CN109825526A - Recombinant adeno-associated virus vector for universal CAR-T preparation and construction method and application thereof - Google Patents

Abstract

The invention discloses a recombinant adeno-associated virus vector prepared from physiological universal CAR-T, a construction method and application thereof. The invention also relates to the application of the vector and the CAR-T cell in the aspect of tumor resistance.

Description

A kind of recombined glandulae correlation viral vectors and its building for universal CAR-T preparation Methods and applications

Technical field

The present invention relates to biomedicine field, more particularly to the recombined glandulae correlation viral vectors prepared for CAR-T and Its construction method and application.

Background technique

CAR-T is using can be with the antibody fragment in conjunction with specific antigen come the antigen on tumor cell surface.In recent years Come, CD19 antigentic specificity CAR-T cell is shown lasting for treating in B cell leukemia and lymthoma clinical test Disease-modifying activity.Chimeric antigen receptor (CAR) assigns the ability that the non-dependent mode of T cell HLA identifies tumour antigen, this makes Wider target can be identified relative to nave T cell surface receptor TCR by obtaining the T cell by CAR transformation.In recent years, CAR-T technology has significant curative effect in the treatment of acute leukemia and non-Hodgkin lymphoma, it is considered to be most has prospect One of oncotherapy mode.

The principle of CAR-T treatment is as follows: being modified by genetic engineering, the T cell for the cancer patient for collecting in-vitro separation Expression identifies the Chimeric antigen receptor (CAR) of single tumour antigen, and returns it to cancer after massive amplification CAR-T cell in vitro Disease patient's body carries out cellular immunotherapy.CAR as a kind of gene expression chimeric protein include and T cell signal transduction knot The connection of structure domain, antibody antigen-binding domains (such as: single-chain antibody scFv).CAR-T cell adoptive immunity it is significant excellent Gesture is: cellular immunotherapy has more accuracy.CAR-T adoptive cellular immunotherapy system application gene modification patient is self T cell has evaded the antigen presentation for relying on MHC limitation using antigen-antibody combination principle, to have accurate targeting.Together When overcome tumour cell may be by lowering MHC molecule expression to reduce the immunologic escape of antigen presentation.

The research and development of CAR-T therapy are concentrated mainly on the building of CAR at present, thin to enhance CAR-T by various modifications The targeting of born of the same parents, immunologic cytotoxicity, effectiveness persistence and safety.Although the building of CAR has achieved many remarkable break-throughs, so And following obvious shortcoming is had based on traditional CAR-T cell adoptive immunotherapy system always: (1) can only autologous infusion. Although at present CAR-T treat disease in the blood system can obtain good curative effect, can only autologous infusion, i.e., from patient's body T cell is extracted, expands after carrying out gene modification, is then fed back again to patient.Therefore this therapeutic modality cannot be as drug It is widely applied.Some patients can not carry out CAR-T feedback due to that can not obtain sufficient amount of T cell, lose treatment Possibility.(2) prepare cumbersome: the CAR-T system that every suit targets certain single tumor associated antigen is required to individually construct, and leads to Cross experiment and detect its safety, targeting and validity, time and effort consuming longer applied to clinical evaluation cycle, economy compared with Difference.(3) during CAR-T adoptive cellular immunotherapy, to targeting ability, the biological metabolism situation of CAR-T cell in vivo Lack effectively evaluating and monitoring means, thus often results in treatment excessively or treatment is invalid.

In CAR albumen during T cell surface expression, need to synthesize by viral vectors by DNA synthetic technology The DNA sequence dna of CAR albumen can be expressed in cell；Then the DNA sequence dna of CAR plasmid is put by molecule clone technology to carry In the longer cyclic DNA of body.The gene or DNA sequence dna that are mounted in multiple cloning sites are expressed as albumen by plasmid vector in cell Matter.Plasmid vector DNA is that gene order, the starting of antibiotic are such as expressed comprising other DNA components by artificial reconstructed Subsequence, multiple cloning sites (multiple cloning site, MCS) etc., also, it can pass through base with some other Because engineered helper plasmid (helper plasmid) is assembled into engineering cell (such as 293T cell) automatically together There is the slow virus of infection (infection) ability.Such slow virus just has the function of expressing CAR albumen in cell.It will Such slow virus is added in the culture medium of culture T cell, can infect T cell, that is, enters T cell, then thin using T Member intracellular usually expresses CAR albumen, and the surface of T cell is just anchored on after these CAR protein expressions.Disease is generallyd use at present The gene expression technique that poison mediates, such as slow virus (lentivirus), retrovirus (retrovirus), adenovirus (adenovirus), adeno-associated virus (adeno-associated virus, AAV) etc..

However, these virus technologies have certain deficiency, such as mainly it is that slow virus and retrovirus enter After cell, (insertion) will be inserted randomly into genome, and adenovirus and adeno-associated virus also have it is certain Probability is inserted into genome, may all destroy the gene in cell, so as to cause cell exception, in some instances it may even be possible to can allow cell It is transformed into tumour cell, and then causes tumour.Therefore, CART is prepared using these virus technologies carries out cellular immunotherapy meeting There is the risk for causing tumour.

Summary of the invention

Specifically, the gland relevant viral vector includes following behaviour the present invention relates to a kind of recombined glandulae correlation viral vectors The sequential element of the property made connection: 5 ' inverted terminal repeat sequences, 3 ' inverted terminal repeat sequences and the sequence for encoding CAR gene Column.Specifically, the sequence of the coding CAR gene is CD19CAR (4-1BB).

Wherein, the gland relevant viral vector also can further include the sequential element being operatively connected as follows: SA sequence, 2A sequence, polyA sequence, 5 ' genome homologous sequences (5 ' HA), 3 ' genome homologous sequences (3 ' HA).

5 ' the HA sequences include sequence shown in SEQ ID NO:1；

The SA sequence includes sequence shown in SEQ ID NO:2；

The 2A sequence includes sequence shown in SEQ ID NO:3；

CD19CAR (4-1BB) sequence includes sequence shown in SEQ ID NO:4；

The polyA sequence includes sequence shown in SEQ ID NO:5；

3 ' the HA sequences include sequence shown in SEQ ID NO:6

5 ' the inverted terminal repeat sequences include sequence shown in SEQ ID NO:7

3 ' the inverted terminal repeat sequences include sequence shown in SEQ ID NO:8.

Further, the recombined glandulae correlation viral vectors include to have at least about with sequence shown in SEQ ID NO:9 70%, the nucleotide sequence of the sequence identity of at least about 80%, at least about 90% sequence identity or more.

The invention further relates to the preparation methods of the recombined glandulae correlation viral vectors, the described method comprises the following steps: The package cell line of aforementioned viral carrier is provided；With the recycling recombination AAV virus from the supernatant of the package cell line.

The invention further relates to a kind of recombinant adeno-associated virus, the virus is by aforementioned arbitrary recombined glandulae correlation viral vectors Packaging obtains.

On the other hand, the invention further relates to a kind of methods for expressing CAR gene, include compiling the method includes providing The nucleotide sequence of the aforementioned arbitrary recombinant adeno-associated virus (AAV) of code；In conjunction with CRISPR/cas9 gene editing technology, by institute It states in AAV homologous recombination to the genome of T cell, the AAV expresses the CAR gene in T cell.

On the other hand, the invention further relates to aforementioned arbitrary recombined glandulae correlation viral vectors, recombinant adeno-associated virus to make Application in standby CAR-T cell or anti-tumor drug.

On the other hand, the invention further relates to a kind of aforementioned CAR-T cell preparation method of recombined glandulae correlation viral vectors, Be characterized in that: this method comprises the following steps:

The first step constructs aforementioned arbitrary recombined glandulae correlation viral vectors；

Second step, virus packaging；

Third step, T cell separation, activation and amplification, CRISPR/cas9 gene editing, AAV virus-mediated gene weight Group；

Aforementioned arbitrary recombined glandulae correlation viral vectors are to be expressed in cancer patient or strong by gene editing means The T cell separated and collected in health human peripheral is to obtain CAR-T cell.

Therefore, the invention further relates to the CAR-T cells prepared by the above method.

The invention further relates to a kind of kit, in the kit comprising aforementioned arbitrary recombined glandulae correlation viral vectors, Recombinant adeno-associated virus or the CAR-T cell.

The invention further relates to the CAR-T cell or the kit application in preparations of anti-tumor drugs.

The present inventor passes through in-depth study, and in view of the high cost of CAR-T immunotherapy, therapeutic effect individual difference is big, Safety is low, has the problems such as risk for causing tumour, the application utilizes gene editing technology, in conjunction with gene recombination technology, from table Carrier up to CAR gene is started with, and is improved the structure of AAV carrier, to realize that the genetic fragment fixed point of CAR is accurate whole It closes, it is ensured that the continual and steady expression of CAR gene avoids the risk for causing tumour.Simultaneously also by the expression of CAR as endogenous Under the control of property promoter, so that the expression of CAR is regulated and controled by normal physiological, treatment side effect is substantially reduced, obtains one kind The universal CAR-T of physiological.

Generally speaking, the beneficial effects of the present invention are:

1, the no pathogenicity of the improved AAV carrier preparation of the structure of acquisition of the present invention；

2, the invention universal T cell and universal CAR-T cell can answer in such a way that allogeneic is fed back For the treatment of malignant tumour or infectious diseases, treatment cost is significantly reduced；

3, the CAR prepared is incorporated into before TCR constant region exon, and the regulation by internal promoter, The expression that ensure that CAR and is expressed uniform by physiological regulating control.Due to this physiological and homogeneity, CAR was not in The expression of degree, and the expression of CAR is consistent with the expression of original TCR, the individual difference between each CAR-T cell It is small；

4, safety is higher, due to the expression of CAR be in physiological range, after CAR-T cell-stimulating, release it is thin Intracellular cytokine is also not in excessive release in physiological range, to avoid the generation of cytokine storm.

5, using gene editing technology, CAR is accurate by way of homologous recombination there is no the risk for causing tumour It is integrated on specified TCR constant region gene, rather than on random integration to the genome of T cell, therefore be not in cause to swell The risk of tumor.

Term

As used herein, described " being operatively connected " or " operability be connected " refer to two or more nucleic acid regions or Functional space arrangement of nucleic acid sequence.

" element " refers to a series of useful functional nucleic acid sequences of some expression for albumen, the present invention In, " element " is systematically constructed to form a kind of expression construct.The sequence of " element " can be this hair It also include their variant those of provided in bright, as long as these variants substantially remain the function of " element ", By being inserted into or deleting some base (such as 1-50bp；Preferably 1-30bp, more preferably 1-20bp, more preferably 1-10bp), or into Random or rite-directed mutagenesis etc. go to obtain.

Plasmid

Adeno-associated virus (adeno-associated virus, AAV) carrier is to utilize naturally occurring adeno-associated virus A kind of carrier for artificial transgenosis that certain characteristics generate after genetic engineering is transformed.Adeno-associated virus (Adeno- Associated virus, AAV) it is a kind of virus for being unable to self-replacation, there is lower immunogenicity.There are about 10 kinds at present The AAV of serotypes A AV, different serotypes can be selectively targeting different tissues.But AAV viral vectors struck capacity has Limit is no more than 5.0kb.

According to the information of above-mentioned provided element, variation appropriate is carried out and has still retained the above-mentioned of its original function The variant of element is also included in the present invention.For example, hybridizing under strict conditions with the sequence that the present invention limits and there is phase The sequence variant of congenerous.

The nucleotide full length sequence or its segment of gene pointed by each element of the invention can usually use PCR amplification Method, recombination method or artificial synthesized method obtain.It, can disclosed related nucleotides sequence according to the present invention for PCR amplification method Column, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or by well known by persons skilled in the art normal The library cDNA prepared by rule method expands as template and obtains related sequence.

The position of the upstream and downstream of said elements, may also include restrictive restriction enzyme site in the carrier, this Sample is conducive to the organic linking of each element.

Method well-known to those having ordinary skill in the art can be used to construct the required expression vector of the present invention.These methods include Recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..In addition, expression vector preferably includes one or more Selected marker, to provide the phenotypic character for selecting the host cell of conversion.

Carrier comprising above-mentioned appropriate polynucleotide sequence and appropriate promoter or control sequence, can be used for into The packaging of row virus.

Kit

It is formed the present invention also provides the recombined glandulae correlation viral vectors for including the expression CAR or by the carrier package Virus kit.Other reagents for being usually used in carrying out viral packaging, transfection, injection etc. can also be comprised in the reagent In box, to facilitate those skilled in the art to use.In addition, also may include that those skilled in the art is instructed to grasp in the kit The operation instructions of work.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

Detailed description of the invention

Fig. 1-Fig. 3 is three plasmid construct schematic diagrames, successively are as follows: AAV6-TCR-CD19CAR (4-1BB) (experimental vehicle), AAV6-TCR-GFP (negative control), LV-EF-1a-CD19CAT (4-1BB)-mCherry (positive control)；

Fig. 4: AAV6-TCR-CD19CAR (4-1BB) plasmid construct figure of gene editing；

Fig. 5: the T cell TCR knockout flow cytometer detection result through latter two Different Individual of gene editing；

The flow cytometer detection result of Fig. 6: AAV6 CD19CAR (4-1BB) homologous recombination mediated；

Fig. 7: AAV6-TCR-CD19CAR-T tumor-killing ability FCM analysis result；

Fig. 8: the detection of different time points cytokine concentrations and comparing result, wherein in column diagram daily from left to right The numerical value of column respectively represent Kmix, LV, AAV, LV+Kmix, AAV+Kmix；

The flow cytometer detection and comparing result of the failure marker of Fig. 9: CAR-T cell, wherein be located above in line chart Broken line is LV CD19CAR-T+Kmix, and underlying broken line is AAV CD19CAR-T+Kmix；

The antitumor experiment in vivo of Figure 10 a, b:CAR-T is as a result, wherein Figure 10 b curve for survival, the LV of lentiviruses transduction The AAV-TCR-CAR-T of CAR-T and AAV transduction significantly extends the life cycle of mouse, and two groups of effects are without significant difference.

Specific embodiment

The building of 1 plasmid of embodiment

1, the plasmid of the present embodiment building includes

LV-EF-1a-CD19CAR (4-1BB)-mCherry (positive control, structural schematic diagram are shown in Fig. 3)

(experimental vehicle, structural schematic diagram are shown in Fig. 1,4) to AAV6-TCR-CD19CAR (4-1BB)

AAV6-TCR-GFP (negative control, structural schematic diagram are shown in Fig. 2)

2, plasmid construction and viral packaging process

2.1LV-EF-1a-CD19CAT (4-1BB)-mCherry plasmid construction

Sequence is shown in SEQ ID NO:10.:

1) LV-EF-1a-CD19CAR (4-1BB)-mCherry plasmid is obtained

The plasmid map is first constructed on ApE or Snapgene software.

The functional area of plasmid: LTR-EF-1a-CD19CAT (4-1BB)-mCherry-LTR carries out gene chemical synthesis.

This section of sequence is cloned into slow virus carrier plasmid.

Plasmid conversion, coated plate choose clone, extract plasmid (small to mention), and sequencing confirmation is errorless, extract plasmid again and (mention greatly, go Endotoxin), plasmid waits wrapping viral use.

2.2AAV6-TCR-CD19CAR (4-1BB) plasmid construction

The map of the plasmid is first constructed on ApE or Snapgene software.

The structure of plasmid functional area: ITR-5 ' HA-SA-2A-CD19CAR (4-1BB)-polyA-3 ' HA-ITR

Sequence is shown in SEQ ID NO:11.

Genetic fragment: 5 ' HA-SA-2A-CD19CAR (4-1BB)-polyA-3 ' HA is synthesized first

Said gene segment is cloned into AAV6 viral vectors plasmid

Plasmid conversion, coated plate choose clone, extract plasmid (small to mention), and sequencing confirmation is errorless, extract plasmid again and (mention greatly, go Endotoxin), plasmid waits wrapping viral use.

2.3AAV6-TCR-GFP plasmid construction

The map of the plasmid is first constructed on ApE or Snapgene software.

The structure of plasmid functional area are as follows: ITR-5 ' HA-SA-2A-GFP-polyA-3 ' HA-ITR

Sequence is shown in SEQ ID NO:12.

According to Infusion principle, GFP primer is designed, PCR obtains GFP segment.

Using above-mentioned 2.2 plasmid as template, according to Infusion principle, design primer, PCR obtains AAV6 carrier.

Infusion connection, plasmid conversion, coated plate choose clone, extract plasmid (small to mention), and sequencing confirmation is errorless, mentions again Plasmid (mentioning greatly, remove endotoxin) is taken, plasmid waits wrapping viral use.

The viral packaging process of embodiment 2

2.1LV packaging

Prepare DMEM+10%FBS culture medium+antibiotic

Recovery 293T cell, secondary culture judge that cell state is good

Malicious proxima luce (prox. luc) is wrapped, point 6 10cm culture dishes, each seed 2.5M cell, poison can be wrapped by reaching 70% convergence afterwards for 24 hours.

Packet toxin grain includes: pSLQ5367, pCMV-dR8.91, pMD2-G, TransIT-VirusReagent, Opti MEM.

Specific proportion is according to the 10-cm disk in table 1.

The condition proportion of 1 DNA of table transfection

2.2.AAV6 virus packaging

By taking T75flask as an example, noon before that day passage, cell quantity 9M-10M

4.AAV virus receives poison: virion exists simultaneously in incasing cells and culture supernatant.

5.AAV viral concentration and purifying.

The sorting of 3 T cell of embodiment

One, T cell sorts

1, secure good health the blood sample (at least 50mL) of donor.Detection by following disease (is not only limited to this A little detections), qualified patient.It include: hepatitis A, hepatitis B, hepatitis, AIDS, syphilis antibody, tuberculosis, genetic disease etc..2, it obtains It obtains peripheral blood mononuclear cells (PBMC)

1) Ficoll-PaqueTM PLUS (#07957) is uniformly mixed and is placed in blank pipe；

2) PBS+2%FBS dilute blood sample (2X) is used；

3) blood sample in step 2) is placed in the upper layer of step 1) solution, reduces blood and Ficoll- to the greatest extent The mixing of PaqueTM PLUS, natural reduction of speed after 400g is centrifuged 30 minutes at room temperature；

4) upper plasma after abandoning step 3) centrifugation is moved, takes the blood plasma to be with Ficoll-PaqueTM PLUS liquid interlayer Peripheral blood mononuclear cells (wherein, be divided into four layers after centrifugation in pipe, be followed successively by from top to bottom blood plasma, peripheral blood mononuclear cells, Ficoll-PaqueTM PLUS liquid, red blood cell and granulocyte layer).

5) peripheral blood mononuclear cells is cleaned with PBS+2%FBS, for use.

3, T cell (T memory stem cells, Tmsc) is obtained

Total T cell is obtained using the Pan T cell isolation Kit human of Miltenyi.This kit is yin Select kit.Two, T cell culture

1) T cell culture medium (IL-2): OpTmizer^TMCTS^TMT-cell Expansion SFM+5%CTS^TMImmune Cell SR+1%Penicillin-Streptomycin 100X Solution+1%L-glutamine+IL-2 200IU/ mL。

2) T cell culture medium (IL-7/15): OpTmizer^TMCTS^TMT-cell Expansion SFM+5% CTS^TMImmune Cell SR+1%Penicillin-Streptomycin 100X Solution+1%L-glutamine+ IL-710ng/ml+IL-15 10ng/mL.Starting cell concentration is 1M/mL, and culture medium liquid level is not higher than in Flask 1cm。

Three, t cell activation

1) t cell activation uses: Dynabeads Human T-Activator CD3/CD28 magnetic bead

2) magnetic bead Beads Wash Buffer:PBS+1%BSA+2mMEDTA, pH=7.4 are washed.

3) T cell is mixed with magnetic bead in equivalent 1:1 ratio.

4) it is cultivated in T25Flask or 6 orifice plates.

Four, T cell expands

After t cell activation 48-72 hours, Beads is removed, carries out gene transfer.T cell culture medium (IL-7/ is replaced later 15) by the T cell of activation using 1M/mL as initial cell density, cell culture is carried out, every 2 days supplementing culture mediums simultaneously add appropriate Cell factor.

The CAR gene transfer of 4 T cell of embodiment

After t cell activation 48-72 hours in embodiment 3, AAV6 virus-mediated CAR homologous recombination is in situ It is inserted into shearing site and carries out gene modification, transduce at once, AAV6 virus MOI:2.5 × 10e5-10e6.

1, tcr gene knocks out

1.1 use CRISPR/cas9 system

1.2 electricity swivel systems:

T cell: 3M

Cas9 protein 10 ug (2ul)

sgRNA 2.5ug(5ul)

Total volume: 100 μ L of Buffer T

Electricity turns condition: 1600V, 10ms, 3pulses

Wherein, the sgRNA sequence is as follows:

CTGGATATCTGTGGGACAAGAGG(SEQ ID NO:13)

1.3 CAR gene transfers

AAV6 virus-mediated CAR homologous recombination, it is in situ to be inserted into shearing site.Electricity is transduceed at once after turning, AAV6MOI:2.5 × 10e5-10e6.

The sorting of 1.4 TCR-/CAR+T cells

After 4 days, using the T cell of the CD3Biotin Microbeads sorting TCR feminine gender of Miltenyi.

As a result such as Fig. 5, T cell is respectively from two Different Individuals.The expression of flow cytomery TCR, CD3. The T cell TCR knockout rate of two Different Individuals is respectively 87.2% and 68.6%.

Shown in Fig. 6: T cell is respectively from two Different Individuals.The expression of flow cytomery CAR, respectively 69.1% and 67.5%.Compared with the CAR-T of lentiviruses transduction, the expression of this CAR-T cell CAR is more uniform.

The function of 5 CAR-T cell of embodiment, the detection of phenotype

1. the detection of cytotoxicity

K562-CD19+/K562-CD19- cell co-cultures, each 5 × 10e4 of initiator cell quantity, wherein CD19+ cell table Up to mCherry fluorescin

It is co-cultured again with CAR-T cell, E/T ratio 8:1,4:1,2:1,1:1,0.5:1,0:1

Respectively set three multiple holes

NegativeCtrl:8:1,4:1,2:1,1:1,0.5:1,0:1

PositiveCtrl:8:1,4:1,2:1,1:1,0.5:1,0:1

Test 1:8:1,4:1,2:1,1:1,0.5:1,0:1

Test 2:8:1,4:1,2:1,1:1,0.5:1,0:1

Blank k562-CD19+:0:1,

Blank k562-CD19-:0:1,

Test1+CD19-:8:1,4:1

Test2+CD19-:8:1,4:1

All 4:1 groups are all provided with 6 multiple holes, and 1 is used to detect cell phenotype: 12,24,48h；The expression of 2 detection CAR

96 orifice plate cultures

The mCherry fluorescence of flow cytomery K562-CD19+ cell after 48 hours

Calculation formula are as follows:

100% × (1- (%CD19pos/%CD19neg at notedE:T)/(%CD19pos/CD19neg at 0: 1E:T))by flow cytometry

As a result as shown in fig. 7, the ratio of the tumor-killing ability of AAV6-TCR-CD19CAR-T and CAR-T cell and target cell Be worth directly proportional, CAR-T cell: effect is most obvious when tumour cell=4:1 or 8:1.

Cell toxicity test, different time points take 20ul culture solution supernatant, survey cell factor: IL-2, IFN-r, TNF-a

As a result as shown in figure 8, fluidic cell factors check cell toxicity test different time points, cell in cell culture medium The concentration of the factor.The concentration of three the major cytokines IL-2, IFN-r, TNF-a of AAV6-TCR-CD19CAR-T significantly drop It is low.

The detection of 3.T cell failure

After cell toxicity test starts, different time points detect the marker of T cell failure: PD-1, TIM-3, LAG-3

As a result as shown in figure 9, cell toxicity test detects the failure marker of T cell: PD-1, LAG-3, TIM- after starting 3.The failure marker expression amount of AAV-TCR-CD19CAR-T cell is substantially less than control group.

4. the foundation of mouse tumor model and the in vivo functionality detection of AAV-TCR-CAR-T cell

Experiment in vivo shows (Figure 10): AAV-TCR-CAR-T prepared by the present invention shows equivalent anti-tumor activity, The growth of mouse interior tumor can be efficiently controlled.The life cycle of mouse significantly extends.

It is not for limiting claim, any this field skill although the present invention is disclosed as above with preferred embodiment Art personnel without departing from the inventive concept of the premise, can make several possible variations and modification, therefore of the invention Protection scope should be quasi- with range that the claims in the present invention are defined.

Sequence table

<110>Beijing door los biosynthesis Science and Technology Ltd.

<120>a kind of for the recombined glandulae correlation viral vectors and its construction method of universal CAR-T preparation and application

<130>applying date

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 560

<212> DNA

<213>artificial sequence

<400> 1

acgcaggtgt tctgatttat agttcaaaac ctctatcaat gagagagcaa tctcctggta 60

atgtgataga tttcccaact taatgccaac ataccataaa cctcccattc tgctaatgcc 120

cagcctaagt tggggagacc actccagatt ccaagatgta cagtttgctt tgctgggcct 180

ttttcccatg cctgccttta ctctgccaga gttatattgc tggggttttg aagaagatcc 240

tattaaataa aagaataagc agtattatta agtagccctg catttcaggt ttccttgagt 300

ggcaggccag gcctggccgt gaacgttcac tgaaatcatg gcctcttggc caagattgat 360

agcttgtgcc tgtccctgag tcccagtcca tcacgagcag ctggtttcta agatgctatt 420

tcccgtataa agcatgagac cgtgacttgc cagccccaca gagccccgcc cttgtccatc 480

actggcatct ggactccagc ctgggttggg gcaaagaggg aaatgagatc atgtcctaac 540

cctgatcctc ttgtcccaca 560

<210> 2

<211> 60

<212> DNA

<213>artificial sequence

<400> 2

ctagggacag cgatcgggta catcgatcgc aggcgcaatc ttcgcatttc ttttttccag 60

<210> 3

<211> 57

<212> DNA

<213>artificial sequence

<400> 3

gctactaact tcagcctgct gaagcaggct ggagacgtgg aggagaaccc tggacct 57

<210> 4

<211> 1524

<212> DNA

<213>artificial sequence

<400> 4

gccttaccag tgaccgcctt gctcctgccg ctggccttgc tgctccacgc cgccaggccg 60

gagcagaaac ttatcagtga ggaggacctg gacatccaga tgacacagac tacatcctcc 120

ctgtctgcct ctctgggaga cagagtcacc atcagttgca gggcaagtca ggacattagt 180

aaatatttaa attggtatca gcagaaacca gatggaactg ttaaactcct gatctaccat 240

acatcaagat tacactcagg agtcccatca aggttcagtg gcagtgggtc tggaacagat 300

tattctctca ccattagcaa cctggagcaa gaagatattg ccacttactt ttgccaacag 360

ggtaatacgc ttccgtacac gttcggaggg gggaccaagc tggagatcac aggtggcggt 420

ggctcgggcg gtggtgggtc gggtggcggc ggatctgagg tgaaactgca ggagtcagga 480

cctggcctgg tggcgccctc acagagcctg tccgtcacat gcactgtctc aggggtctca 540

ttacccgact atggtgtaag ctggattcgc cagcctccac gaaagggtct ggagtggctg 600

ggagtaatat ggggtagtga aaccacatac tataattcag ctctcaaatc cagactgacc 660

atcatcaagg acaactccaa gagccaagtt ttcttaaaaa tgaacagtct gcaaactgat 720

gacacagcca tttactactg tgccaaacat tattactacg gtggtagcta tgctatggac 780

tactggggcc aaggaacctc agtcaccgtc tcctcagcgg ccgcattcgt gccggtcttc 840

ctgccagcga agcccaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 900

gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 960

cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact 1020

tgtggggtcc ttctcctgtc actggttatc accctttact gcaaacgggg cagaaagaaa 1080

ctcctgtata tattcaaaca accatttatg agaccagtac aaactactca agaggaagat 1140

ggctgtagct gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc 1200

agcaggagcg cagacgcccc cgcgtacaag cagggccaga accagctcta taacgagctc 1260

aatctaggac gaagagagga gtacgatgtt ttggacaaga gacgtggccg ggaccctgag 1320

atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa 1380

gataagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag 1440

gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta cgacgccctt 1500

cacatgcagg ccctgccccc tcgc 1524

<210> 5

<211> 225

<212> DNA

<213>artificial sequence

<400> 5

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180

gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

<210> 6

<211> 560

<212> DNA

<213>artificial sequence

<400> 6

gatatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc cagtgacaag 60

tctgtctgcc tattcaccga ttttgattct caaacaaatg tgtcacaaag taaggattct 120

gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 180

agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 240

attattccag aagacacctt cttccccagc ccaggtaagg gcagctttgg tgccttcgca 300

ggctgtttcc ttgcttcagg aatggccagg ttctgcccag agctctggtc aatgatgtct 360

aaaactcctc tgattggtgg tctcggcctt atccattgcc accaaaaccc tctttttact 420

aagaaacagt gagccttgtt ctggcagtcc agagaatgac acgggaaaaa agcagatgaa 480

gagaaggtgg caggagaggg cacgtggccc agcctcagtc tctccaactg agttcctgcc 540

tgcctgcctt tgctcagact 560

<210> 7

<211> 130

<212> DNA

<213>artificial sequence

<400> 7

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct 130

<210> 8

<211> 141

<212> DNA

<213>artificial sequence

<400> 8

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120

gagcgcgcag ctgcctgcag g 141

<210> 9

<211> 3315

<212> DNA

<213>artificial sequence

<400> 9

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgtacgcag gtgttctgat ttatagttca aaacctctat 180

caatgagaga gcaatctcct ggtaatgtga tagatttccc aacttaatgc caacatacca 240

taaacctccc attctgctaa tgcccagcct aagttgggga gaccactcca gattccaaga 300

tgtacagttt gctttgctgg gcctttttcc catgcctgcc tttactctgc cagagttata 360

ttgctggggt tttgaagaag atcctattaa ataaaagaat aagcagtatt attaagtagc 420

cctgcatttc aggtttcctt gagtggcagg ccaggcctgg ccgtgaacgt tcactgaaat 480

catggcctct tggccaagat tgatagcttg tgcctgtccc tgagtcccag tccatcacga 540

gcagctggtt tctaagatgc tatttcccgt ataaagcatg agaccgtgac ttgccagccc 600

cacagagccc cgcccttgtc catcactggc atctggactc cagcctgggt tggggcaaag 660

agggaaatga gatcatgtcc taaccctgat cctcttgtcc cacactaggg acagcgatcg 720

ggtacatcga tcgcaggcgc aatcttcgca tttctttttt ccagacgcta ctaacttcag 780

cctgctgaag caggctggag acgtggagga gaaccctgga cctgccttac cagtgaccgc 840

cttgctcctg ccgctggcct tgctgctcca cgccgccagg ccggagcaga aacttatcag 900

tgaggaggac ctggacatcc agatgacaca gactacatcc tccctgtctg cctctctggg 960

agacagagtc accatcagtt gcagggcaag tcaggacatt agtaaatatt taaattggta 1020

tcagcagaaa ccagatggaa ctgttaaact cctgatctac catacatcaa gattacactc 1080

aggagtccca tcaaggttca gtggcagtgg gtctggaaca gattattctc tcaccattag 1140

caacctggag caagaagata ttgccactta cttttgccaa cagggtaata cgcttccgta 1200

cacgttcgga ggggggacca agctggagat cacaggtggc ggtggctcgg gcggtggtgg 1260

gtcgggtggc ggcggatctg aggtgaaact gcaggagtca ggacctggcc tggtggcgcc 1320

ctcacagagc ctgtccgtca catgcactgt ctcaggggtc tcattacccg actatggtgt 1380

aagctggatt cgccagcctc cacgaaaggg tctggagtgg ctgggagtaa tatggggtag 1440

tgaaaccaca tactataatt cagctctcaa atccagactg accatcatca aggacaactc 1500

caagagccaa gttttcttaa aaatgaacag tctgcaaact gatgacacag ccatttacta 1560

ctgtgccaaa cattattact acggtggtag ctatgctatg gactactggg gccaaggaac 1620

ctcagtcacc gtctcctcag cggccgcatt cgtgccggtc ttcctgccag cgaagcccac 1680

cacgacgcca gcgccgcgac caccaacacc ggcgcccacc atcgcgtcgc agcccctgtc 1740

cctgcgccca gaggcgtgcc ggccagcggc ggggggcgca gtgcacacga gggggctgga 1800

cttcgcctgt gatatctaca tctgggcgcc cttggccggg acttgtgggg tccttctcct 1860

gtcactggtt atcacccttt actgcaaacg gggcagaaag aaactcctgt atatattcaa 1920

acaaccattt atgagaccag tacaaactac tcaagaggaa gatggctgta gctgccgatt 1980

tccagaagaa gaagaaggag gatgtgaact gagagtgaag ttcagcagga gcgcagacgc 2040

ccccgcgtac aagcagggcc agaaccagct ctataacgag ctcaatctag gacgaagaga 2100

ggagtacgat gttttggaca agagacgtgg ccgggaccct gagatggggg gaaagccgag 2160

aaggaagaac cctcaggaag gcctgtacaa tgaactgcag aaagataaga tggcggaggc 2220

ctacagtgag attgggatga aaggcgagcg ccggaggggc aaggggcacg atggccttta 2280

ccagggtctc agtacagcca ccaaggacac ctacgacgcc cttcacatgc aggccctgcc 2340

ccctcgctga ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 2400

tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 2460

tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 2520

ggggaggatt gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgggatat 2580

ccagaaccct gaccctgccg tgtaccagct gagagactct aaatccagtg acaagtctgt 2640

ctgcctattc accgattttg attctcaaac aaatgtgtca caaagtaagg attctgatgt 2700

gtatatcaca gacaaaactg tgctagacat gaggtctatg gacttcaaga gcaacagtgc 2760

tgtggcctgg agcaacaaat ctgactttgc atgtgcaaac gccttcaaca acagcattat 2820

tccagaagac accttcttcc ccagcccagg taagggcagc tttggtgcct tcgcaggctg 2880

tttccttgct tcaggaatgg ccaggttctg cccagagctc tggtcaatga tgtctaaaac 2940

tcctctgatt ggtggtctcg gccttatcca ttgccaccaa aaccctcttt ttactaagaa 3000

acagtgagcc ttgttctggc agtccagaga atgacacggg aaaaaagcag atgaagagaa 3060

ggtggcagga gagggcacgt ggcccagcct cagtctctcc aactgagttc ctgcctgcct 3120

gcctttgctc agactctgat tttgtaggta accacgtgcg gaccgagcgg ccgcaggaac 3180

ccctagtgat ggagttggcc actccctctc tgcgcgctcg ctcgctcact gaggccgggc 3240

gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc 3300

gcagctgcct gcagg 3315

<210> 10

<211> 12298

<212> DNA

<213>artificial sequence

<400> 10

gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 60

ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg 120

tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc 180

agcatctaga attaattccg tgtattctat agtgtcacct aaatcgtatg tgtatgatac 240

ataaggttat gtattaattg tagccgcgtt ctaacgacaa tatgtacaag cctaattgtg 300

tagcatctgg cttactgaag cagaccctat catctctctc gtaaactgcc gtcagagtcg 360

gtttggttgg acgaaccttc tgagtttctg gtaacgccgt cccgcacccg gaaatggtca 420

gcgaaccaat cagcagggtc atcgctagcc agatcctcta cgccggacgc atcgtggccg 480

gcatcaccgg cgccacaggt gcggttgctg gcgcctatat cgccgacatc accgatgggg 540

aagatcgggc tcgccacttc gggctcatga gcgcttgttt cggcgtgggt atggtggcag 600

gccccgtggc cgggggactg ttgggcgcca tctccttgca tgcaccattc cttgcggcgg 660

cggtgctcaa cggcctcaac ctactactgg gctgcttcct aatgcaggag tcgcataagg 720

gagagcgtcg aatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag 780

ccccgacacc cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc 840

gcttacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca 900

tcaccgaaac gcgcgagacg aaagggcctc gtgatacgcc tatttttata ggttaatgtc 960

atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc 1020

cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc 1080

tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc 1140

gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg 1200

gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat 1260

ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc 1320

acttttaaag ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa 1380

ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa 1440

aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat aaccatgagt 1500

gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct 1560

tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat 1620

gaagccatac caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg 1680

cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg 1740

atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt 1800

attgctgata aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg 1860

ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca ggcaactatg 1920

gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg 1980

tcagaccaag tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa 2040

aggatctagg tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt 2100

tcgttccact gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt 2160

tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt 2220

ttgccggatc aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag 2280

ataccaaata ctgtctttct agtgtagccg tagttaggcc accacttcaa gaactctgta 2340

gcaccgccta catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat 2400

aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg 2460

ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg 2520

agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag aaaggcggac 2580

aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct tccaggggga 2640

aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt 2700

ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc ggccttttta 2760

cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat 2820

tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg 2880

accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct 2940

ctccccgcgc gttggccgat tcattaatgc agctgtggaa tgtgtgtcag ttagggtgtg 3000

gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 3060

caaccaggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc 3120

tcaattagtc agcaaccata gtcccgcccc taactccgcc catcccgccc ctaactccgc 3180

ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 3240

aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag 3300

gcttttgcaa aaagcttgga cacaagacag gcttgcgaga tatgtttgag aataccactt 3360

tatcccgcgt cagggagagg cagtgcgtaa aaagacgcgg actcatgtga aatactggtt 3420

tttagtgcgc cagatctcta taatctcgcg caacctattt tcccctcgaa cactttttaa 3480

gccgtagata aacaggctgg gacacttcac atgagcgaaa aatacatcgt cacctgggac 3540

atgttgcaga tccatgcacg taaactcgca agccgactga tgccttctga acaatggaaa 3600

ggcattattg ccgtaagccg tggcggtctg taccgggtgc gttactggcg cgtgaactgg 3660

gtattcgtca tgtcgatacc gtttgtattt ccagctacga tcacgacaac cagcgcgagc 3720

ttaaagtgct gaaacgcgca gaaggcgatg gcgaaggctt catcgttatt gatgacctgg 3780

tggataccgg tggtactgcg gttgcgattc gtgaaatgta tccaaaagcg cactttgtca 3840

ccatcttcgc aaaaccggct ggtcgtccgc tggttgatga ctatgttgtt gatatcccgc 3900

aagatacctg gattgaacag ccgtgggata tgggcgtcgt attcgtcccg ccaatctccg 3960

gtcgctaatc ttttcaacgc ctggcactgc cgggcgttgt tctttttaac ttcaggcggg 4020

ttacaatagt ttccagtaag tattctggag gctgcatcca tgacacaggc aaacctgagc 4080

gaaaccctgt tcaaaccccg ctttaaacat cctgaaacct cgacgctagt ccgccgcttt 4140

aatcacggcg cacaaccgcc tgtgcagtcg gcccttgatg gtaaaaccat ccctcactgg 4200

tatcgcatga ttaaccgtct gatgtggatc tggcgcggca ttgacccacg cgaaatcctc 4260

gacgtccagg cacgtattgt gatgagcgat gccgaacgta ccgacgatga tttatacgat 4320

acggtgattg gctaccgtgg cggcaactgg atttatgagt gggccccgga tctttgtgaa 4380

ggaaccttac ttctgtggtg tgacataatt ggacaaacta cctacagaga tttaaagctc 4440

taaggtaaat ataaaatttt taagtgtata atgtgttaaa ctactgattc taattgtttg 4500

tgtattttag attccaacct atggaactga tgaatgggag cagtggtgga atgcctttaa 4560

tgaggaaaac ctgttttgct cagaagaaat gccatctagt gatgatgagg ctactgctga 4620

ctctcaacat tctactcctc caaaaaagaa gagaaaggta gaagacccca aggactttcc 4680

ttcagaattg ctaagttttt tgagtcatgc tgtgtttagt aatagaactc ttgcttgctt 4740

tgctatttac accacaaagg aaaaagctgc actgctatac aagaaaatta tggaaaaata 4800

ttctgtaacc tttataagta ggcataacag ttataatcat aacatactgt tttttcttac 4860

tccacacagg catagagtgt ctgctattaa taactatgct caaaaattgt gtacctttag 4920

ctttttaatt tgtaaagggg ttaataagga atatttgatg tatagtgcct tgactagaga 4980

tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac ctcccacacc 5040

tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg tttattgcag 5100

cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt 5160

cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat gtctggatca 5220

actggataac tcaagctaac caaaatcatc ccaaacttcc caccccatac cctattacca 5280

ctgccaatta cctagtggtt tcatttactc taaacctgtg attcctctga attattttca 5340

ttttaaagaa attgtatttg ttaaatatgt actacaaact tagtagttgg aagggctaat 5400

tcactcccaa agaagacaag atatccttga tctgtggatc taccacacac aaggctactt 5460

ccctgattag cagaactaca caccagggcc aggggtcaga tatccactga cctttggatg 5520

gtgctacaag ctagtaccag ttgagccaga taaggtagaa gaggccaata aaggagagaa 5580

caccagcttg ttacaccctg tgagcctgca tgggatggat gacccggaga gagaagtgtt 5640

agagtggagg tttgacagcc gcctagcatt tcatcacgtg gcccgagagc tgcatccgga 5700

gtacttcaag aactgctgat atcgagcttg ctacaaggga ctttccgctg gggactttcc 5760

agggaggcgt ggcctgggcg ggactgggga gtggcgagcc ctcagatcct gcatataagc 5820

agctgctttt tgcctgtact gggtctctct ggttagacca gatctgagcc tgggagctct 5880

ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga gtgcttcaag 5940

tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga cccttttagt 6000

cagtgtggaa aatctctagc agtggcgccc gaacagggac ttgaaagcga aagggaaacc 6060

agaggagctc tctcgacgca ggactcggct tgctgaagcg cgcacggcaa gaggcgaggg 6120

gcggcgactg gtgagtacgc caaaaatttt gactagcgga ggctagaagg agagagatgg 6180

gtgcgagagc gtcagtatta agcgggggag aattagatcg cgatgggaaa aaattcggtt 6240

aaggccaggg ggaaagaaaa aatataaatt aaaacatata gtatgggcaa gcagggagct 6300

agaacgattc gcagttaatc ctggcctgtt agaaacatca gaaggctgta gacaaatact 6360

gggacagcta caaccatccc ttcagacagg atcagaagaa cttagatcat tatataatac 6420

agtagcaacc ctctattgtg tgcatcaaag gatagagata aaagacacca aggaagcttt 6480

agacaagata gaggaagagc aaaacaaaag taagaccacc gcacagcaag cggccggccg 6540

ctgatcttca gacctggagg aggagatatg agggacaatt ggagaagtga attatataaa 6600

tataaagtag taaaaattga accattagga gtagcaccca ccaaggcaaa gagaagagtg 6660

gtgcagagag aaaaaagagc agtgggaata ggagctttgt tccttgggtt cttgggagca 6720

gcaggaagca ctatgggcgc agcgtcaatg acgctgacgg tacaggccag acaattattg 6780

tctggtatag tgcagcagca gaacaatttg ctgagggcta ttgaggcgca acagcatctg 6840

ttgcaactca cagtctgggg catcaagcag ctccaggcaa gaatcctggc tgtgaaagat 6900

acctaaagga tcaacagctc ctggggattt ggggttgctc tggaaaactc atttgcacca 6960

ctgctgtgcc ttggaatgct agttggagta ataaatctct ggaacagatt tggaatcaca 7020

cgacctggat ggagtgggac agagaaatta acaattacac aagcttaata cactccttaa 7080

ttgaagaatc gcaaaaccag caagaaaaga atgaacaaga attattggaa ttagataaat 7140

gggcaagttt gtggaattgg tttaacataa caaattggct gtggtatata aaattattca 7200

taatgatagt aggaggcttg gtaggtttaa gaatagtttt tgctgtactt tctatagtga 7260

atagagttag gcagggatat tcaccattat cgtttcagac ccacctccca accccgaggg 7320

gacccgacag gcccgaagga atagaagaag aaggtggaga gagagacaga gacagatcca 7380

ttcgattagt gaacggatct cgacggtatc gccaaatggc agtattcatc cacaatttta 7440

aaagaaaagg ggggattggg gggtacagtg caggggaaag aatagtagac ataatagcaa 7500

cagacataca aactaaagaa ttacaaaaac aaattacaaa aattcaaaat tttcgggttt 7560

attacaggga cagcagagat ccagtttatc gataagcttt gcaaagatgg ataaagtttt 7620

aaacagagag gaatctttgc agctaatgga ccttctaggt cttgaaagga gtgggaattg 7680

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 7740

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 7800

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 7860

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 7920

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 7980

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 8040

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 8100

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 8160

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 8220

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 8280

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 8340

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 8400

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 8460

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 8520

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 8580

cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg cacctcgatt 8640

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 8700

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 8760

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 8820

tggttcaaag tttttttctt ccatttcagg tgtcgtgagg taccgcctag gacgcgtgga 8880

tccgccacca tggccttacc agtgaccgcc ttgctcctgc cgctggcctt gctgctccac 8940

gccgccaggc cggagcagaa acttatcagt gaggaggacc tggacatcca gatgacacag 9000

actacatcct ccctgtctgc ctctctggga gacagagtca ccatcagttg cagggcaagt 9060

caggacatta gtaaatattt aaattggtat cagcagaaac cagatggaac tgttaaactc 9120

ctgatctacc atacatcaag attacactca ggagtcccat caaggttcag tggcagtggg 9180

tctggaacag attattctct caccattagc aacctggagc aagaagatat tgccacttac 9240

ttttgccaac agggtaatac gcttccgtac acgttcggag gggggaccaa gctggagatc 9300

acaggtggcg gtggctcggg cggtggtggg tcgggtggcg gcggatctga ggtgaaactg 9360

caggagtcag gacctggcct ggtggcgccc tcacagagcc tgtccgtcac atgcactgtc 9420

tcaggggtct cattacccga ctatggtgta agctggattc gccagcctcc acgaaagggt 9480

ctggagtggc tgggagtaat atggggtagt gaaaccacat actataattc agctctcaaa 9540

tccagactga ccatcatcaa ggacaactcc aagagccaag ttttcttaaa aatgaacagt 9600

ctgcaaactg atgacacagc catttactac tgtgccaaac attattacta cggtggtagc 9660

tatgctatgg actactgggg ccaaggaacc tcagtcaccg tctcctcagc ggccgcattc 9720

gtgccggtct tcctgccagc gaagcccacc acgacgccag cgccgcgacc accaacaccg 9780

gcgcccacca tcgcgtcgca gcccctgtcc ctgcgcccag aggcgtgccg gccagcggcg 9840

gggggcgcag tgcacacgag ggggctggac ttcgcctgtg atatctacat ctgggcgccc 9900

ttggccggga cttgtggggt ccttctcctg tcactggtta tcacccttta ctgcaaacgg 9960

ggcagaaaga aactcctgta tatattcaaa caaccattta tgagaccagt acaaactact 10020

caagaggaag atggctgtag ctgccgattt ccagaagaag aagaaggagg atgtgaactg 10080

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 10140

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 10200

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 10260

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 10320

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 10380

tacgacgccc ttcacatgca ggccctgccc cctcgctgag acgaatgccg agataccgtc 10440

ggatatcgaa ttcccacggg gttggggttg cgccttttcc aaggcagccc tgggtttgcg 10500

cagggacgcg gctgctctgg gcgtggttcc gggaaacgca gcggcgccga ccctgggtct 10560

cgcacattct tcacgtccgt tcgcagcgtc acccggatct tcgccgctac ccttgtgggc 10620

cccccggcga cgcttcctgc tccgccccta agtcgggaag gttccttgcg gttcgcggcg 10680

tgccggacgt gacaaacgga agccgcacgt ctcactagta ccctcgcaga cggacagcgc 10740

cagggagcaa tggcagcgcg ccgaccgcga tgggctgtgg ccaatagcgg ctgctcagcg 10800

gggcgcgccg agagcagcgg ccgggaaggg gcggtgcggg aggcggggtg tggggcggta 10860

gtgtgggccc tgttcctgcc cgcgcggtgt tccgcattct gcaagcctcc ggagcgcacg 10920

tcggcagtcg gctccctcgt tgaccgaatc accgacctct ctccccaggg ggatccaccg 10980

gtcgccacca tggtgagcaa gggcgaggag gataacatgg ccatcatcaa ggagttcatg 11040

cgcttcaagg tgcacatgga gggctccgtg aacggccacg agttcgagat cgagggcgag 11100

ggcgagggcc gcccctacga gggcacccag accgccaagc tgaaggtgac caagggtggc 11160

cccctgccct tcgcctggga catcctgtcc cctcagttca tgtacggctc caaggcctac 11220

gtgaagcacc ccgccgacat ccccgactac ttgaagctgt ccttccccga gggcttcaag 11280

tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca ggactcctcc 11340

ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt cccctccgac 11400

ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct cctccgagcg gatgtacccc 11460

gaggacggcg ccctgaaggg cgagatcaag cagaggctga agctgaagga cggcggccac 11520

tacgacgctg aggtcaagac cacctacaag gccaagaagc ccgtgcagct gcccggcgcc 11580

tacaacgtca acatcaagtt ggacatcacc tcccacaacg aggactacac catcgtggaa 11640

cagtacgaac gcgccgaggg ccgccactcc accggcggca tggacgagct gtacaagtaa 11700

agcgtcgaca atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 11760

tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 11820

gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat 11880

gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca 11940

acccccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc 12000

cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 12060

gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca 12120

tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct 12180

tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt 12240

ccgcgtcttc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgc 12298

<210> 11

<211> 5200

<212> DNA

<213>artificial sequence

<400> 11

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgttcaagg ccttatatcg agtaaacggt agtgctgggg 180

cttagacgca ggtgttctga tttatagttc aaaacctcta tcaatgagag agcaatctcc 240

tggtaatgtg atagatttcc caacttaatg ccaacatacc ataaacctcc cattctgcta 300

atgcccagcc taagttgggg agaccactcc agattccaag atgtacagtt tgctttgctg 360

ggcctttttc ccatgcctgc ctttactctg ccagagttat attgctgggg ttttgaagaa 420

gatcctatta aataaaagaa taagcagtat tattaagtag ccctgcattt caggtttcct 480

tgagtggcag gccaggcctg gccgtgaacg ttcactgaaa tcatggcctc ttggccaaga 540

ttgatagctt gtgcctgtcc ctgagtccca gtccatcacg agcagctggt ttctaagatg 600

ctatttcccg tataaagcat gagaccgtga cttgccagcc ccacagagcc ccgcccttgt 660

ccatcactgg catctggact ccagcctggg ttggggcaaa gagggaaatg agatcatgtc 720

ctaaccctga tcctcttgtc ccacactagg gacagcgatc gggtacatcg atcgcaggcg 780

caatcttcgc atttcttttt tccagacgct actaacttca gcctgctgaa gcaggctgga 840

gacgtggagg agaaccctgg acctgtgagc aagggcgagg agctgttcac cggggtggtg 900

cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag 960

ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag 1020

ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc 1080

cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac 1140

gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg 1200

aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag 1260

gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc 1320

atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag 1380

gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc 1440

gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac 1500

gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc 1560

atggacgagc tgtacaagta ctcagatctc gagctcaagt agctgtgcct tctagttgcc 1620

agccatctgt tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca 1680

ctgtcctttc ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta 1740

ttctgggggg tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc 1800

atgctgggga tgcggtgggc tctatgggat atccagaacc ctgaccctgc cgtgtaccag 1860

ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 1920

acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 1980

atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 2040

gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 2100

ggtaagggca gctttggtgc cttcgcaggc tgtttccttg cttcaggaat ggccaggttc 2160

tgcccagagc tctggtcaat gatgtctaaa actcctctga ttggtggtct cggccttatc 2220

cattgccacc aaaaccctct ttttactaag aaacagtgag ccttgttctg gcagtccaga 2280

gaatgacacg ggaaaaaagc agatgaagag aaggtggcag gagagggcac gtggcccagc 2340

ctcagtctct ccaactgagt tcctgcctgc ctgcctttgc tcagactgtt tgccccttac 2400

tgctcttcta ggcctcattc taactgattt tgtaggtaac cacgtgcgga ccgagcggcc 2460

gcaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga 2520

ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga 2580

gcgagcgcgc agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg 2640

cggtatttca caccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta 2700

agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg 2760

cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa 2820

gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc 2880

aaaaaacttg atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt 2940

cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca 3000

acactcaacc ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc 3060

tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta 3120

acgtttacaa ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 3180

cagccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca 3240

tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg 3300

tcatcaccga aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat 3360

gtcatgataa taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga 3420

acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 3480

ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt 3540

gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg 3600

ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg 3660

gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg 3720

agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag 3780

caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca 3840

gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg 3900

agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc 3960

gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg 4020

aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg 4080

ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 4140

tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 4200

tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 4260

gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 4320

atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 4380

ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 4440

aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 4500

ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 4560

ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 4620

tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 4680

cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct 4740

gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 4800

gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 4860

tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 4920

ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 4980

gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 5040

ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 5100

tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 5160

ttacggttcc tggccttttg ctggcctttt gctcacatgt 5200

<210> 12

<211> 2603

<212> DNA

<213>artificial sequence

<400> 12

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggccgcac gcgttcaagg ccttatatcg agtaaacggt agtgctgggg 180

cttagacgca ggtgttctga tttatagttc aaaacctcta tcaatgagag agcaatctcc 240

tggtaatgtg atagatttcc caacttaatg ccaacatacc ataaacctcc cattctgcta 300

atgcccagcc taagttgggg agaccactcc agattccaag atgtacagtt tgctttgctg 360

ggcctttttc ccatgcctgc ctttactctg ccagagttat attgctgggg ttttgaagaa 420

gatcctatta aataaaagaa taagcagtat tattaagtag ccctgcattt caggtttcct 480

tgagtggcag gccaggcctg gccgtgaacg ttcactgaaa tcatggcctc ttggccaaga 540

ttgatagctt gtgcctgtcc ctgagtccca gtccatcacg agcagctggt ttctaagatg 600

ctatttcccg tataaagcat gagaccgtga cttgccagcc ccacagagcc ccgcccttgt 660

ccatcactgg catctggact ccagcctggg ttggggcaaa gagggaaatg agatcatgtc 720

ctaaccctga tcctcttgtc ccacactagg gacagcgatc gggtacatcg atcgcaggcg 780

caatcttcgc atttcttttt tccagacgct actaacttca gcctgctgaa gcaggctgga 840

gacgtggagg agaaccctgg acctgtgagc aagggcgagg agctgttcac cggggtggtg 900

cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag 960

ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag 1020

ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc 1080

cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac 1140

gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg 1200

aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag 1260

gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc 1320

atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag 1380

gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc 1440

gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac 1500

gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc 1560

atggacgagc tgtacaagta ctcagatctc gagctcaagt agctgtgcct tctagttgcc 1620

agccatctgt tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca 1680

ctgtcctttc ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta 1740

ttctgggggg tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc 1800

atgctgggga tgcggtgggc tctatgggat atccagaacc ctgaccctgc cgtgtaccag 1860

ctgagagact ctaaatccag tgacaagtct gtctgcctat tcaccgattt tgattctcaa 1920

acaaatgtgt cacaaagtaa ggattctgat gtgtatatca cagacaaaac tgtgctagac 1980

atgaggtcta tggacttcaa gagcaacagt gctgtggcct ggagcaacaa atctgacttt 2040

gcatgtgcaa acgccttcaa caacagcatt attccagaag acaccttctt ccccagccca 2100

ggtaagggca gctttggtgc cttcgcaggc tgtttccttg cttcaggaat ggccaggttc 2160

tgcccagagc tctggtcaat gatgtctaaa actcctctga ttggtggtct cggccttatc 2220

cattgccacc aaaaccctct ttttactaag aaacagtgag ccttgttctg gcagtccaga 2280

gaatgacacg ggaaaaaagc agatgaagag aaggtggcag gagagggcac gtggcccagc 2340

ctcagtctct ccaactgagt tcctgcctgc ctgcctttgc tcagactgtt tgccccttac 2400

tgctcttcta ggcctcattc taactgattt tgtaggtaac cacgtgcgga ccgagcggcc 2460

gcaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga 2520

ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga 2580

gcgagcgcgc agctgcctgc agg 2603

<210> 13

<211> 23

<212> DNA

<213>artificial sequence

<400> 13

ctggatatct gtgggacaag agg 23

Claims (14)

1. a kind of recombined glandulae correlation viral vectors, which is characterized in that the gland relevant viral vector includes to be operatively connected as follows Sequential element: 5 ' inverted terminal repeat sequences, 3 ' inverted terminal repeat sequences and encode CAR gene sequence.

2. recombined glandulae correlation viral vectors as described in claim 1, which is characterized in that it is described coding CAR gene sequence be CD19CAR(4-1BB)。

3. recombined glandulae correlation viral vectors as claimed in claim 1 or 2, which is characterized in that the gland relevant viral vector into One step includes the sequential element being operatively connected as follows: SA sequence, 2A sequence, polyA sequence, 5 ' genome homologous sequences (5 ' HA), 3 ' genome homologous sequences (3 ' HA).

4. recombined glandulae correlation viral vectors as claimed in claim 3, which is characterized in that described CD19CAR (4-1BB) sequence Include sequence shown in SEQ ID NO:4.

5. the recombined glandulae correlation viral vectors as described in claim 1-4 any one, which is characterized in that the sequential element Sequence is selected from following sequence: 5 ' the HA sequences include sequence shown in SEQ ID NO:1；The SA sequence includes SEQ Sequence shown in ID NO:2；The 2A sequence includes sequence shown in SEQ ID NO:3；；The polyA sequence includes Sequence shown in SEQ ID NO:5；3 ' the HA sequences include sequence shown in SEQ ID NO:6；5 ' the ends are anti- It include sequence shown in SEQ ID NO:7 to repetitive sequence；3 ' the inverted terminal repeat sequences include SEQ ID NO:8 institute The sequence shown.

6. the recombined glandulae correlation viral vectors as described in claim 1-5 any one, which is characterized in that the recombination gland is related Viral vectors includes to have at least about 70%, at least about 80%, at least about 90% sequence same with sequence shown in SEQ ID NO:9 The nucleotide sequence of the sequence identity of one property or more.

7. the preparation method of recombined glandulae correlation viral vectors as claimed in any one of claims 1 to 6, it is characterised in that: described Method is the following steps are included: provide the package cell line of viral vectors as claimed in any one of claims 1 to 6；With from the packet Fill recycling recombination AAV virus in the supernatant of cell line.

8. a kind of recombinant adeno-associated virus, which is characterized in that the virus is by recombination gland related diseases of any of claims 1 or 2 Poisonous carrier packaging obtains.

9. a kind of method for expressing CAR gene, it is characterised in that: the method includes providing including coding claim 1- The nucleotide sequence of the recombinant adeno-associated virus (AAV) of 6 any one；It, will be described in conjunction with CRISPR/cas9 gene editing technology In AAV homologous recombination to the genome of T cell, the AAV expresses the CAR gene in T cell.

10. recombination gland described in recombined glandulae correlation viral vectors as claimed in any one of claims 1 to 6, claim 8 is related Virus is preparing the application in CAR-T cell or anti-tumor drug.

11. a kind of CAR-T cell preparation method of recombined glandulae correlation viral vectors, it is characterised in that: this method includes following step It is rapid:

The first step constructs recombined glandulae correlation viral vectors as claimed in any one of claims 1 to 6；

Second step, virus packaging；

Third step, T cell separation, activation and amplification, CRISPR/cas9 gene editing, AAV virus-mediated genetic recombination；

Preparing recombined glandulae correlation viral vectors as claimed in any one of claims 1 to 6 is by gene editing means, by its table Up to the T cell separated and collected in cancer patient or healthy human peripheral blood to obtain CAR-T cell.

12. a kind of CAR-T cell prepared by claim 11 the method.

13. a kind of kit, which is characterized in that include recombination gland as claimed in any one of claims 1 to 6 in the kit CAR-T cell described in recombinant adeno-associated virus or claim 12 described in related viral vectors, claim 8.

14. kit application in preparation of anti-tumor drugs described in CAR-T cell or claim 13 described in claim 12.