghui (guangzhou) Biotechnology Co Ltd
Current assignee: Xinkaiyuan Honghui (guangzhou) Biotechnology Co Ltd
Priority date: 2017-12-05
Filing date: 2017-12-05
Publication date: 2019-06-11

Abstract

The invention discloses a kind of rapid amplifying kit of CYP2C19 gene and amplification methods, it wherein include three pairs of amplimers, Taq enzyme, dNTPs and buffer in kit, wherein amplimer is used to expand at least two SNP sites in CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type, and each pair of primer respectively corresponds the upstream and downstream region of one of SNP site.The present invention uses the amplification method of multiplex PCR, while expanding multiple important SNP sites of CYP2C19, and can flexible choice amplification according to actual needs Sites Combination, the multi-purpose effect of a box can be played, primer specificity in kit is high, and mismatch rate is low, primer length and T_mRationally, amplified production is convenient for detection separation for value design.A plurality of purpose product is once expanded, amplification efficiency is not only substantially increased, reduces amplification cost.

Description

A kind of the rapid amplifying kit and amplification method of CYP2C19 gene

Technical field

The present invention relates to a kind of rapid amplifying kit of CYP2C19 gene and amplification methods, belong to biological field, especially It is field of biological detection.

Background technique

Drug metabolic enzyme plays an important role during drug metabolism in vivo, and activity height directly determines drug effect Intensity and persistence.Cytochrome P450 (CYP450) is the main enzyme of the intracorporal drug metabolism of people, take part in 40%~ The metabolism of 50% marketed drug, active power are an important factor for determining drug metabolic rate.

CYP2C19 enzyme is known as S- mephenytoin -4- hydroxylase, is Cytochrome P450 family (CYP450) most important medicine One of object metabolic enzyme, the gene pleiomorphism of CYP2C19 affect clopidogrel, Omeprazole, dilantin sodium and diazepam etc. and are permitted The metabolism of drug.CYP2C19 enzyme is located in hepatomicrosome, and encoding gene is located at chromosome q24.1-24.3 of the mankind No. 10 Point, wild type are CYP2C19*1/*1 type, have normal enzymatic activity,.But often there is gene mutation in Chinese population, common mutations class Type is CYP2C19*2 type (the 5th exon G681A) and CYP2C19*3 type (the 4th exon G636A).CYP2C19*2 type and The enzymatic activity that CYP2C19*3 type can cause CYP2C19 gene to encode is lost, and the reduced capability of metabolism substrate increases blood concentration Height easily causes accumulation of poisoning in Normal therapeutic dose.Poor metabolizer 99% in Chinese population be CYP2C19*2 type and CYP2C19*3 type allele.Sim in 2006 etc. has found a kind of new CYP2C19 allele C YP2C19*17, has Mutational site is: -806C > T.CYP2C19*17 allele also has higher frequency to occur in crowd, CYP2C19*17 type The enzymatic activity enhancing for then causing CYP2C19 gene to encode, the ability enhancing of metabolism substrate, it is therefore desirable to increase drug dose.

There are many clinical or laboratory testing CYP2C19 gene pleiomorphism method at present, including PCR sequencing PCR, gene chips With fluorescence quantitative PCR method etc..But various detection methods are detected for single mononucleotide polymorphism site (SNP) , detection time is longer and testing cost is higher, but the frequency of mutation in above three mutational site is higher, and individually detection not only consumes When laborious and accuracy rate it is low, it is difficult to provide the qualitative conclusions in site in a short time.It thus can not real-time and accurately give tested Person is accurately metabolized outcome prediction and medication guide.

To sum up, it researches and develops a to this 3 sites CYP2C19 gene C YP2C19*2, CYP2C19*3 and CYP2C19*17 Polymorphism carries out the rapid amplifying box and amplification detection method of qualitative detection, is highly important.

Summary of the invention

In view of the above-mentioned problems existing in the prior art, the purpose of the present invention obtains a kind of rapid amplifying of CYP2C19 gene Kit and amplification method.

One of for achieving the above object, the technology of the rapid amplifying kit for the CYP2C19 gene that the present invention uses Scheme is as follows:

It include three pairs of amplimers, Taq enzyme, dNTPs and buffer in the kit, wherein amplimer is for expanding At least two SNP sites in CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type, each pair of primer respectively correspond wherein The upstream and downstream region of one SNP site.Three SNP sites are respectively corresponded comprising three pairs of primers in kit, and when amplification can be same When three SNP sites of amplification or arbitrarily two sites of selection expanded so that kit using more flexible, and three pairs Primer passes through careful design, and the high mispairing of amplification efficiency is low, amplified production easily detect it is easily separated, convenient for further sequencing or detection Work is gone on smoothly.

The amplification template sequence of CYP2C19*2 type is as shown in sequence table SEQ ID NO:1, the amplification mould of CYP2C19*3 type Plate sequence is as shown in sequence table SEQ ID NO:2, the amplification template sequence of CYP2C19*17 type such as sequence table SEQ ID NO:3 institute Show.

The three pairs of primers designed according to three SNP sites, that is to say, that be one by one between every pair of primers and amplified fragments Corresponding, the primer sequence of three pairs of primers is as shown in sequence table SEQ ID NO:4~SEQ ID NO:9, wherein SEQ ID NO:4 It is respectively the upstream and downstream amplimer of CYP2C19*2 type with SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 is respectively The upstream and downstream amplimer of CYP2C19*3 type, SEQ ID NO:8 and SEQ ID NO:9 are respectively the upper and lower of CYP2C19*17 type Swim amplimer.

In multiplexed PCR amplification, the additive amount of every group of amplification template and primer is identical as Standard PCR, adds between every group It measures identical, influencing each other between all primer and template when amplification can be made to be reduced to minimum in this way.

Amplification kit in the present invention is generally using processed DNA sample as amplification template, the general source of sample In people's whole blood or tissue, handling sample, can to reduce immunoglobulin G in blood, hemoglobin and lactoferrin anti-to PCR Answer the interference of system.

Preferably, whole blood sample PCR buffer is additionally provided in this kit, the buffer contains 100mmol/LTris- HCl, 50mmol/L KCl, pH 9.3~9.5.Whole blood sample PCR buffer is a kind of preferred embodiment of the invention, He can use the whole blood PCR reagent of type, the buffer and buffer formulation being not limited in the present invention.

Second object of the present invention is to provide a kind of amplification method using above-mentioned amplification kit, and the method is adopted With the multiplex PCR system of 25 μ L, specifically:

10×PCR buffer 2μL；

Mg²⁺(25mmol/L)1μL；

dNTPs(25mmol/L)0.6μL；

Taq enzyme (5U/ μ L) 0.3 μ L；

CYP2C19*2 type, CYP2C19*3 type and/or each 2 μ L of CYP2C19*17 pattern plate；

CYP2C19*2 type, CYP2C19*3 type and/or CYP2C19*17 type upstream and downstream primer (10 μm of ol/L) each 1 μ L；Its Middle primer is corresponding with the type of template and quantity,

Aseptic double-distilled water polishing is to 25 μ L.

According to the difference of the amplified band quantity of multiplex PCR, the additional amount of aseptic double-distilled water is adjusted, to guarantee reaction system It is complete.Since the amplification selection of this kit has CYP2C19*2 type and CYP2C19*3 type, CYP2C19*3 type and CYP2C19* Four kinds of 17 types, CYP2C19*2 type and CYP2C19*17 type, CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type situations, Therefore it according to the difference of amplification template, needs that the corresponding primer of template is added in system, and adjust the amount of water of whole system.

The multi-PRC reaction condition that this kit is recommended are as follows: 94 DEG C of initial denaturation 5.5min；Then 94 DEG C of denaturation 30s, 58 DEG C Anneal 45s, 72 DEG C of extensions 50s, after 36 recycle, 72 DEG C of extension 5min again.

Augmentation detection is generally carried out using the DNA sample after purification processes in this kit.But further include in this kit Whole blood amplification buffer, convenient for directly expanding collected people's whole blood sample, when amplification, is replaced with whole blood sample buffer Change the PCR buffer in existing PCR system.

Compared with prior art, the present invention uses the amplification method of multiplex PCR, while expanding the multiple important of CYP2C19 SNP site, and can flexible choice amplification according to actual needs Sites Combination, the multi-purpose effect of a box, reagent can be played Primer specificity in box is high, and mismatch rate is low, primer length and T_mRationally, amplified production is convenient for detection separation for value design.Once A plurality of purpose product is expanded, amplification efficiency is not only substantially increased, reduces amplification cost.This detection kit can extend It extends in other SNP site detections, there is good promotional value.

Detailed description of the invention

Fig. 1 is pcr amplification product electrophoretogram provided by the invention.

Specific embodiment

Below with reference to rapid amplifying kit and amplification method of the embodiment to CYP2C19 gene provided by the invention make into One step illustrates in detail, completely.The embodiments described below is exemplary, and for explaining only the invention, and should not be understood as Limitation of the present invention.

Experimental method in following embodiments is unless otherwise specified conventional method.Reality as used in the following examples It tests material unless otherwise specified, is that market is commercially available.

Rapid amplifying kit in the present embodiment carries out same for the higher SNP site of three frequencies for CYP2C19 When the multiple PCR reagent kit that expands, it is poly- including the upstream and downstream amplimer and amplification template, Taq DNA of three pairs of SNP sites Synthase, dNTPs and buffer.Taq archaeal dna polymerase is the Ex Taq archaeal dna polymerase of TaKaRa company.Three in the present embodiment A template is respectively CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type.

The DNA profiling used in the present embodiment kit is the DNA profiling that treated extracts, for people's whole blood of acquisition Or it for tissue, needs to be handled in advance.It, need to be using for whole blood if sample to be amplified is untreated whole blood sample The buffer of product PCR, wherein containing 100mmol/L Tris-HCl, 50mmol/L KCl, pH 9.3~9.5.

One, amplimer designs

In the present embodiment using multiplex PCR composite amplification CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type this Three sites carry out rapid amplifying to above-mentioned site, and specific sequence to be amplified is as follows:

CYP2C19*2 type genotypic sequences recorded in NCBI marked as rs4451645, sequence such as sequence table SEQ ID Shown in NO:1, wherein " R " represents SNP site, indicate that the variation in the site is A/G, specific as follows:

ATACATGGTGCTTGATAAGATCTGAAGATAGGTGAAGAGTAAGCATGTCCATTCATTGTTTAGTTGCCT ATCCATCCATTCATCCATTAATCCTTCCACCCATCCATCCTTTCATTCATGCATTCACCCAACCACCCATCTATCTA CTCATCCCTCCTATGATTCACCGAACAGTTCTTGCATATTCTGTCTGTGCCAGTTATAGAGACAGTGTTTGTCACTC TCACAGTTACACATGAGGAGTAACTTCTCCCT

R

TGTTTGTTATTTTCAGGAAAACGGATTTGTGTGGGAGAGGGCCTGGCCCGCATGGAGCTGTTTTTATTCCTGACCTT CATTTTACAGAACTTTAACCTGAAATCTCTGATTGACCCAAAGGACCTTGACACAACTCCT GTTGTCAATGGATTTGCTTCTGTCCCGCCCTTCTATCAGCTGTGCTTCATTCCTGTCTGAAGAAGCACAGATGGTCT GGCTGCTCCTGTGCTGTCCCTGCAGCTCTCTTTCCTCTGG

CYP2C19*3 type genotypic sequences recorded in NCBI marked as rs17885567, sequence such as sequence table SEQ Shown in ID NO:2, wherein " Y " represents SNP site, indicate that the variation in the site is C or T, specific as follows:

CCAACCCAGAGATGTTTGACCCTCGTCACTTTCTGGATGAAGGTGGAAATTTTAAGAAAAGTAACTACT TCATGCCTTTCTCAGCAGGTAATATAAATTTATTTCCCTTTGTGTTTCAGGGTACAAGATAACTTTTTTGATCAGTT GGAACTTACATGTGCCTTCTCTGCAGTGGTACAGTTACTCTTTGTACATGATCAAGAGCACTGTTCTGAATGCCTGT GTTTTCTCCGCTGGTGATACATCCTCATTATT

Y

GGCCAGATTAGTGGGTTTTGGAGAATTAATCCAATTCTTCCAAATTGAGAAAGCTGAAGTATAGGTTGG TTGAATTCTGCCTCTAGATACACCACTGAGGTACTCAAGAACTCCTCCTGGAAGATAAAACTAATTACATTTTCCTC ACTAGCCATGAGGAAGTTATCTCACTCCAGAACTTCACTGAGTGTCTTCCACATGGTGTCCCTCACCCCCTAGGCTG GGCTTGTAGGATAAAATTATCCTCAAACACAG

CYP2C19*17 type genotypic sequences recorded in NCBI marked as rs3814637, sequence such as sequence table SEQ Shown in ID NO:3, wherein " B " represents SNP site, indicate that the variation in the site is not in base A, specific as follows:

TTGGCTACAGTACTGAATCTTCAAGGCTCAGCCTCCTCATTCCTGAGATGGGTCAATTTTATTGTAAGC AAAGGCAATTGAGAGATTCCAAAGGGATATGAGGTGTGAGAATTCTCTCTAAATGGGGTTAGAATCCCTGTTAAAAA TGACCAGTGAAACATTGTGCAATTGTGTCTTAACATAACTTACTTTTTCTTAATAAGAGAACTGGAAATAACCTCAT TAGGAAATTTAGAACAAATA

B

GATGATATCTTTAAAGAAAATGGCTTTGTGTAAGTATTGTCGTTAGTGATCTAGTAATGTGTATCTTTC TGGTTGTATTTAGACCTTCAACTCAAATGTCAGCTCCCGTTAAGGTCTATACATTGTGGTGGTTTTGTGCTGTGGGT CCATTTAGTGATTTCCCTACCTCCCATCCTCTATTAGATTCACAACTGTTGTTCTGCCCATAATTTCCTATGCTTGC TTTGCATTGTTACATTTTTTTTTGAAAATCAGAAAGCAAAATCAATATAAAGCAGCCATGTCTGGAGGAGACCAGGA GGTCAAGAAGCCTTAGTTTCTCAAGCCCTTAGCACCAAATTCTCTGAGATCAGCTCTTCCTTCAGTTACACTGAGCA TTTCCCCTCTGCAGTGATGGAGAAGGGAGAACTCTTATTTTTTCTCATGAGCATCTCTGGGGCTGTTTTCCTTAGAT AAATAAGTGGTTCTATTTAATGTGAAGCCTGTTTTATGAACAGGATGAATGTGGTATATATTCAGAATAACTAATGT TTGGAAGTTGTTTTGTTTTGCTAAAACAAAGTTTTAGCAAACGATTTTTTTTTTCAAATTTGTGTCTTCTGTTCTCA AAGCATCTCTGATGTAAGAGATAATGCGCCACGATGGGCATCAGAAGACCTCAGCTCAAATCCCAGTTCTGCCAGCT ATGAGCTGTGTGGCACCAACAGGTGTCCTGTTCTCCCAGGGTCTCCCTTTTCCCATTTGAAATATAAAAAATAACAA TTCCTGCCTTCACGTGTTTTTTTAGGGGGTTAAATGGTAAAGGTGTTTATATCTGCTAAGGTAATTTACTTGATATA TGTTTGGTTATTGAAGAT

According to above-mentioned sequence design three to amplimer, primer sequence is specific as follows:

Two, multiplex PCR

The PCR system of 25 μ L is selected, wherein

10×PCR buffer 2μL；

Mg²⁺(25mmol/L)1μL；

dNTPs(25mmol/L)0.6μL；

Taq enzyme (5U/ μ L) 0.3 μ L；

CYP2C19*2 type, CYP2C19*3 type and each 2 μ L of CYP2C19*17 pattern plate；

CYP2C19*2 type, CYP2C19*3 type and CYP2C19*17 type upstream and downstream primer (10 μm of ol/L) each 1 μ L；

Aseptic double-distilled water polishing is to 25 μ L.

PCR reaction condition: 94 DEG C of initial denaturation 5.5min；Then 94 DEG C of denaturation 30s, 58 DEG C of annealing 45s, 72 DEG C of extension 50s, After 36 circulations, 72 DEG C of extension 5min again.

Three, PCR product is verified

2% agarose gel electrophoresis is selected, for electrophoretogram as shown in Figure 1, band 1 is DNA Marker, band 2 is negative right According to band 3 is amplified production, and electrophoresis result proves that amplification is errorless.

Sequencing will be sent after the recycling of electrophoresis result glue, sequencing result is also consistent with purpose product sequence.

Be it is necessary to described herein finally: above embodiments are served only for making technical solution of the present invention further detailed Ground explanation, should not be understood as limiting the scope of the invention, those skilled in the art's above content according to the present invention The some nonessential modifications and adaptations made all belong to the scope of protection of the present invention.

Sequence table

<110>Xiang Tan intelligence connection technique transfers promote Co., Ltd

<120>the rapid amplifying kit and amplification method of a kind of CYP2C19 gene

<130> 2017

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 511

<212> DNA

<213> Homo sapiens

<220>

<221> gene

<222> (1)..(511)

<223>CYP2C19*2 type genotypic sequences

<400> 1

atacatggtg cttgataaga tctgaagata ggtgaagagt aagcatgtcc attcattgtt 60

tagttgccta tccatccatt catccattaa tccttccacc catccatcct ttcattcatg 120

cattcaccca accacccatc tatctactca tccctcctat gattcaccga acagttcttg 180

catattctgt ctgtgccagt tatagagaca gtgtttgtca ctctcacagt tacacatgag 240

gagtaacttc tccctrtgtt tgttattttc aggaaaacgg atttgtgtgg gagagggcct 300

ggcccgcatg gagctgtttt tattcctgac cttcatttta cagaacttta acctgaaatc 360

tctgattgac ccaaaggacc ttgacacaac tcctgttgtc aatggatttg cttctgtccc 420

gcccttctat cagctgtgct tcattcctgt ctgaagaagc acagatggtc tggctgctcc 480

tgtgctgtcc ctgcagctct ctttcctctg g 511

<210> 2

<211> 511

<212> DNA

<213> Homo sapiens

<220>

<221> gene

<222> (1)..(511)

<223>CYP2C19*3 type genotypic sequences

<400> 2

ccaacccaga gatgtttgac cctcgtcact ttctggatga aggtggaaat tttaagaaaa 60

gtaactactt catgcctttc tcagcaggta atataaattt atttcccttt gtgtttcagg 120

gtacaagata acttttttga tcagttggaa cttacatgtg ccttctctgc agtggtacag 180

ttactctttg tacatgatca agagcactgt tctgaatgcc tgtgttttct ccgctggtga 240

tacatcctca ttattyggcc agattagtgg gttttggaga attaatccaa ttcttccaaa 300

ttgagaaagc tgaagtatag gttggttgaa ttctgcctct agatacacca ctgaggtact 360

caagaactcc tcctggaaga taaaactaat tacattttcc tcactagcca tgaggaagtt 420

atctcactcc agaacttcac tgagtgtctt ccacatggtg tccctcaccc cctaggctgg 480

gcttgtagga taaaattatc ctcaaacaca g 511

<210> 3

<211> 1101

<212> DNA

<213> Homo sapiens

<220>

<221> gene

<222> (1)..(1101)

<223>CYP2C19*17 type genotypic sequences

<400> 3

ttggctacag tactgaatct tcaaggctca gcctcctcat tcctgagatg ggtcaatttt 60

attgtaagca aaggcaattg agagattcca aagggatatg aggtgtgaga attctctcta 120

aatggggtta gaatccctgt taaaaatgac cagtgaaaca ttgtgcaatt gtgtcttaac 180

ataacttact ttttcttaat aagagaactg gaaataacct cattaggaaa tttagaacaa 240

atabgatgat atctttaaag aaaatggctt tgtgtaagta ttgtcgttag tgatctagta 300

atgtgtatct ttctggttgt atttagacct tcaactcaaa tgtcagctcc cgttaaggtc 360

tatacattgt ggtggttttg tgctgtgggt ccatttagtg atttccctac ctcccatcct 420

ctattagatt cacaactgtt gttctgccca taatttccta tgcttgcttt gcattgttac 480

attttttttt gaaaatcaga aagcaaaatc aatataaagc agccatgtct ggaggagacc 540

aggaggtcaa gaagccttag tttctcaagc ccttagcacc aaattctctg agatcagctc 600

ttccttcagt tacactgagc atttcccctc tgcagtgatg gagaagggag aactcttatt 660

ttttctcatg agcatctctg gggctgtttt ccttagataa ataagtggtt ctatttaatg 720

tgaagcctgt tttatgaaca ggatgaatgt ggtatatatt cagaataact aatgtttgga 780

agttgttttg ttttgctaaa acaaagtttt agcaaacgat tttttttttc aaatttgtgt 840

cttctgttct caaagcatct ctgatgtaag agataatgcg ccacgatggg catcagaaga 900

cctcagctca aatcccagtt ctgccagcta tgagctgtgt ggcaccaaca ggtgtcctgt 960

tctcccaggg tctccctttt cccatttgaa atataaaaaa taacaattcc tgccttcacg 1020

tgttttttta gggggttaaa tggtaaaggt gtttatatct gctaaggtaa tttacttgat 1080

atatgtttgg ttattgaaga t 1101

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*2 Forward primer sequence

<400> 4

ttgcatattc tgtctgtgcc ag 22

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*2 Reverse primer sequence

<400> 5

ataaaaacag ctccatgcgg gc 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*3 Forward primer sequence

<400> 6

tctacctgaa gagcaagtcc cc 22

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*3 Reverse primer sequence

<400> 7

cttccaggag gagttcttga gt 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*17 Forward primer sequence

<400> 8

aatggggtta gaatccctgt ta 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(22)

<223>CYP2C19*17 Reverse primer sequence

<400> 9

aatagaggat gggaggtagg ga 22

Claims

1. a kind of rapid amplifying kit of CYP2C19 gene, which is characterized in that include that three pairs of amplifications are drawn in the kit Object, Taq enzyme, dNTPs and buffer, wherein amplimer is for expanding CYP2C19*2 type, CYP2C19*3 type and CYP2C19* At least two SNP sites in 17 types, each pair of primer respectively correspond the upstream and downstream region of one of SNP site.

2. the rapid amplifying kit of CYP2C19 gene according to claim 1, it is characterised in that: CYP2C19*2 type Template sequence is expanded as shown in sequence table SEQ ID NO:1, the amplification template sequence of CYP2C19*3 type such as sequence table SEQ ID Shown in NO:2, the amplification template sequence of CYP2C19*17 type is as shown in sequence table SEQ ID NO:3.

3. the rapid amplifying kit of CYP2C19 gene according to claim 1, which is characterized in that three draw primer Object sequence is as shown in sequence table SEQ ID NO:4~SEQ ID NO:9, and wherein SEQ ID NO:4 and SEQ ID NO:5 is respectively The upstream and downstream amplimer of CYP2C19*2 type, SEQ ID NO:6 and SEQ ID NO:7 are respectively the upstream and downstream of CYP2C19*3 type Amplimer, SEQ ID NO:8 and SEQ ID NO:9 are respectively the upstream and downstream amplimer of CYP2C19*17 type.

4. the rapid amplifying kit of CYP2C19 gene according to claim 1, which is characterized in that the amplification system In, the amplimer of each SNP site and the additional amount of template are identical.

5. the rapid amplifying kit of CYP2C19 gene according to claim 1, which is characterized in that the amplifing reagent Box further includes whole blood sample PCR buffer, and the buffer contains 100mmol/L Tris-HCl, 50mmol/L KCl, pH 9.3~9.5.

6. a kind of amplification side of the rapid amplifying kit using CYP2C19 gene as claimed in any one of claims 1 to 5 Method, which is characterized in that the amplification system that the amplification method uses for the PCR system of 25 μ L, specifically:

10×PCR buffer 2μL；

Mg²⁺(25mmol/L)1μL；

dNTPs(25mmol/L)0.6μL；

Taq enzyme (5U/ μ L) 0.3 μ L；

CYP2C19*2 type, CYP2C19*3 type and/or CYP2C19*17 type upstream and downstream primer (10 μm of ol/L) each 1 μ L；Wherein draw Object is corresponding with the type of template and quantity,

Aseptic double-distilled water polishing is to 25 μ L.

7. the rapid amplifying method of CYP2C19 gene according to claim 6, which is characterized in that the amplification method Reaction condition are as follows: 94 DEG C of initial denaturation 5.5min；Then 94 DEG C of denaturation 30s, 58 DEG C of annealing 45s, 72 DEG C of extension 50s, 36 recycle Afterwards, 72 DEG C of extension 5min again.

8. the rapid amplifying method of CYP2C19 gene according to claim 6, it is characterised in that: for PCR amplification DNA sample is people's whole blood sample after extracting.

9. the rapid amplifying method of CYP2C19 gene according to claim 8, it is characterised in that: when using people's whole blood When product carry out PCR amplification, buffer uses whole blood sample PCR buffer in PCR amplification system.