CN109852700A - Methods and applications using HIF2 α mRNA relative to the expression quantity infering diing time of Caspase-3 - Google Patents

Abstract

The invention discloses a kind of methods and applications of expression quantity infering diing time using HIF2 α mRNA relative to Caspase-3.The primer sequence is shown in NO.1~4 SEQ ID；Method includes the following steps: (1) extracts the tissue of sample to be examined after death different time points, and carry out RNA, DNA and extract altogether, then reverse transcription prepares cDNA；(2) expression quantity of HIF2 α mRNA and Caspase-3 DNA in each time point are detected；(3) expression quantity of the HIF2 α mRNA relative to Caspase-3 DNA in each death time point is calculated, regression curve is established, obtains the equation of infering diing time.The present invention can accurately be inferred to the death time of the dead, facilitate the detection of case.

Description

Expression quantity infering diing time using HIF2 α mRNA relative to Caspase-3 Methods and applications

Technical field

The invention belongs to legal medical expert's detection technique fields, and in particular to a kind of to utilize HIF2 α mRNA relative to Caspase-3 Expression quantity infering diing time methods and applications.

Background technique

The deduction of death time is most important in medicolegal practice, the lockable crime time, facilitates the detection of case. About the deduction of death time, it is and to combine cadaveric ecchymoses cadaveric rigidity using the temperature inside corpse that legal medical expert, which practices common method, Situation is inferred.The method of this infering diing time is influenced by factors such as more environment temperature and humidity, age, diseases.

And potassium ion (K+) concentration in the ion concentration after death in corpse, such as vitreous humor, it can also be used to when dead Between deduction, but it is this detection potassium concentration accuracy because method difference due to generate difference.Since nucleic acid is by extraneous shadow Sound is smaller, and according to nucleic acid, such as DNA, RNA, the variation of content in after death corpse, the collective inference death time becomes medicolegal Research hotspot, but have not yet to see relevant report, therefore find DNA, RNA and become in changing rule after death and utilize nucleic acid progress The pith of corrupt corpse.

Summary of the invention

For above-mentioned deficiency in the prior art, the present invention provide it is a kind of using HIF2 α mRNA relative to Caspase-3 Expression quantity infering diing time methods and applications, can accurately determine the death time of the dead.

To achieve the above object, the technical solution adopted by the present invention to solve the technical problems is:

A kind of primer, the primer include the primer of the mRNA of hypoxia inducible factor HIF2 α, fragment length 79bp；With And the primer of Caspase-3 DNA, fragment length 157bp, particular sequence are as follows:

HIF2 α mRNA-F:GGGACGGTCATCTACAAC；(SEQ ID NO.1)

HIF2 α mRNA-R:TCTCGATCTCACTCAGCA；(SEQ ID NO.2)

Caspase-3 DNA-F:ATGTGGGGCCATCGTTACAG；(SEQ ID NO.3)

Caspase-3 DNA-R:CACCAGGTTGTCACAGGGTT.(SEQ ID NO.4)

A method of the expression quantity infering diing time using HIF2 α mRNA relative to Caspase-3, including it is following Step:

(1) tissue of sample to be examined after death different time points is extracted, and carries out RNA, DNA and extracts altogether, then reverses and records Standby cDNA；

(2) using cDNA as template, using above-mentioned primer, HIF2 α mRNA and Caspase-3 DNA are detected by RT-qPCR Expression quantity；

(3) expression quantity of the HIF2 α mRNA relative to Caspase-3 DNA in each death time point is calculated, is then established The regression curve of relative expression quantity and death time, and obtain the equation of infering diing time.

Further, the tissue in step (1) is brain tissue.

Further, the detailed process of brain tissue extraction are as follows: after sample to be examined is dead, collected every 0.5h primary to be checked Sample brain tissue.

Further, reverse transcription reaction system in step (1) are as follows: 1 μ L of reverse transcriptase, 0.5 μ L of random primer, dNTPs are pre- Mixed 1 μ L of liquid, 2 μ L of reaction buffer, altogether 1 μ L of extracting solution, finally complement to 10 μ L with RNase-free water.

Further, reverse transcription reaction condition in step (1) are as follows: 25 DEG C of 5min；60℃42min；70℃5min.

Further, in step (2) RT-qPCR reaction system are as follows: SYBR Green PCR reaction buffer premixed liquid 5 μ L, 1 μ L of DNA or cDNA template, 1 μ L of preceding primer, 1 μ L of rear primer, finally complement to 10 μ L with RNase-free.

Further, in step (2) RT-qPCR reaction condition are as follows: 95 DEG C, initial denaturation 15min；94 DEG C, it is denaturalized 15s； 55 DEG C, anneal 30s；72 DEG C, extend 34s, totally 40 circulations.

Application of the above method in detection mRNA label.

It is a kind of for carrying out the kit of dead deduction, including above-mentioned primer.

More specifically, the component which may also include are as follows:

A) amplified reaction mixed liquor: contain PCR buffer solution, MgCl₂, dNTPs, the common ingredient such as archaeal dna polymerase；

B) primer: particular sequence is as shown in NO.1~4 SEQ ID；

C) amplified production purified reagent: contain exonuclease 1 (ExoI) and its buffer solution (ExoI Buffer), shrimp The common ingredient such as alkaline phosphatase (SAP) and its buffer solution (SAP Buffer)；For the product after composite amplification to be carried out Purifying, in order to carry out next step operation；

Amplified reaction mixed liquor, amplified production purified reagent can be by formulas commonly used in the art or by molecular biology manual It is prepared, commercialized product also can be used directly；As for the template that DNA, RNA for extracting in sample to be detected are extracted altogether, The various conventional reagents that can be used this field current, extraction DNA profiling, which is referred to existing conventional method, to carry out.

Of the invention is effective are as follows:

Since Caspase-3 DNA DNA expression quantity is more stable after death in corpse, and HIF2 α mRNA has centainly Changing rule, i.e., after death the time is longer, and expression quantity is lower, therefore, using the mRNA of HIF2 α relative to Caspase-3 The content of DNA DNA is the death time it can be inferred that the dead.

Mouse death model establishes more and comparatively dense death time point in 48 hours in the present invention, this facilitates accurately Infering diing time；Change unconspicuous feature using after death DNA, does reference gene using Caspase-3 DNA DNA, can obtain Obtain accurate gene expression amount；In addition, HIF2 α label is also the deduction for being used for the death time for the first time.

Detailed description of the invention

Fig. 1 is HIF2 α mRNA relative to the expression quantity of Caspase-3 DNA and the regression curve of death time.

Specific embodiment

A specific embodiment of the invention is described below, in order to facilitate understanding by those skilled in the art this hair It is bright, it should be apparent that the present invention is not limited to the ranges of specific embodiment, for those skilled in the art, As long as various change is in the spirit and scope of the present invention that the attached claims limit and determine, these variations are aobvious and easy See, all are using the innovation and creation of present inventive concept in the column of protection.

Embodiment

1, Mice brain tissues are collected

By 57 healthy male SD mouse anesthesias, then make its disconnected neck dead, and in the 48h of mouse after death, every certain Time collect a Mice brain tissues, i.e., respectively dead mouse 0h, 0.5h, 1.0h, 1.5h, 2.0h, 2.5h, 3.0h, 3.5h, 4.0h、4.5h、5.0h、5.5h、6.0h、7.0h、8.0h、9.0h、10h、11h、12h、13h、14h、15h、16h、18h、20h、 22h, for 24 hours, 36h and 48h when, collect Mice brain tissues take 3 mouse corpse every time when collecting Mice brain tissues, make Brain tissue dissection is carried out with surgical instrument, collects brain tissue at the same position of three mouse, is subsequently placed in the EP pipe of 1.5mL It is interior.

2, RNA, DNA are extracted altogether

The brain tissue for weighing 25mg or so is total to extracts kit using hundred Tyke genomes and RNA after grinding and carries out mouse The total extraction of brain tissue, then through albumen precipitation, adsorption column absorption nucleic acid simultaneously elutes genomic DNA and RNA step, obtains 80 μ L and mention Liquid is taken, concrete operations are carried out according to kit specification；Extracting solution is then subjected to reverse transcription reaction.

3, reverse transcription reaction

Reverse transcription reaction is carried out using commercial reagents box RevertAid First Strand cDNA (Thermo), is reversed Record reaction system are as follows: 1 μ L of reverse transcriptase, 1 μ L of dNTPs premixed liquid, 0.5 μ L of random primer, 2 μ L of reaction buffer, altogether extracting solution 1 μ L finally complements to 10 μ L with RNase-free water；Reaction condition is 25 DEG C of 5min, 60 DEG C of 42min, 70 DEG C of 5min.

4, design primer

Design the mRNA primer of HIF2 α and the primer of Caspase-3 DNA；Wherein, the mRNA primer of HIF2 α needs Across introne, to ensure mRNA specificity, fragment length 79bp, specific primer sequence is shown in NO.1~2 SEQ ID； The primer segments length of Caspase-3 DNA is 157bp, and specific primer sequence is shown in NO.3~4 SEQ ID.

HIF2 α mRNA-F:GGGACGGTCATCTACAAC；(SEQ ID NO.1)

HIF2 α mRNA-R:TCTCGATCTCACTCAGCA；(SEQ ID NO.2)

Caspase-3 DNA-F:ATGTGGGGCCATCGTTACAG；(SEQ ID NO.3)

Caspase-3 DNA-R:CACCAGGTTGTCACAGGGTT.(SEQ ID NO.4)

Meanwhile through detecting, above-mentioned primer all has specificity.

5, RT-qPCR is detected

Using step 2 gained cDNA and DNA as template, quantitative fluorescent PCR is carried out using step 3 gained primer, detection is each The expression quantity of HIF2 α mRNA and Caspase-3 DNA in time point；QPCR reaction system is that SYBR Green PCR reaction is slow 5 μ L of fliud flushing premixed liquid, 1 μ L of DNA or cDNA template, preceding primer and each 1 μ L of rear primer, finally complement to 10 with RNase-free water μL；Reaction condition are as follows: 95 DEG C, initial denaturation 15min；94 DEG C, it is denaturalized 15s；55 DEG C, anneal 30s；72 DEG C, extend 34s, totally 40 Circulation.

6, interpretation of result

Quantitative fluorescent PCR collects fluorescence signal after reaction, using SDS software, and is analyzed；By thershold It is set as 0.02, the Cq value of each time point reaction is obtained, calculates each death further according to the calculation formula of gene expression amount Expression quantity of the HIF2 α mRNA relative to Caspase-3 DNA in time point, then by the opposite table at time point and HIF2 α mRNA The conversion that lg value is carried out up to amount, establishes relative expression quantity and the regression curve of death time (see Fig. 1).

As a result, as shown in Figure 1, showing that the equation of infering diing time is Y=-0.75X²-0.13X-0.02；And it returns bent Relative coefficient R is -0.84, P value < 0.0001 in line, shows that curve matching is preferable.

7, corrupt corpse

The brain tissue for acquiring the dead that 1 death time is 8h carries out HIF2 α according to above-mentioned steps 2, step 3 and step 5 MRNA, the detection of Caspase-3 DNA gene expression amount, are 0.16636 by the relative expression quantity that detection obtains the two, then again According to the deduction equation Y=-0.75X obtained in step 6²- 0.13X-0.02 is calculated, and show that the death time of the sample is 8.38h, the error compared with the practical death time belong in normal range (NR), show that this method can be used for carrying out legal medical expert's practice.

Although only disclosing the process for carrying out dead deduction using brain tissue in the present embodiment content, it should be apparent that this Invention is not limited to the range of specific embodiment；Based on this programme, then use and difference disclosed in this programme embodiment Tissue carries out the application of same innovation and creation, substantially also belongs to innovation and creation identical with this programme.

Sequence table

<110>Sichuan University

<120>methods and applications of the HIF2 α mRNA relative to the expression quantity infering diing time of Caspase-3 are utilized

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gggacggtca tctacaac 18

<210> 2

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

tctcgatctc actcagca 18

<210> 3

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

atgtggggcc atcgttacag 20

<210> 4

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

caccaggttg tcacagggtt 20

Claims (10)

1. a kind of primer, which is characterized in that the primer includes the primer of the mRNA of hypoxia inducible factor HIF2 α, and The primer of Caspase-3 DNA, particular sequence are as follows:

HIF2 α mRNA-F:GGGACGGTCATCTACAAC；

HIF2 α mRNA-R:TCTCGATCTCACTCAGCA；

Caspase-3 DNA-F:ATGTGGGGCCATCGTTACAG；

Caspase-3 DNA-R:CACCAGGTTGTCACAGGGTT.

2. a kind of method of the expression quantity infering diing time using HIF2 α mRNA relative to Caspase-3, which is characterized in that The following steps are included:

(1) tissue of sample to be examined after death different time points is extracted, and carries out RNA, DNA and extracts altogether, then prepared by reverse transcription cDNA；

(2) using cDNA as template, using claim 1 design primer, by RT-qPCR detect HIF2 α mRNA with The expression quantity of Caspase-3DNA；

(3) expression quantity of the HIF2 α mRNA relative to Caspase-3 DNA in each death time point is calculated, is then established opposite The regression curve of expression quantity and death time, and obtain the equation of infering diing time.

3. according to the method described in claim 2, it is characterized in that, be tissue described in step (1) being brain tissue.

4. according to the method described in claim 3, it is characterized in that, the detailed process of the brain tissue extraction are as follows: to sample After this death, a sample to be examined brain tissue is collected every 0.5h.

5. according to the method described in claim 3, it is characterized in that, reverse transcription reaction system described in step (1) are as follows: reverse transcription 1 μ L of enzyme, 0.5 μ L of random primer, 1 μ L of dNTPs premixed liquid, 2 μ L of reaction buffer, altogether 1 μ L of extracting solution, finally use RNase-free Water complements to 10 μ L.

6. according to the method described in claim 3, it is characterized in that, reverse transcription reaction condition described in step (1) are as follows: 25 DEG C 5min；60℃42min；70℃5min.

7. according to the method described in claim 3, it is characterized in that, the reaction system of RT-qPCR described in step (2) are as follows: 5 μ L of SYBR Green PCR reaction buffer premixed liquid, 1 μ L of DNA or cDNA template, 1 μ L of preceding primer, 1 μ L of rear primer, are finally used RNase-free water complements to 10 μ L.

8. according to the method described in claim 3, it is characterized in that, the reaction condition of RT-qPCR described in step (2) are as follows: 95 DEG C, initial denaturation 15min；94 DEG C, it is denaturalized 15s；55 DEG C, anneal 30s；72 DEG C, extend 34s, totally 40 circulations.

9. application of any one of claim 2~8 the method in detection mRNA label.

10. a kind of for carrying out the kit of dead deduction, which is characterized in that including primer described in claim 1.