CN109837354B - Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof - Google Patents
Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof Download PDFInfo
- Publication number
- CN109837354B CN109837354B CN201811634355.0A CN201811634355A CN109837354B CN 109837354 B CN109837354 B CN 109837354B CN 201811634355 A CN201811634355 A CN 201811634355A CN 109837354 B CN109837354 B CN 109837354B
- Authority
- CN
- China
- Prior art keywords
- tomato
- disease
- scab
- sequence
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular marker closely linked with a tomato scab broad-spectrum resistance gene SlPub24, a specific primer pair for detecting the molecular marker, a kit containing the specific primer pair, a method for identifying the tomato scab resistance gene by using the specific primer pair and application thereof. The molecular marker is an InDel marker and is named as SlPub-Del, a 189bp sequence located in a 5' -UTR region of SlPub24 gene is detected by the marker, and a material lacking the sequence shows disease resistance to tomato scab. Experiments prove that: the InDel marker SlPub-Del has strong specificity, can be used for molecular marker-assisted selection of broad-spectrum resistance of tomato scab, can obtain a disease-resistant single plant through seedling stage screening, does not need resistance identification, can save cost, improves selection efficiency and greatly accelerates a breeding process.
Description
Technical Field
The invention belongs to the field of vegetable genetic breeding, and relates to a molecular marker related to broad-spectrum resistance of tomato scab and application thereof.
Background
Tomato scab is a bacterial disease caused by various species of the genus Xanthomonas (Xanthomonas spp). As early as 40 years in the 20 th century, the disease occurs in Hunan and Jiangxi provinces of China, and currently, all provinces, cities and autonomous regions except Tibet are reported, so that the disease is one of four bacterial diseases in tomato production in China, and has great influence on tomato production in China (Wang et al.2018). The pathogenic bacteria of the disease are very complex, and have four species and at least four physiological races (T1-T4) (Jones et al 2004,2005), and the pathogenic bacteria can generate drug resistance, which brings great difficulty to the drug control of the disease, and meanwhile, the application of a large amount of pesticide can cause serious environmental pollution, destroy the ecological environment and influence the health of people and livestock, and the adoption of disease-resistant varieties is the most economic and effective control measure.
Scientists in various countries have been devoted to screening of disease-resistant resources since tomato scab occurred in order to use disease-resistant materials for breeding for disease resistance. The antiviral material found so far mostly carries a single resistance, i.e. resistance to only one physiological race, e.g. the Rx4 gene from currant tomato is resistant to only T3 races, and the Rx3 gene from breeding material Hawaii7998 is resistant to only T1 races (Wang et al 2018). Although the genes are already used for breeding disease-resistant varieties, the bred varieties only resist a single microspecies and cannot meet the requirement of disease-resistant varieties with a plurality of microspecies in tomato planting areas.
For this reason, resources with broad spectrum resistance are being sought. The cherry tomato (Solanum lycopersicum. cerasiforme) material PI114490 is resistant to all species and small species of tomato scab pathogenic bacteria (Scottet al 2003,2013), and is a very excellent broad-spectrum disease-resistant material. Therefore, there is a need in the art to develop molecular markers that are closely linked to the broad-spectrum resistance of this material, thereby facilitating the research and practice of using markers to assist in the selection of new species with broad-spectrum resistance to tomato scab.
Disclosure of Invention
In order to solve the problems in the prior art, the invention develops a molecular marker closely linked with the broad-spectrum resistance of the tomato material, verifies the practicability of the marker, and provides a reliable molecular marker for the selection and cultivation of a new species with broad-spectrum resistance to tomato scab by adopting the marker.
In a first aspect, the present invention provides a molecular marker (hereinafter, sometimes simply referred to as "molecular marker of the present invention") that is closely linked to the tomato scab resistance gene SlPub 24. The tomato scab resistance gene SlPub24 targeted by the invention is positioned on chromosome 11.
The molecular marker of the invention is an InDel marker (namely, an insertion deletion marker), the InDel marker (named SlPub-Del) is positioned in a 5 '-UTR region (namely, an untranslated region) of a tomato scab resistance gene SlPub24, starts from 639bp upstream of an initiation codon ATG of a 5' -UTR region of SlPub24 to end at 833bp, and a DNA sequence shown as a sequence 1 in the molecular marker is absent in tomato disease-resistant materials.
Specifically, for tomato susceptible materials and disease-resistant materials, a DNA sequence shown as a sequence 1 with the length of 191bp exists in the susceptible materials, and the sequence shown as the sequence 1 is deleted in the disease-resistant materials. At the same time, at 833bp position, the disease-resistant material has 2 basic groups which are deleted in the disease-sensitive material, and the sequence of the disease-sensitive material is 189bp longer than that of the disease-resistant material. In addition, the disease-resistant material and the disease-susceptible material have 3 mononucleotide differences in the 5 '-UTR region, wherein the 23 rd site (calculated from the 5' end) is C for the disease-susceptible material and T for the disease-resistant material; at position 83, the susceptible material is A, and the disease resistant material is T; at position 343, the susceptible material is a and the disease resistant material is C (see also fig. 1).
The characteristics can be used for identifying the tomato scab resistance gene SlPub24, if a short band with the length of 187bp (the sequence of the short band is shown as the sequence 4) is detected, the material to be detected is a disease-resistant material containing the tomato scab resistance gene SlPub24, and if a long band with the size of 376bp (namely 189bp more than the short band and the sequence of the short band is shown as the sequence 5) is detected, the material to be detected is a disease-sensitive material containing no tomato scab resistance gene SlPub 24.
Thus, in a second aspect, the present invention provides a specific primer pair for detecting the molecular marker of the present invention (hereinafter sometimes simply referred to as "primer pair of the present invention") comprising a forward primer shown as sequence 2 and a reverse primer shown as sequence 3:
forward primer 5'-TATAAACTCATAAATGTTGGATCT-3' (SEQ ID NO: 2)
Reverse primer 5'-TTTTGTTGTCCATCTAGTCTGA-3' (SEQ ID NO: 3)
In a third aspect, the invention provides an amplified fragment obtained using the primer pair of the invention, said amplified fragment being represented by sequence 4 or sequence 5.
In a fourth aspect, the present invention provides a method for identifying a tomato having disease resistance to tomato scab, (hereinafter sometimes simply referred to as "the identification method of the present invention"), the method comprising identifying whether a tomato scab resistance gene SlPub24 is contained in the genome of a tomato material to be tested, and if so, the tomato to be tested has disease resistance to tomato scab.
In one embodiment, the identification of the tomato scab resistance gene SlPub24 in the above method comprises the steps of:
1) taking the genomic DNA of the tomato material to be detected as a template, and carrying out PCR amplification reaction by using the primer pair; and
2) detecting the PCR amplification product obtained in the step 1), wherein if the detection result is only one band with the size of 187bp, the tomato material to be detected is the tomato scab disease-resistant material, and if the detection result only contains one band with the size of 376bp, the tomato material to be detected is the tomato scab susceptible material.
In a preferred embodiment, the 187bp sized band has the sequence shown in SEQ ID No. 4 and the 376bp sized band has the sequence shown in SEQ ID No. 5.
In a preferred embodiment, the disease-resistant material is resistant to all and all races of scab.
In the identification method of the present invention, the following reaction system may be used in the PCR amplification reaction of step 1): 10 μ l of the reaction system contained 1.5mM Mg2+1. mu.l of 10 XPCR reaction buffer, 1. mu.l of 2mM dNTPs, 0.2. mu.l of each of 10. mu.M forward and reverse primers, 0.4. mu.l of 2.5U/. mu.l Taq DNA polymerase, 1. mu.l of 5-10 ng/. mu.l DNA template, ddH2The amount of O was adjusted to 10. mu.l.
In the identification method of the present invention, the PCR amplification reaction of step 1) may employ the following PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extension at 72 ℃ for 5 min.
In the identification method of the present invention, the PCR amplification product can be detected by a common method known in the art, for example, 2% agarose gel electrophoresis. Therefore, in a preferred embodiment, the PCR amplification product obtained in step 1) is detected by agarose gel electrophoresis.
In a fifth aspect, the present invention provides a method of breeding a tomato variety having broad-spectrum disease resistance to tomato scab, said method comprising the steps of:
1) detecting whether the genome of the tomato material to be detected contains a tomato scab resistance gene SlPub 24; and
2) tomato material containing tomato scab resistance gene SlPub24 is selected as the target tomato variety.
In a preferred embodiment, the detecting in step 1) comprises performing a PCR amplification reaction using the primer pair of the present invention with genomic DNA of the tomato material to be detected as a template, and detecting the resulting amplification product, and selecting the tomato material to be detected, which has the amplification product obtained in step 1) only as a band of 187bp in size, as the tomato variety of interest in step 2).
In a sixth aspect, the present invention provides a kit for detecting a tomato scab resistance gene SlPub24 (hereinafter sometimes simply referred to as "the kit of the present invention") comprising the primer pair of the present invention.
In a preferred embodiment, the kit of the invention further comprises one or more of dNTPs, Taq DNA polymerase, PCR reaction buffer and standard positive DNA template.
In a seventh aspect, the invention also provides an application of the molecular marker, the primer pair or the kit in tomato molecular marker assisted breeding. Namely, the molecular marker or primer of the invention can be used for breeding disease-resistant tomatoes according to genotypes.
The invention has the beneficial effects that:
(1) the molecular marker SlPub-Del (primer pair) provided by the invention is positioned in the 5' -UTR of the gene, has the characteristics of strong specificity and high stability, and can be used for molecular marker-assisted breeding;
(2) the molecular marker SlPub-Del (primer pair) has low requirements on the quality of detection equipment and a substrate template, amplified specific fragments are small, the difference between disease-resistant materials and disease-susceptible materials is obvious, the detection period is short, and the method is suitable for high-throughput and automatic operation and is suitable for the practice of modern molecular marker-assisted breeding;
(3) the molecular marker SlPub-Del (primer pair) can be applied to tomato breeding work, disease-resistant single plants can be obtained through seedling stage screening, resistance identification is not needed, the cost can be saved, the selection efficiency is improved, and the breeding process is greatly accelerated; the method can replace the traditional method of selecting the resistance material by adopting the disease resistance identification, eliminates the influence of human and environmental factors on the surface type judgment, and ensures that the result is more accurate and reliable.
Drawings
Preferred embodiments of the present invention will be described below with reference to the accompanying drawings, and it will be understood by those skilled in the art that the embodiments or examples described below with reference to the drawings are only illustrative of the best modes for carrying out the invention, and do not limit the scope of the invention to these embodiments.
FIG. 1 shows a schematic representation of the sequence difference alignment of disease-resistant and disease-sensitive material, the horizontal line-missing sequence and arrow pointing to single nucleotide substitution.
FIG. 2 shows the amplification results of InDel marker SlPub-Del in donor parent, acceptor parent and partially selfed backcrossed population. Wherein, M: 100bp DNA Marker; p: disease-resistant gene donor parent PI 114490; o: an infectious parent OH 88119; r: disease-resistant individual plants in the inbred backcross population; s: susceptible individuals in the inbred backcross population. The disease is detected when the electrophoresis band is 187bp, and the disease is infected when the electrophoresis band is 376 bp.
FIG. 3 is an electrophoresis diagram of molecular marker identification of tomato material from partially different sources by InDel marker SlPub-Del. Wherein, M: 100bp DNA Marker; p: disease-resistant parent PI 114490; o: an infectious parent OH 88119; 1-42: 42 parts of tomato material.
Detailed Description
As described above, the invention provides a molecular marker SlPub-Del closely linked with a tomato scab resistance gene SlPub 24. The inventors designed specific primer pairs (sequence 2 and sequence 3) according to the sequence characteristics to detect SlPub-Del. The length of the band obtained by amplification in the disease-resistant variety by using the primer pair is 187bp (sequence 4), the length of the band obtained in the disease-resistant material is 376bp (sequence 5), and the difference between the two is 189bp, namely, the 5' -UTR sequence of the SlPub24 gene of the tomato disease-resistant material is 189bp longer than the sequence of the disease-resistant material.
Taking the susceptible processing tomato variety OH88119 and the material PI114490 carrying broad-spectrum resistance gene in the examples as examples, the following amplified fragments can be obtained by using the primer pair of the invention:
sequence of the disease-resistant material PI114490(187bp) (SEQ ID NO: 4):
TATAAACTCATAAATGTTGGATTTATTGACCATAAAATATTATAATGATAATGTGATGATTATATTTTCTTAATAAGGGTTTTAGGTTTAATCTTGAATAATAAATACTGAATCTATTACTAATTTTTTCGATATCAATTTAAAATAATCAATCTAATATGAAAATCAGACTAGATGGACAACAAAA
sequence of the susceptible material OH88119(376bp) (sequence 5):
TATAAACTCATAAATGTTGGATCTATTGACCATAAAATATTATAATGATAATGTGATGATTATATTTTCTTAATAAGGGTTTAATTTGAGTCTCAAGAATTAATTACTTTCGACAGTGCATTTCACTTGATCTTCAAAACAAATTT AAATTTAAAAGTCACAAAAAATCTCCGTTTAAATTTAAAAGTCACAAAAAAATCTCCAAGAATACAGTTAGCACTTT CAAATCTAATATGAATCTAAATTTATCTGTAATAGAATCACAAAAATATTCAAGAAATCTTGAATAATAAATACTGAATCTATTACTAATTTTTTCGATATCAATTTAAAATAATCAATATAATATGAAAATCAGACTAGATGGACAACAAAA
as shown above, the bold marks are single nucleotide differences, and the black-lined parts are fragments which are respectively more than those in the two sequences of the disease-resistant material PI114490 and the disease-sensitive material OH 88119. Wherein a DNA sequence (sequence 1) with the length of 191bp exists in the susceptible material OH88119, and the sequence is deleted in the disease-resistant material PI 114490. Meanwhile, at 833bp, 2 bases of the disease-resistant material PI114490 are deleted in the disease-sensitive material OH88119, and the sequence of the disease-sensitive material OH88119 is 189bp longer than that of the disease-resistant material PI114490 by combining the two. In addition, the disease-resistant material PI114490 and the susceptible material OH88119 have 3 single nucleotide differences in the 5' -UTR region, the 23 rd position, the susceptible material OH88119 is C, and the disease-resistant material PI114490 is T; at position 83, the susceptible material OH88119 is A, and the disease-resistant material PI114490 is T; at position 343, the susceptible material OH88119 is a, and the resistant material PI114490 is C (the specific positions of the differences can also refer to fig. 1).
Therefore, by utilizing the characteristics, whether the tomato material to be detected contains the tomato scab resistance gene SlPub24 can be identified, namely, if a short band with the length of 187bp is detected, the tomato material to be detected is a disease-resistant material containing the tomato scab resistance gene SlPub24, and if a long band with the size of 376bp is detected, the tomato material to be detected is a disease-sensitive material and does not contain the tomato scab resistance gene SlPub 24.
The invention is illustrated and described below by means of examples, it being understood that the invention may be subject to numerous modifications and variations on the examples described below, all of which are included within the scope of the invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market. In the quantitative (disease resistance identification) tests in the following examples, three replicates were set up and the results averaged.
Materials and methods
The tomato material used in the following examples was the susceptible processed tomato variety OH88119, the material carrying the broad spectrum resistance gene PI114490 and an inbred backcross population containing 166 lines.
Tomato material OH 88119: tomato is processed to treat high susceptibility to scab (Yang et al 2005). The public is available from the university of agriculture in china.
Tomato material PI 114490: cherry tomato (tomato lycopersicum var. cerasiform) carries broad-spectrum resistance genes of tomato scab, and has high resistance to all species and small species of scab pathogenic bacteria (Scott et al 2003; Sunju et al 2011; Scott et al 2013). The public is available from the university of agriculture in china.
Self-crossing and backcrossing population: PI114490 is used as a donor, and a group (Scott et al 2003; Sunji et al 2011) containing 166 strains is obtained through hybridization and backcross, wherein the genetic composition in each line in the group is basically consistent and is stably inherited, and the genetic compositions of different lines are different. The public is available from the university of agriculture in china.
The pathogenic bacteria of tomato scab in the following examples belong to the physiological races T1-T4 (Pei et al 2012; Scott et al 2013). The public is available from the university of agriculture in china.
The identification of disease resistance in the following examples employed spray inoculation: scraping a little of the bacteria preserved at 4 ℃ by using an inoculating ring 3-4 days before inoculation, coating the bacteria on an YDC plate culture medium, culturing at 28 ℃ for 2-3 days, suspending by using sterile water, and diluting to about 1 × 108cfu/mL of bacterial liquid. 1h before inoculation, tomato plants grown in a sunlight greenhouse were sprayed with water. Inoculating by spraying. After inoculation is completed, the tomato plants are sprayed with water 1 time in the morning and at night each day to increase the humidity required for disease occurrence. 8 days after inoculation Sun et al (2014)The method is used for measuring the area of the leaf scab, or the disease condition is investigated by adopting a 1-12 grade grading method of Horsfall-Barratt (1945), and the method is converted according to the area estimation of the whole disease organization of the plant as follows: the disease condition of each material is classified by 0, 0-3% for 1, 3-6% for 3, 6-12% for 4, 12-25% for 5, 25-50% for 6, 50-75% for 7, 75-87% for 8, 87-94% for 9, 94-97% for 10, 97-100% for 11, and 100% for 12.
Example 1 obtaining of molecular marker SlPub-Del closely linked to tomato broad-spectrum scab resistance Gene
The resistance evaluation is carried out on the disease-resistant parent PI114490, the disease-susceptible parent OH88119 and a plant of an inbred backcross group (Scott et al 2003; Sunjianget et al 2011; Scott et al 2013) containing 166 lines by adopting the spray inoculation method, the anti-susceptible reaction of each line is determined according to the disease grade difference significance analysis result of each line, the line with the disease grade significantly higher than PI114490 is the disease-susceptible, and the rest is the disease-resistant.
According to the results, tomato material PI114490 contains a gene which is resistant to all species and small species of scab, the gene is located on chromosome 11 (Scott et al 2003; Sunji et al 2011; Scott et al 2013), and gene SlPub24 (Du and shan 2015) is identified by using gene differential expression analysis techniques (cDNA-AFLP and RNA-seq). In the invention, the sequence difference of the gene between a disease-resistant material PI114490 and a disease-susceptible material OH88119 is compared, and the result shows that the 5' -UTR of the SlPub24 gene in the disease-resistant material is less than that of a disease-susceptible variety by a 189bp DNA sequence, and in order to confirm whether the sequence is related to the resistance gene, a specific primer pair (sequences 2 and 3) is designed according to the sequence characteristics to detect the InDel, and the marker is named as SlPub-Del. The size of the band obtained by amplification of the primer pair in a disease-resistant variety is 187bp (sequence 4), and the size of the band obtained in a disease-sensitive material is 376bp (sequence 5). The marked primer pair PI114490 and OH88119 and the genome DNA of the inbred backcross group plant are amplified, and the reaction system of PCR is as follows: 10 μ l of the reaction system contained 1.5mM Mg2+1. mu.l of 10 XPCR reaction buffer, 1. mu.l of 2mM dNTPs,mu.l of each of the upstream and downstream primers at 10. mu.M, 0.4. mu.l of Taq DNA polymerase at 2.5U/. mu.l, 1. mu.l of DNA template at 5-10 ng/. mu.l, ddH2The amount of O was adjusted to 10. mu.l. The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extension at 72 ℃ for 5 min. And (3) carrying out 2% agarose gel electrophoresis on the PCR product, wherein the result shows that all the strains in the self-crossed backcross population have only a single band and accord with the genetic characteristics of the population. Of these, 5 lines were resistant to four races of T1-T4 simultaneously and carried a band of 187bp in size, while the remaining 161 lines carried a band of 376bp in size (FIG. 1), indicating that the InDel marker SlPub-Del is closely linked to disease resistance and can be used for identification and screening of resistant materials carrying the resistance gene SlPub 24.
Example 2 application of molecular marker SlPub-Del closely linked with tomato broad-spectrum scab resistance gene
In order to further verify the molecular marker SlPub-Del developed in the above example 1 and establish a marker-assisted selection system to obtain a material for resisting tomato scab, the molecular marker SlPub-Del obtained in the above example 1 was used in the example to perform marker analysis on 192 parts (including PI114490) of tomato materials (Liu et al 2017, publicly available from the university of agriculture in China) from different sources, and the results show that 16 parts of the materials (including PI114490) are amplified to a band of 187bp, 3 parts of the materials are amplified to bands of 187bp and 376bp, and the rest of the materials are bands of 376bp (FIG. 2). Of the 16 materials carrying the 187bp band and the 3 materials carrying the 187bp and 376bp bands, 11 simultaneously carried the scab resistance gene Rx 4. To exclude the influence of the gene on resistance identification, only 5 materials (LA0395, LA2181, Ha7998, LA1269 and PI114490) carrying only 187bp bands and not Rx4 gene were selected for resistance identification, and 3 materials (Riger 87-5, Zhongshui No. 6 and OH88119) carrying 376bp bands were used as controls, 10 plants were planted for each material, and T3 small species were inoculated by spraying. The results showed that the disease grade of PI114490 was 4, the average disease grade of the other 4 materials carrying 187bp bands was 5, higher than that of PI114490, and the average disease grade of the 3 materials carrying 376bp bands was 6, higher than that of PI 114490. The material carrying the 187bp band was shown to be partially resistant to scab, while it was also demonstrated that the SlPub24 gene was only one site in PI114490 for scab resistance.
Reference to the literature
Du and shan 2015, tomato material PI114490 for separation and functional analysis of scab resistant T3 small related genes and doctor academic paper of Chinese university of agriculture
Sun Hui Jun, Zhangjiun, Wang Garden, Jay W.Scott, David M.Francis, Poplar talent.2011 analysis of tomato scab T3 Small species resistance QTL horticultural report, 38 (12): 2297-2308.
Horsfall JG,Barratt RW.1945.An improved grading system for measuringplant diseases.Phytopathology 35:655.
Jones JB,Lacy GH,Bouzar H,Minsavage GV,Stall RE,SchaadNW.2005.Bacterial spot-Worldwide distribution,importance and review.ActaHorticulturae 695:27-33.
Jones JB,Lacy GH,Bouzar H,Stall RE,Schaad NW.2004.Reclassification ofthe xanthomonads associated with bacterial spot disease of tomato andpepper.Systematic and Applied Microbiology 27:755-762.
Liu XX,Geng XL,Zhang HC,Shen HL,Yang WC.2017.Association and geneticidentification of loci for four fruit traits in tomato using InDelmarkers.Frontiers in Plant Science 8:1269.
Pei CC,Wang H,Zhang JY,Wang YY,Francis DM,Yang WC.2012.Fine mappingand analysis of a candidate gene in tomato accession PI128216conferringhypersensitive resistance to bacterial spot race T3.Theoretical and AppliedGenetics 124:533-542.
Scott JW,Francis DM,Miller SA,Somodi GC,Jones JB.2003.Tomatobacterial spot resistance derived from PI 114490；Inheritance of resistance torace T2and relationship across three pathogen races.Journal of the AmericanSociety for Horticultural Science 128(5):698-703.
Scott JW,Hutton SF,Shekasteband R,Sim SC,FrancisDM.2013.Identification of tomato bacterial spot race T1,T2,T3,T4,andXanthomonas gardneri resistance QTLs derived from PI 114490populationsselected for race T4.Acta Horticulturae 1069:53-58.
Sun HJ,Wei JL,Zhang JY,Yang WC.2014.A comparison of disease severitymeasurements using image analysis and visual estimates using a category scalefor genetic analysis of resistance to bacterial spot in tomato.EuropeanJournal of Plant Pathology 139:125-136.
Wang YQ,Zhang YX,Gao ZP,Yang WC.2018.Breeding for resistance totomato bacterial diseases in China:challenges and prospects.HorticulturalPlant Journal 4:193-207.
Yang WC,Sacks EJ,Ivey MLL,Miller SA,Francis DM.2005.Resistance inLycopersicon esculentumintraspecific crosses to race T1strains of Xanthomonascampestris pv.vesicatoria causing bacterial spot of tomato.Phytopathology 95:519-527.
While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.
Sequence listing
<110> university of agriculture in China
<120> molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof
<130>GNCJX182370
<141>2018-12-29
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>191
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gagtctcaag aattaattac tttcgacagt gcatttcact tgatcttcaa aacaaattta60
aatttaaaag tcacaaaaaa tctccgttta aatttaaaag tcacaaaaaa atctccaaga 120
atacagttag cactttcaaa tctaatatga atctaaattt atctgtaata gaatcacaaa 180
aatattcaag a 191
<210>2
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tataaactca taaatgttgg atct 24
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ttttgttgtc catctagtct ga 22
<210>4
<211>187
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
tataaactca taaatgttgg atttattgac cataaaatat tataatgata atgtgatgat 60
tatattttct taataagggt tttaggttta atcttgaata ataaatactg aatctattac 120
taattttttc gatatcaatt taaaataatc aatctaatat gaaaatcaga ctagatggac 180
<210>5
<211>376
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tataaactca taaatgttgg atctattgac cataaaatat tataatgata atgtgatgat 60
tatattttct taataagggt ttaatttgag tctcaagaat taattacttt cgacagtgca 120
tttcacttga tcttcaaaac aaatttaaat ttaaaagtca caaaaaatct ccgtttaaat 180
ttaaaagtca caaaaaaatc tccaagaata cagttagcac tttcaaatct aatatgaatc 240
taaatttatc tgtaatagaa tcacaaaaat attcaagaaa tcttgaataa taaatactga 300
atctattact aattttttcg atatcaattt aaaataatca atataatatg aaaatcagac 360
Claims (3)
1. A method for identifying tomatoes having disease resistance to tomato scab, the method comprising the steps of:
1) taking the genomic DNA of the tomato material to be detected as a template, and carrying out PCR amplification reaction by using a primer pair consisting of a forward primer shown in a sequence 2 and a reverse primer shown in a sequence 3; and
2) detecting the PCR amplification product obtained in the step 1), if the detection result is only one 187bp strip, indicating that the tomato material to be detected is the tomato scab disease-resistant material, and if the detection result only contains one 376bp strip, indicating that the tomato material to be detected is the tomato scab susceptible material, wherein the disease-resistant material has resistance to T1-T4 small species of the tomato scab.
2. The method according to claim 1, wherein the sequence of the 187bp band is represented by SEQ ID No. 4, and the sequence of the 376bp band is represented by SEQ ID No. 5.
3. A method for breeding tomato varieties, which is characterized by comprising the following steps:
using the genomic DNA of the tomato material to be detected as a template, carrying out PCR amplification reaction by using a primer pair consisting of a forward primer shown in a sequence 2 and a reverse primer shown in a sequence 3, detecting the obtained amplification product, and selecting the tomato material to be detected with the obtained amplification product being a band of 187bp as a target tomato variety, wherein the target tomato variety has resistance to T1-T4 microspecies of scab.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634355.0A CN109837354B (en) | 2018-12-29 | 2018-12-29 | Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811634355.0A CN109837354B (en) | 2018-12-29 | 2018-12-29 | Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109837354A CN109837354A (en) | 2019-06-04 |
| CN109837354B true CN109837354B (en) | 2020-10-27 |
Family
ID=66883481
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811634355.0A Active CN109837354B (en) | 2018-12-29 | 2018-12-29 | Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109837354B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116589548B (en) * | 2023-06-07 | 2024-02-02 | 南京农业大学 | Tomato SlβCA1 gene and application of encoding protein thereof in bacterial scab of tomatoes |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012187008A (en) * | 2011-03-08 | 2012-10-04 | Hokko Chem Ind Co Ltd | New kasugamycin acetyltransferase and method for detecting the same |
| CN107447010A (en) * | 2017-08-29 | 2017-12-08 | 中国农业大学 | Tomato shot hole resistance molecule marks and its application in tomato shot hole resistant gene NIL structure |
| CN108950049A (en) * | 2018-08-15 | 2018-12-07 | 潍坊兴旺生物种业有限公司 | The SNP marker and its application of bacterial spot of tomato close linkage |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2015005466A (en) * | 2012-10-31 | 2015-07-23 | Two Blades Foundation | Identification of a xanthomonas euvesicatoria resistance gene from pepper (capsicum annuum) and method for generating plants with resistance. |
-
2018
- 2018-12-29 CN CN201811634355.0A patent/CN109837354B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012187008A (en) * | 2011-03-08 | 2012-10-04 | Hokko Chem Ind Co Ltd | New kasugamycin acetyltransferase and method for detecting the same |
| CN107447010A (en) * | 2017-08-29 | 2017-12-08 | 中国农业大学 | Tomato shot hole resistance molecule marks and its application in tomato shot hole resistant gene NIL structure |
| CN108950049A (en) * | 2018-08-15 | 2018-12-07 | 潍坊兴旺生物种业有限公司 | The SNP marker and its application of bacterial spot of tomato close linkage |
Non-Patent Citations (2)
| Title |
|---|
| 番茄材料LA1589抗疮痂病T3小种基因初定位;孙会军等;《河北农业大学学报》;20111130;第34卷(第6期);全文 * |
| 番茄材料PI114490抗疮痂病T3小种相关基因的分离和功能分析;杜和山;《中国博士学位论文全文库 农业科技辑》;20140815(第8期);第4页摘要部分、第51-52页 番茄抗、感材料间slpub24基因序列的比较分析 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109837354A (en) | 2019-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7279004B2 (en) | Compositions and methods for peronospora resistance in spinach | |
| Zhao et al. | Genetic analysis of loci associated with partial resistance to Sclerotinia sclerotiorum in rapeseed (Brassica napus L.) | |
| Goodwin | Back to basics and beyond: increasing the level of resistance to Septoria tritici blotch in wheat | |
| Silva et al. | Molecular, physiological and pathological characterization of Corynespora leaf spot fungi from rubber plantations in Sri Lanka | |
| CN110512025B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof | |
| Liu et al. | A sequence-amplified characterized region marker for a single, dominant gene in melon PI 134198 that confers resistance to a unique race of Podosphaera xanthii in China | |
| Radišek et al. | Genetic variability and virulence among Verticillium albo-atrum isolates from hop | |
| CN102925436A (en) | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| Clavijo et al. | Genetic and phenotypic characterization of Xanthomonas species pathogenic in wheat in Uruguay | |
| CN109837354B (en) | Molecular marker closely linked with tomato scab broad-spectrum resistance and application thereof | |
| Sudha et al. | Phenotypic and molecular characterization of potato germplasm for potato cyst nematode resistance | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN109517919B (en) | Development of broad-spectrum stripe rust resistance T4DL.4DS-3Ai translocation line and SCAR marker of wheat-thinopyrum intermedium | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| Omara et al. | Molecular and genetic analysis of leaf rust resistance genes in two new Egyptian wheat cultivars | |
| Diaz et al. | Characterization of the race structure of Leptosphaeria maculans causing blackleg of winter canola in Oklahoma and Kansas | |
| Acharya et al. | Genetics of tolerance to bacterial wilt disease in tomato (Solanum lycopersicum L.) | |
| CN111034612A (en) | Breeding method of scab and clavispora leaf spot resistant dense thorn type cucumber hybrid | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110616275B (en) | Molecular marker derived from Yttrium okamuni cotton and cotton fiber strength QTL (quantitative trait locus) linkage and application thereof | |
| Talha et al. | Marker assisted detection of underutilized potential Yr genes in elite wheat breeding lines. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |