CN109824784A - Nano antibody-magnetic corpusculum immunomagnetic beads compound and the preparation method and application thereof - Google Patents

Abstract

The present invention provides a kind of nano antibody-magnetic corpusculum immunomagnetic beads compound and the preparation method and application thereof.Nano antibody-Magnetosome membrane protein fusion gene is inserted at the multiple cloning sites of suicide plasmid and obtains recombinant plasmid, recombinant plasmid is transferred in wild type magnetic spirillum, the recombination magnetic spirillum of acquisition can show target nano antibody (immunomagnetic beads compound) on Magnetosome membrane.The immunomagnetic beads compound has Magnetic Isolation and the dual function to corresponding antigens identification simultaneously, cannot be only used for the ELISA detection and application of target antigen, can be also used for the absorption and enrichment of target antigen.The present invention is based on technique for gene engineerings to prepare nano antibody-magnetic corpusculum immunomagnetic beads compound, and comparing traditional chemical conjugation methods has the clear superiorities such as production cost is low, the period is short, is easy to purify.

Description

Nano antibody-magnetic corpusculum immunomagnetic beads compound and the preparation method and application thereof

Technical field

The present invention relates to genetic engineering fields, specifically, be related to nano antibody-magnetic corpusculum immunomagnetic beads compound and its Preparation method and application.

Background technique

To prepare functional protein-magnetic-particle method be chemical coupling method at present, magnetic-particle used generally by Artificial chemistry synthesis, reaction step is many and diverse, severe reaction conditions, i.e. the synthesis of inner nuclear material before this, then inner nuclear material is embedded In shell, whole process needs stringent control temperature and pH.Kernel magnetic-particle can be by the method for co-precipitation, this is needed High pH (pH=10) is wanted, it can also be by temperature in 80-350 DEG C of thermal decomposition method, sol-gal process, immersion method etc..It can be with It is assembled into the surface of kernel using surfactant, forms shell, surfactant has lauryl sodium sulfate, cetyl front three Base ammonium bromide etc..

Magnetic corpusculum (magnetosome) is that the magnetism of magnetotactic bacteria (magnetotactic bacteria) synthesis intracellular is received Rice corpuscles.The synthesis of magnetic corpusculum is that a series of orderly enzymes are catalyzed under specific physiological environment by the procedural control of gene The product of synthesis, therefore, shape, size, chemical component of magnetic corpusculum etc. are all very single.Microorganism can be considered as cheap receive Rice magnetic-particle manufactory, the original material needed for them only have simple carbon source, nitrogen source etc., therefore, the synthesis side of magnetic corpusculum Just and it is environmentally friendly.

Crosslinking agent is the necessity that target proteins are coupled to chemically synthesized nano grain surface, common to be chemically crosslinked Agent has: glutaraldehyde, carbodiimide hydrochloride etc..Magnetic corpusculum is by Microbe synthesis, by phospholipid bilayer package Portion is Fe₃O₄Magnetic-particle.The package of outer membrane, i.e. Magnetosome membrane make magnetic corpusculum have good dispersibility.The grain of magnetic corpusculum Diameter is typically distributed across between 40-50nm, 1-20 times smaller than artificial synthesized load medicine magnetic particle between single magnetic domain range.It is abundant Memebrane protein is embedded in the phospholipid bilayer of Magnetosome membrane, they can be used as the load of foreign protein, nucleic acid, drug etc. Body.It wherein, is specific to magnetotactic bacteria there are about 20 kinds of memebrane proteins.Above-mentioned two o'clock illustrates magnetic corpusculum than artificial synthesized magnetic Grain is more advantageous.Therefore, magnetic corpusculum all shows potential application value in many fields, such as nucleic acid and albumen Carrier, immunoassay, pharmaceutical carrier, magnetic resonance imaging, magnetic thermotherapy, biocatalyst, information storage of matter macromolecular substances etc..

Nano antibody is single domain antibody, and molecular weight is about 14KD, and size is in camellid body about between 2-4nm Heavy chain antibody can identify the region of antigen, i.e., only by a short nucleotide coding.Therefore, nano antibody is common in addition to having The advantages that affinity of antibody, specificity, at the same be also equipped with stability is high, molecular weight is small, it is water-soluble it is strong, be easy to biotechnology behaviour The advantages that making.In medical research, nano antibody is in addition to can be used as drug, for treating inflammation, neurogenic disease, resisting and swell Tumor, virus neutralize preparation etc.；Be also used as the carrier of drug, be fused on nano particle, prepare diagnose rapidly kit, It is fused to and diagnoses virus on oligomer albumen, is coupled to the parasitic disease for treating the mankind on albumen etc.；In base application, nanometer Antibody can be used as bonding agent, unordered albumen and the molecular chaperones of macromolecular complex of albumen etc..In addition, nano antibody also by It is considered as the tool of environment measuring, to analyze the small molecule contaminants in environment.

Summary of the invention

The object of the present invention is to provide a kind of nano antibody-magnetic corpusculum immunomagnetic beads compound and preparation method thereof with answer With.

Present inventive concept is as follows: the present invention is in the method for homologous double-crossover by exogenous origin gene integrator to host strain (magnetic spirillum) Genome on, the anchorin selected is MamC, expression bacterial strain culture when be not necessarily to outer added with antibiotic, the transcription of foreign gene Plasmid stabilisation is compared with expression.This method for the first time will environment-identification small molecular pollutant nano antibody show it is small in magnetic The surface of body.

In order to achieve the object of the present invention, in a first aspect, the present invention provides a kind of nano antibody-magnetic corpusculum fusion protein, institute Stating fusion protein is by being directly connected in series between nano antibody and Magnetosome membrane albumen or passing through flexibility Linker operationally It connects and composes.

Wherein, the nano antibody is resisted using the nanometer for capableing of specific recognition antigen that display technique of bacteriophage obtains Body.The Magnetosome membrane albumen is from magnetotactic bacteria.

Preferably, the nano antibody be tetrabromobisphenol A specific nano antibody, amino acid sequence such as SEQ ID NO: Shown in 6, the gene order of the nano antibody is encoded as shown in SEQ ID NO:4.

Preferably, the amino acid sequence of the Magnetosome membrane albumen encodes the memebrane protein as shown in SEQ ID NO:7 Gene order is as shown in SEQ ID NO:1.

It is highly preferred that the nano antibody-magnetic corpusculum fusion protein is tetrabromobisphenol A specific nano antibody-magnetic corpusculum The fusion protein of memebrane protein.Tetrabromobisphenol A specific nano antibody in the fusion protein can be substituted for have and identify it The nano antibody of his antigen function.

Second aspect, the present invention provide the gene of encoding said fusion protein, i.e. nano antibody-Magnetosome membrane protein fusion Gene.

The third aspect, the present invention provide a kind of polynucleotide (fusion), the upstream comprising Magnetosome membrane protein gene Sequence, Magnetosome membrane protein gene, nano antibody gene and Magnetosome membrane protein gene downstream sequence.The fusion Structure is as follows: the upstream sequence of Magnetosome membrane protein gene-Magnetosome membrane protein gene-nano antibody gene-Magnetosome membrane egg The downstream sequence of white gene, alternatively, the upstream sequence of Magnetosome membrane protein gene-nano antibody gene-Magnetosome membrane albumen base The downstream sequence of cause-Magnetosome membrane protein gene.

Preferably, the upstream sequence of the Magnetosome membrane protein gene is as shown in SEQ ID NO:2, the Magnetosome membrane egg The downstream sequence of white gene is as shown in SEQ ID NO:3.

It is highly preferred that the nucleotide sequence of the polynucleotide is as shown in SEQ ID NO:5.

Fourth aspect, the present invention provides the biomaterial containing the antigen-4 fusion protein gene or the polynucleotide, described Biomaterial includes but is not limited to recombinant DNA, expression cassette, transposons, plasmid vector, phage vector, viral vectors or engineering Bacterium.

Preferably, the present invention constructs the expression vector of the antigen-4 fusion protein gene using plasmid pK18mobSacB.That is, will Nano antibody-Magnetosome membrane protein fusion gene is inserted into the recombinant plasmid obtained at the multiple cloning sites of suicide plasmid.

5th aspect, the present invention provide a kind of recombination magnetic spirillum, the antigen-4 fusion protein gene or the polynucleotide are led to Plasmid is crossed to be transferred into magnetic spirillum or be integrated on magnetic spirillum chromosome by genetic engineering means.

Preferably, the magnetic spirillum is Magnetospirillum gryphiswaldensense, more preferably M.gryphiswaldense MSR-1。

The construction method of the recombination magnetic spirillum is as follows: polynucleotide construct shown in SEQ ID NO:5 is arrived At the multiple cloning sites of pK18mobSacB carrier, gained recombinant vector is transferred into M.gryphiswaldense MSR-1, screening Recon to obtain the final product.

6th aspect, the present invention provides a kind of recombinant bacterial strain and its construction method, the nano magnetics of recombinant bacterial strain synthesis Corpusculum surface can show nano antibody.Nano antibody gene is merged with Magnetosome membrane protein gene specially, is merged Gene, which is inserted at the multiple cloning sites of suicide plasmid, obtains recombinant plasmid, and recombinant plasmid is transferred in wild type magnetic spirillum, is obtained The recombination magnetic spirillum obtained can show target nano antibody on Magnetosome membrane.

Further, the present invention, which is provided, prepares nano antibody-magnetic corpusculum immunomagnetic beads compound based on technique for gene engineering Method, comprising the following steps:

1, building carries anchorin upstream region of gene arm gene, nano antibody-anchorin fusion, anchorin The recombination suicide plasmid of downstream of gene arm gene；

2, above-mentioned recombination suicide plasmid is transferred in wild type M.gryphiswaldense by parents' mating experiment, Antibiotic and sucrose screening are passed sequentially through, is verified by bacterium colony PCR and magnetic response verifying determines the positive colony bacterium that screening obtains Strain；

3, the positive colony bacterial strain for obtaining above-mentioned screening is received through the culture of Na lactate culture media shaking flask or Submerged fermentation Collect cell thallus, sonicated cells, Magnetic Isolation, PBS cleans to obtain high-purity nano antibody-magnetic corpusculum immunomagnetic beads compound Object.

7th aspect, the present invention provide a kind of nano antibody-magnetic corpusculum immunomagnetic beads compound, and the immunomagnetic beads are compound Object and is obtained from culture by magnetic absorption by cultivating the recombination magnetic spirillum.

Eighth aspect, the present invention provide that using the recombination magnetic spirillum to prepare nano antibody-magnetic corpusculum immunomagnetic beads compound The method of object, including the recombination magnetic spirillum is cultivated in the fermentation medium, and nanometer is isolated and purified from culture Antibody-magnetic corpusculum immunomagnetic beads compound.

Further, it the method includes thalline were collected by centrifugation, is then resuspended, ultrasonication, finally by magnetic absorption Obtain nano antibody-magnetic corpusculum immunomagnetic beads compound.

In the specific embodiment of the present invention, magnetic is immunized in the tetrabromobisphenol A specific nano antibody-magnetic corpusculum Pearl compound the preparation method is as follows:

(1) PCR amplification respectively Magnetosome membrane protein gene SEQ ID NO:1, the Magnetosome membrane protein gene it is upper Swim the downstream gene SEQ ID NO:3 and nano antibody gene of genes of SEQ ID NO:2, the Magnetosome membrane protein gene SEQ ID NO:4, by fusion DNA vaccine technology by SEQ ID NO:2-SEQ ID NO:4-SEQ ID NO:1-SEQ ID NO:3 Splicing obtains fusion SEQ ID NO:5.Fusion SEQ ID NO:5 is inserted into pMD19-T simple carrier, And be transformed into E.coli DH5 α competent cell, the sequencing of picking single colonie obtains the fusion SEQ ID of correct sequence NO:5；

(2) the SEQ ID NO:5 sequence on pMD19-T simple carrier is obtained using digestion with restriction enzyme, be inserted into To at the multiple cloning sites of the pK18mobSacB carrier with identical restriction enzyme site, the recombinant plasmid transformed that constructs E.coli S17-1 competent cell；

(3) recombinant plasmid intracellular of donor bacterium E.coli S17-1 in step (2) is transferred to wild type In M.gryphiswaldensense MSR-1, successively existing for the antibiotic and sucrose under the conditions of filter out fusion integration Recombinant bacterial strain onto M.gryphiswaldensense MSR-1 genome.Under conditions of Na lactate culture media shaking flask culture Or recombinant bacterial strain is cultivated under conditions of deep drainpipe, high-power ultrasonic smudge cells extract nano antibody-magnetic corpusculum immunomagnetic beads Compound, PBS liquid (pH7.4) are resuspended, low power ultrasound cleaning, magnetic absorption, and the nano antibody-magnetic corpusculum for obtaining high-purity is immune Bead complexes.

Method above-mentioned, for expanding SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ in step (1) The PCR reaction system of ID NO:4 are as follows: 2 × pfu Mix, 25 μ l；1.25 μ l of forward primer；1.25 μ l of reverse primer；Distilled water 21.25μl；1.25 μ l of template DNA.Reaction condition are as follows: 95 DEG C of 5min of initial denaturation；95 DEG C of 30s are denaturalized, anneals 55 DEG C -65 DEG C, prolongs 72 DEG C of Shen 30s or 1min, 30 circulations；Finally extend 72 DEG C of 10min；Save 25 DEG C of 1min.

For expanding the forward primer of SEQ ID NO:1 are as follows: GATCTGGTGGCGGCGGTTCCGGTGGCGGTGGCAGCT TTCAACTTGCGCCGTAC；Reverse primer are as follows: TCAGGCCAATTCTTCCCTCAG；For expanding the forward direction of SEQ ID NO:2 Primer are as follows: CCGGAATTCGGCGCAGTTTCGTCTCAGG；Reverse primer are as follows: GAGCTGCAACTGCATCATCGCTGTTGTCCT；For expanding the forward primer of SEQ ID NO:3 are as follows: TGAGGGAAGAATTGG；Reverse primer are as follows: GCTCTAGAAGAACAAGGCAGAGGCGAT；For expanding SEQ ID NO:4's Forward primer are as follows: ATGCAGTTGCAGCTCGTGGAG；Reverse primer are as follows: AACCGCCGCCACCAGATCCACCACCGCCGGAA TGGTGATGGTGATGATGGTC。

Method above-mentioned, for expanding the PCR reaction system of SEQ ID NO:5 in step (2) are as follows: 2 × pfu Mix, 25 μ l；0.5 μ l of forward primer；0.5 μ l of reverse primer；23.5 μ l of distilled water；0.5 μ l of template DNA.Reaction condition are as follows: initial denaturation 95 ℃5min；95 DEG C of 30s are denaturalized, are annealed 55 DEG C -65 DEG C, 72 DEG C of Shen 2.5min, 30 circulations are prolonged；Finally extend 72 DEG C of 10min；It protects Deposit 25 DEG C of 1min.

For expanding the forward primer of SEQ ID NO:5 are as follows: CCGGAATTCGGCGCAGTTTCGTCTCAGG；Reverse primer Are as follows: GCTCTAGAAGAACAAGGCAGAGGCGAT.

Method above-mentioned, restriction enzyme used in step (2) are respectively as follows: EcoR I and Xba I.

Method above-mentioned, antibiotic used in step (3) are kanamycins, sucrose concentration 10%.

The high power of step (3) ultrasonication is 200-300W；Low-power is 40-100W.

The formula of PBS liquid are as follows: 7.9g NaCl, 0.2g KCl, 0.24g KH₂PO₄, 1.8g K₂HPO₄, pH 7.4.

9th aspect, the present invention provide the nano antibody-magnetic corpusculum immunomagnetic beads compound following any application:

1) detection, absorption, the purification etc. of tetrabromobisphenol A are used for；

2) detection reagent or kit of tetrabromobisphenol A are used to prepare.

By above-mentioned technical proposal, the present invention at least have following advantages and the utility model has the advantages that

(1) it is received using the magnetic corpusculum surface display of the recombination magnetic spirillum synthesis of the method for the present invention building acquisition functionality Meter Kang Ti, the compound have Magnetic Isolation and the dual function to corresponding antigens identification simultaneously.It cannot be only used for target antigen ELISA detection and application, can be also used for the absorption and enrichment of target antigen.The present invention is based on technique for gene engineerings to prepare Nano antibody-magnetic corpusculum immunomagnetic beads compound compares traditional chemical conjugation methods with production cost is low, the period is short, easy In clear superiorities such as purifying.

(2) element of the transcript and expression for the recombination magnetic spirillum control fusion that present invention building obtains is still former base Because of the control element in group, recombinant bacterium cultural method is simple, easily operated, and outer added with antibiotic is not necessarily in incubation, synthesis Magnetic corpusculum surface display functional nano antibody, the acquisition of the nano antibody-magnetic corpusculum immunomagnetic beads compound only need letter Single sonicated cells and Magnetic Isolation, can be obtained the product of high-purity.The compound have simultaneously Magnetic Isolation and The dual function of nano antibody specific recognition.

(3) present invention solve traditional chemical coupling function albumen-magnetic particle manufacture be at high cost, the production cycle is long, batch The problems such as difference is big between secondary, while having important practical significance in fields such as medicine living organism non-destructive monitoring, medicament research and developments.

(4) nano antibody of specific recognition small molecule tetrabromobisphenol A provided by the invention-magnetic corpusculum immunomagnetic beads are multiple Object is closed, the products such as the immune detection for small molecule contaminants tetrabromobisphenol A, purification, absorption can be developed based on this compound, It has a extensive future.

Detailed description of the invention

Fig. 1 is the electromicroscopic photograph that magnetic spirillum is recombinated in the embodiment of the present invention 2.Little particle of black is that specific recognition is small in figure The nano antibody of molecule tetrabromobisphenol A-magnetic corpusculum immunomagnetic beads compound.

Fig. 2 is to utilize nano antibody-magnetic corpusculum immunomagnetic beads compound using one-step ELISA in the embodiment of the present invention 5 Detect the result of small molecule tetrabromobisphenol A.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment According to conventional laboratory conditions, such as Sambrook molecular cloning experiment handbook (Sambrook J Russell DW, Molecular Cloning:a Laboratory Manual, 2001), or according to the condition of manufacturer's specification suggestion.

The building of the recombination suicide plasmid of embodiment 1

1,1 primer of table, high-fidelity pfu enzyme, the difference upstream PCR amplification mamC arm gene, mamC gene, the downstream mamC are utilized The nano antibody gene of arm gene and anti-tetrabromobisphenol A.PCR system and condition are as follows:

PCR system (50 μ l):

PCR condition (denaturation → annealing → extension: 30 circulations):

Table 1PCR expands the primer

Note: underscore is restriction enzyme site sequence.

2, it will be walked according to the specification of the Ago-Gel DNA QIAquick Gel Extraction Kit of TIANGEN Biotech (Beijing) Co., Ltd. Pcr amplification product in rapid 1 carries out gel extraction；

3, each genetic fragment that acquisition is recycled in step 2 is carried out by the amplification of 3 step fusion DNA vaccines using fusion DNA vaccine technology:

It is that nano antibody gene with merging for mamC gene expands to obtain fusion 1 first, reaction system and condition are as follows:

PCR system (50 μ l):

PCR condition (denaturation → annealing → extension: 30 circulations):

Fusion 2 is merged to obtain followed by fusion 1 and the upstream mamC arm gene, reaction system and condition are as follows:

PCR system (50 μ l):

PCR condition (denaturation → annealing → extension: 30 circulations):

Be followed by fusion 2 and mamC downstream arm gene merges to obtain fusion TBC, and reaction system and condition are such as Under:

PCR system (50 μ l):

PCR condition (denaturation → annealing → extension: 30 circulations):

It is finally that 3 ' ends of TBC fusion are added into " A ", it is spare for subsequent experimental, i.e., in above-mentioned reaction system 2 × Taq PCR Mix of 10 μ l is added to react 30min under the conditions of 72 DEG C.

4, the fusion TBC in step 3 is connected on pMD19-T simple (purchased from TaKaRa) plasmid, passing through The method for learning conversion, connection product is transformed into DH5 α cell, is coated on the LB solid plate containing ammonia benzyl antibiotic and is carried out Screening, picking monoclonal send company to be sequenced, verify the correctness of fusion after bacterium colony PCR verifying.

Fusion TBC is connected to the reaction system on pMD19-T simple are as follows: 4.5 μ l PCR products；5μl Solution I；0.5μl pMD19-T simple.

Fusion TBC is connected to the reaction condition on pMD19-T simple are as follows: 16 DEG C of 2h.

The formula (1L) of LB culture medium: 10g peptone；5g yeast powder；10g NaCl；15g agar powder.

5, EcoR I and Xba I (being purchased from TaKaRa) double digestion obtain TBC genetic fragment and pK18mobSacB carrier segments.

Digestion system:

Reaction condition: 37 DEG C, about 3h.

6, T4DNA Ligase (being purchased from TaKaRa) connection TBC and pK18mobSacB obtains recombinant plasmid pKuTBCd.

Linked system:

Reaction condition: 16 DEG C, about 20h.

7, it finally by recombinant plasmid by the method for chemical conversion, is transformed into F+strain E.coli S17-1.

The screening of 2 recombinant strains of embodiment

1, recombinant plasmid by parents' mating experiment that F+strain E.coli S17-1 in embodiment 1 is intracellular PKuTBCd is converted into F-strain M.gryphiswaldensense MSR-1.Specifically: 1) S17-1 single colonie is inoculated in In 4ml liquid LB, 37 DEG C, 200rpm overnight incubation；2) S17-1 is inoculated in the liquid LB of antibiotic-free in 10% ratio (200 μ l S17-1+2ml LB), cultivates 3h by 30 DEG C, 150rpm；3) MSR-1 is activated 2 times in Na lactate culture media, third time It cultivates to OD₅₆₅For 0.8-1.0；4) take respectively in 2) 300 μ l S17-1 and 3) in 1ml MSR-1 mixed, 12,000rpm It is centrifuged 1min, abandons supernatant in superclean bench；5) thallus, 12,000rpm centrifugations are washed with 1ml sodium glutamate selective medium 1min abandons supernatant in superclean bench, is repeated once；6) thallus in 5) is resuspended with 50 μ l sodium glutamate Selective agar mediums, Then drop is resuspended on the miillpore filter on the sodium glutamate solid selective medium of not antibiotic in thallus, Parafilm sealing is just setting engagement in 30 DEG C overnight；7) bacterium on lower miillpore filter is washed with 1ml sodium glutamate selective medium Body, the rejuvenation 2h in 30 DEG C, the shaking table of 100rpm；8) 12,000rpm is centrifuged 1min, stays the supernatant of about 100 μ l that thallus is resuspended, and The thallus being resuspended is applied to received containing card antibiotic sodium glutamate solid selection medium on, Parafilm sealing, in 30 In DEG C insulating box, culture 5-7 days is just set.

The formula (1L) of Na lactate culture media:

Note: final concentration of 0.2% agar powder is added in semisolid culturemedium；It is added in solid medium final concentration of 1.5% agar powder.

The formula (1L) of mineral element mixed liquor:

Note: final concentration of 1.5% agar powder is added in solid medium.

2, the monoclonal in bacterium colony PCR verification step 1, picking positive monoclonal is prior to receiving the semisolid of antibiotic containing card Puncture culture, condition of culture are carried out in Na lactate culture media are as follows: 30 DEG C of constant temperature stationary cultures；It then will be in semisolid culturemedium Thallus be transferred to received containing card antibiotic 50ml fluid nutrient medium in, condition of culture are as follows: 30 DEG C, 100rpm shaken cultivation, this When obtained mutant strain be single exchange strains that complete recombinant plasmid pKuTBCd is integrated on MSR-1 genome.

3, the single exchange strains in step 2 are transferred in the sodium lactate semisolid culturemedium for containing only 10% sucrose, are trained The condition of supporting are as follows: 30 DEG C of constant temperature stationary cultures are to there is thallus, and at this moment longer bacterium may be the hybrid bacterial strain of homologous double-crossover, These hybrid bacterial strains are transferred in the 50ml Na lactate culture media of antibiotic-free, condition of culture are as follows: 30 DEG C, 100rpm oscillation training It supports, to OD₅₆₅When for 0.8-1.0, in dilution spread on the solid sodium glutamate selective medium of antibiotic-free or scribing line separation Single colonie, eventually by bacterium colony PCR verify homologous double-crossover positive monoclonal, and to the gene on the bacterial strain magnetic corpusculum island PCR verifying and the magnetic response of bacterial strain verifying (Cmag value) are carried out, when the gene on magnetic corpusculum island is not lost, and Cmag value exists Between 0.8-1.2, it is determined as the recombinant bacterial strain successfully constructed, and the recombinant bacterial strain is named as TBC.Recombinate the Electronic Speculum of magnetic spirillum Photo is shown in Fig. 1.

The acquisition of 3 nano antibodies of embodiment-magnetic corpusculum immunomagnetic beads compound

1, the TBC bacterial strain screened in embodiment 2 is directly incubated in the Na lactate culture media of no any antibiotic, Shaking flask culture, condition of culture are 30 DEG C, 100rpm, grow to stationary phase to cell, are centrifuged, collect cell.

2, the bacterium mud of 1g weight in wet base is taken to be resuspended in the PBS (pH 7.4) of 20ml, under conditions of 200W ultrasound 3s, interval 5s Sonicated cells 40min is then proceeded under conditions of 40W, ultrasonic 3s, and interval 5s, ultrasonic 40min are anti-to disperse nanometer Body-not intimately associated the foreign protein of magnetic corpusculum immunomagnetic beads composite surface.

3, the ultrasonication liquid in step 2 is placed in strong magnets, magnetic absorption about 2h disperses nano antibody-magnetic corpusculum Immunomagnetic beads compound and clasmatosis liquid abandon supernatant.

4, nano antibody-magnetic corpusculum immunomagnetic beads compound is resuspended with isometric PBS (pH 7.4), in 40W ultrasound 3s, Interval 5s is cleaned by ultrasonic 30min, then is placed in strong magnets, Magnetic Isolation nano antibody-magnetic corpusculum immunomagnetic beads compound and The foreign protein that the composite surface washes, i.e. precipitating and supernatant.

5, step 4 is repeated up to the OD of supernatant₂₆₀And OD₂₈₀Lower than 0.05, as purified nano antibody-magnetic corpusculum Immunomagnetic beads compound, whole process of purification can be completed in 1 day.

The present invention provide it is a kind of assemble mild condition, repeatability is high, be readily produced, orient show etc. in it is integrated based on Technique for gene engineering prepares nano antibody-magnetic corpusculum immunomagnetic beads compound, and (nano antibody and Magnetosome membrane albumen orientation are coupled Made of immunomagnetic beads) method, this method compare traditional chemical conjugation methods have production cost is low, the period is short, is easy to The clear superiorities such as purifying.

The optimization of 4 nano antibodies of embodiment-magnetic corpusculum immunomagnetic beads compound purification condition

1, the determination of recombinant bacterium TBC condition of culture:

1) pure recombinant bacterium TBC will be frozen continuously to activate twice in sodium lactate ordinary culture medium；

2) it is inoculated in progress shaking flask training in 300mL Na lactate culture media serum bottle respectively according to the inoculum concentration of 10% (v/v) It supports and carries out fermented and cultured in 4.5L initial medium fermentor；

3) shake flask culture conditions are as follows: 30 DEG C, 100rpm；Ferment tank condition of culture are as follows: 30 DEG C of cultivation temperature, initial to turn Speed is 100rpm, and initial ventilatory capacity is 1L/min, and feed supplement and adjusting pH coupling make pH be maintained at 6.9.With the growth of oxygen of cell Gas consumption increases, and dissolved oxygen is gradually reduced, and when dissolved oxygen is down between 15%-30% for the first time, manually adjusts ventilatory capacity and (increases by one Times), when dissolved oxygen reduces again, and is down to 0.5%, first maintain revolving speed 100rpm about 4-6h constant, cell synthesizes nano antibody- Magnetic corpusculum immunomagnetic beads compound, later, every 2h improve 10rpm, and dissolved oxygen maintains 0.5%；

4) under two kinds of condition of culture, cell is collected in magnetic response (Cmag value) highest, it is anti-to extract intracellular nanometer Body-magnetic corpusculum immunomagnetic beads compound, ELISA detection, the final fermented and cultured for determining fermentor are trained better than the shaking flask of serum bottle It supports.

The formula (4.5L) of the initial medium of fermented and cultured:

Supplemented medium (500mL):

2, nano antibody-magnetic corpusculum immunomagnetic beads complex purification condition determination:

1) cell is resuspended: according to 1g bacterium mud: thallus is resuspended in the ratio of 40mL buffer (0.01M PBS pH 7.4)；

2) smudge cells:

Method I (conventional method): according to 200W, work 3s, then interval 5s, ultrasonic 40min successively reduce ultrasonic power For 120W, 100W, 80W, 60W, 40W, other are constant, and microscopy determines that cell is completely broken, and broken liquid is finally rested on strength On magnet (4 DEG C)；

Method II (optimization method): in 200W, work 3s, sonicated cells under conditions of interval 5s, until microscopy is true It is completely broken to determine cell, then adjusts condition in 40W, work 3s, interval 5s, then ultrasound 40min, later by smudge cells liquid (4 DEG C) are rested in strong magnets；

3) purifying of immunomagnetic beads compound:

Method I (conventional method): removing supernatant for the product in step 2), precipitating is resuspended with isometric PBS (pH), then In 40W, work 3s, cleans 40min under the ultrasonic wave of interval 5s, rests in strong magnets (4 DEG C), finally in order to ensure nanometer Antibody-magnetic corpusculum immunomagnetic beads compound is adsorbed onto precipitating from supernatant completely, and each cleaning is primary sooner or later, as the OD of supernatant₂₆₀ And OD₂₈₀When lower than 0.05, as purified nano antibody-magnetic corpusculum immunomagnetic beads compound stops cleaning, time-consuming about one Week；

Method II (optimization method): removing supernatant for the product in step 2), precipitating is resuspended with isometric PBS (pH), so Afterwards in 40W, work 3s, cleans 40min under the ultrasonic wave of interval 5s, rests in strong magnets (4 DEG C), finally in order to obtain magnetic Property best nano antibody-magnetic corpusculum immunomagnetic beads compound, and reduce activity caused by compound is placed on 4 DEG C for a long time Loss can be cleaned wait visually observe less than supernatant in grey black, next time as the OD of supernatant₂₆₀And OD₂₈₀Lower than 0.05 When, as purified nano antibody-magnetic corpusculum immunomagnetic beads compound stops cleaning, and the Magnetic Isolation time is by initial 2h It is reduced to 30min, whole process of purification can be completed in 1 day；

4) ELISA is detected, and the final purification process II for determining clasmatosis and compound is superior to method I.

Application of 5 nano antibodies of the embodiment-magnetic corpusculum immunomagnetic beads compound in tetrabromobisphenol A detection

1,96 hole elisa Plates are stayed overnight in 4 DEG C of standing closings with 1% gelatin first；Next day will be implemented with 2% BSA Nano antibody-magnetic corpusculum immunomagnetic beads compound that acquisition is purified in example 3 is placed in shaker at room temperature closing 3h.Wherein, carbon is used Sour sodium buffer (0.05M, pH 9.6) prepares 1% gelatin, with the BSA of PBS buffer solution (0.01M, pH7.4) configuration 2%.

The formula of sodium carbonate buffer is (1L): 1.59g Na₂CO₃, 2.93g NaHCO₃, pH 9.6.

2, the confining liquid in ELISA Plate is directly got rid of, washs 3 times with PBST, for use；Magnetic Isolation nano antibody-magnetic corpusculum Immunomagnetic beads compound and confining liquid equally wash 3 times with PBST, for use.

PBST: the polysorbas20 of addition final concentration of 0.05% in PBS (0.01M, pH 7.4).

3, nano antibody-magnetic corpusculum immunomagnetic beads compound (final concentration of 337.5ng/ μ L) is resuspended in PBS, and gradient is added Into ELISA Plate hole, a control group and an experimental group is arranged in each gradient, and Magnetic Isolation abandons PBS.

Concentration gradient: 10 μ L；20μL；30μL；40μL；50μL.

4, the PBS that 50 μ L are first added in the hole of control group, adds 50 μ L TBBPA (working concentrations in the hole of experimental group For 1000ng/mL) standard items；Then, then into each hole add 50 μ L coupling have HRP mark TBBPA derivative T5 (referring to Strong and oriented conjugation of nanobodies onto magnetosomes for the development of a rapid immunomagnetic assay for the environmental detection of tetrabromobisphenol-A,Jinxin He,et al.,Analytical and Bioanalytical Chemistry, 2018), finally ELISA Plate is placed on oscillator and is incubated for 1h.

5, Magnetic Isolation is abandoned supernatant, and is washed 3 times with PBST, and the A liquid and B that 100 μ L are mixed in equal volume are added in each hole Liquid is protected from light colour developing 10-15min, 50 μ L 2M H₂SO₄Reaction is terminated, in measuring OD in microplate reader₄₅₀Value, the results showed that (figure 2), nano antibody-magnetic corpusculum immunomagnetic beads complex can identify TBBPA.

A liquid (1L): 1g urea peroxide, 35.8g Na₂HPO₄·12H₂O, 10.3g citric acid, 0.1mL polysorbas20.

B liquid (1L): 0.7g TMB, 10.3g citric acid, the anhydrous DMSO of 40mL.

2M H₂SO₄: by the dense H of 22.2mL₂SO₄(98%) it is slowly added in 177.8mL distilled water.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.

Sequence table

<110>China Agricultural University

<120>nano antibody-magnetic corpusculum immunomagnetic beads compound and the preparation method and application thereof

<130> KHP191110473.7

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 375

<212> DNA

<213>magnetic spirillum (Magnetospirillum gryphiswaldensense)

<400> 1

agctttcaac ttgcgccgta cttggcgaaa tccgtccctg gaatcggcat tctcggcggc 60

attgtcggtg gcgccgccgc ccttgccaag aatgcccgcc ttttgaagga caagcagata 120

accggcacag aagcggccat cgacaccggc aaggaagccg ccggcgccgg gcttgccacc 180

gctttctccg ccgtcgccgc caccgccgtc ggcggtgggt tggtggtctc gttgggagcc 240

gccctaatcg ccggcgtcgc cgccaaatac gcctgggacc tgggtgtcga tttcatcgag 300

aaggaattgc gtcacggcaa gtccgccgag gcgacagcgt ccgacgaaga cattctgagg 360

gaagaattgg cctga 375

<210> 2

<211> 1009

<212> DNA

<213>magnetic spirillum (Magnetospirillum gryphiswaldensense)

<400> 2

ggcgcagttt cgtctcagga aaggccaata ccatgcagga cctttttctc gccaaggtcg 60

aaagcgccat gcaggcgtcc caggtcgggg cacttgccgg tcagacggcg acggtctcgt 120

cagtctcggc cacgaccaat ctggccacca taaccccaac caccgccggg caggccccta 180

tcatcgtcaa actggacgcg gcacggcagg tgacggagtt gcaggccctg atgggaaaga 240

ccgtgctggt cggaaagacc ccgaccacca tcggcggcat cggaaactgg attgccttga 300

ccccggcggc gggagccaag accggcgctg ccgtggccgg aaccggtcag ctggtcatga 360

tgaaggtcga gggcaccggc gcggccatca agcttcccgc cctggcgggt aagagcttca 420

tcgtcgccca gccccccgta gccgccggaa ccaaagcggc gggcatgctc tatctgaatc 480

cggttggcgg tggtgatatg gtggccatca acattcagaa cgccatgacc cagaccggcg 540

gcttggtcgg caagaccttc accgtcgccc ccagccccgt cattggcggc accaccggta 600

aattcctggt cctgaagccc atggcgaccg gggtcggcaa ggcggtgggc agcggcgccg 660

tcgtcgccaa gttcgtaccc gccgccgtca ccggcacggg cggagcggcg gctatcgggg 720

ccggatccgc caccaccctg atggccacgg gcgccagtac gatcaccccc gtcactgccg 780

ccgccgctgg cagcgccatg ctgacagcca aaggtgttgg cctcgggctt ggcctgggcc 840

tcggcgcctg ggggccgttc gccctagggg ctatcggcct agcgggtgtt gtcgcgcttt 900

atacctgggc gcgccgccgc catggcgctc ccgatgtttc cgatgacgct cttctggcgg 960

ctgtcggcga ggaataagcc tgacccttga attaaggaca acagcgatg 1009

<210> 3

<211> 539

<212> DNA

<213>magnetic spirillum (Magnetospirillum gryphiswaldensense)

<400> 3

tgagggaaga attggcctga aatattgggc tggttcacgg cattcagaca ccggcggagg 60

ccagggcgtt ggttgttatc taaacaacgc cctggcagaa ccgaacaaga acactgtcgt 120

cattcacccc gatgtgctct ctctgcccca ctctctgcct ctgaccgctg tgcccccgac 180

agcggccatc cggcgggaac gtccgctgag gcccttgtgt gccaagaacg ggcattcatg 240

atggcgccgc gccggcgtgg ggcgctccga tgccccttag gttcaatccg gggcgcgcac 300

aatttcgttg gaagattacc cccagccaac ccgatcaaag atacgaatag attggacgtt 360

gttctctccc aacatggcga cgttgatcgt ctcctccttg aaatctcccc aggacgatac 420

gagctgcgag cgcttggccc caggaagaac ggggaactcg ttgttggcct cggcgtaaaa 480

ctgctgcgct tcggcccctg agaggaactc caccagcttg atcgcctctg ccttgttct 539

<210> 4

<211> 402

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atgcagttgc agctcgtgga gtctggggga ggcttggtgc aacctggggg gtctctgaga 60

ctctcctgtg cagcctctcg aagcatcttc agtacgtata ccatgggctg gtaccgccag 120

cctccaggga gggggcgcga gttggtcgca gctagtaata gttttggtac cacatactac 180

gcaaactctg tgaagggccg attcgccatc tccagagaca atgccaagaa caccgtgtat 240

ctgcaaatga acagcctgaa acctgaggac acggctatgt attactgtac ggcacgcgac 300

agaagcgacg cgactattcg tgtctggggc caggggaccc aggtcaccgt ctcctcagaa 360

cccaagacac caaaaccaca agaccatcat caccatcacc at 402

<210> 5

<211> 2365

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ggcgcagttt cgtctcagga aaggccaata ccatgcagga cctttttctc gccaaggtcg 60

aaagcgccat gcaggcgtcc caggtcgggg cacttgccgg tcagacggcg acggtctcgt 120

cagtctcggc cacgaccaat ctggccacca taaccccaac caccgccggg caggccccta 180

tcatcgtcaa actggacgcg gcacggcagg tgacggagtt gcaggccctg atgggaaaga 240

ccgtgctggt cggaaagacc ccgaccacca tcggcggcat cggaaactgg attgccttga 300

ccccggcggc gggagccaag accggcgctg ccgtggccgg aaccggtcag ctggtcatga 360

tgaaggtcga gggcaccggc gcggccatca agcttcccgc cctggcgggt aagagcttca 420

tcgtcgccca gccccccgta gccgccggaa ccaaagcggc gggcatgctc tatctgaatc 480

cggttggcgg tggtgatatg gtggccatca acattcagaa cgccatgacc cagaccggcg 540

gcttggtcgg caagaccttc accgtcgccc ccagccccgt cattggcggc accaccggta 600

aattcctggt cctgaagccc atggcgaccg gggtcggcaa ggcggtgggc agcggcgccg 660

tcgtcgccaa gttcgtaccc gccgccgtca ccggcacggg cggagcggcg gctatcgggg 720

ccggatccgc caccaccctg atggccacgg gcgccagtac gatcaccccc gtcactgccg 780

ccgccgctgg cagcgccatg ctgacagcca aaggtgttgg cctcgggctt ggcctgggcc 840

tcggcgcctg ggggccgttc gccctagggg ctatcggcct agcgggtgtt gtcgcgcttt 900

atacctgggc gcgccgccgc catggcgctc ccgatgtttc cgatgacgct cttctggcgg 960

ctgtcggcga ggaataagcc tgacccttga attaaggaca acagcgatga tgcagttgca 1020

gctcgtggag tctgggggag gcttggtgca acctgggggg tctctgagac tctcctgtgc 1080

agcctctcga agcatcttca gtacgtatac catgggctgg taccgccagc ctccagggag 1140

ggggcgcgag ttggtcgcag ctagtaatag ttttggtacc acatactacg caaactctgt 1200

gaagggccga ttcgccatct ccagagacaa tgccaagaac accgtgtatc tgcaaatgaa 1260

cagcctgaaa cctgaggaca cggctatgta ttactgtacg gcacgcgaca gaagcgacgc 1320

gactattcgt gtctggggcc aggggaccca ggtcaccgtc tcctcagaac ccaagacacc 1380

aaaaccacaa gacggccagg ccggccagca ccatcaccat caccattccg gcggtggtgg 1440

atctggtggc ggcggttccg gtggcggtgg cagctttcaa cttgcgccgt acttggcgaa 1500

atccgtccct ggaatcggca ttctcggcgg cattgtcggt ggcgccgccg cccttgccaa 1560

gaatgcccgc cttttgaagg acaagcagat aaccggcaca gaagcggcca tcgacaccgg 1620

caaggaagcc gccggcgccg ggcttgccac cgctttctcc gccgtcgccg ccaccgccgt 1680

cggcggtggg ttggtggtct cgttgggagc cgccctaatc gccggcgtcg ccgccaaata 1740

cgcctgggac ctgggtgtcg atttcatcga gaaggaattg cgtcacggca agtccgccga 1800

ggcgacagcg tccgacgaag acattctgag ggaagaattg gcctgaaata ttgggctggt 1860

tcacggcatt cagacaccgg cggaggccag ggcgttggtt gttatctaaa caacgccctg 1920

gcagaaccga acaagaacac tgtcgtcatt caccccgatg tgctctctct gccccactct 1980

ctgcctctga ccgctgtgcc cccgacagcg gccatccggc gggaacgtcc gctgaggccc 2040

ttgtgtgcca agaacgggca ttcatgatgg cgccgcgccg gcgtggggcg ctccgatgcc 2100

ccttaggttc aatccggggc gcgcacaatt tcgttggaag attaccccca gccaacccga 2160

tcaaagatac gaatagattg gacgttgttc tctcccaaca tggcgacgtt gatcgtctcc 2220

tccttgaaat ctccccagga cgatacgagc tgcgagcgct tggccccagg aagaacgggg 2280

aactcgttgt tggcctcggc gtaaaactgc tgcgcttcgg cccctgagag gaactccacc 2340

agcttgatcg cctctgcctt gttct 2365

<210> 6

<211> 134

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 6

Met Gln Leu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly

1 5 10 15

Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Arg Ser Ile Phe Ser Thr

20 25 30

Tyr Thr Met Gly Trp Tyr Arg Gln Pro Pro Gly Arg Gly Arg Glu Leu

35 40 45

Val Ala Ala Ser Asn Ser Phe Gly Thr Thr Tyr Tyr Ala Asn Ser Val

50 55 60

Lys Gly Arg Phe Ala Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Thr Ala Arg Asp Arg Ser Asp Ala Thr Ile Arg Val Trp Gly Gln Gly

100 105 110

Thr Gln Val Thr Val Ser Ser Glu Pro Lys Thr Pro Lys Pro Gln Asp

115 120 125

His His His His His His

130

<210> 7

<211> 124

<212> PRT

<213>magnetic spirillum (Magnetospirillum gryphiswaldensense)

<400> 7

Ser Phe Gln Leu Ala Pro Tyr Leu Ala Lys Ser Val Pro Gly Ile Gly

1 5 10 15

Ile Leu Gly Gly Ile Val Gly Gly Ala Ala Ala Leu Ala Lys Asn Ala

20 25 30

Arg Leu Leu Lys Asp Lys Gln Ile Thr Gly Thr Glu Ala Ala Ile Asp

35 40 45

Thr Gly Lys Glu Ala Ala Gly Ala Gly Leu Ala Thr Ala Phe Ser Ala

50 55 60

Val Ala Ala Thr Ala Val Gly Gly Gly Leu Val Val Ser Leu Gly Ala

65 70 75 80

Ala Leu Ile Ala Gly Val Ala Ala Lys Tyr Ala Trp Asp Leu Gly Val

85 90 95

Asp Phe Ile Glu Lys Glu Leu Arg His Gly Lys Ser Ala Glu Ala Thr

100 105 110

Ala Ser Asp Glu Asp Ile Leu Arg Glu Glu Leu Ala

115 120

Claims (10)

1. nano antibody-magnetic corpusculum fusion protein, which is characterized in that the fusion protein is by nano antibody and Magnetosome membrane egg It is directly connected in series between white or is operably connected composition by flexible Linker；

Wherein, the nano antibody is the nano antibody obtained using display technique of bacteriophage；The Magnetosome membrane albumen comes from In magnetotactic bacteria.

2. fusion protein according to claim 1, which is characterized in that the nano antibody is that tetrabromobisphenol A specificity is received Meter Kang Ti, amino acid sequence is as shown in SEQ ID NO:6；

The amino acid sequence of the Magnetosome membrane albumen is as shown in SEQ ID NO:7.

3. encoding the gene of fusion protein as claimed in claim 1 or 2.

4. a kind of polynucleotide, which is characterized in that its nucleotide sequence is as shown in SEQ ID NO:5.

5. the biomaterial containing polynucleotide described in gene described in claim 3 or claim 4, the biomaterial include Recombinant DNA, expression cassette, transposons, plasmid vector, phage vector, viral vectors or engineering bacteria.

6. recombinating magnetic spirillum, which is characterized in that polynucleotide described in gene described in claim 3 or claim 4 is passed through matter Grain is transferred into magnetic spirillum or is integrated on magnetic spirillum chromosome by genetic engineering means；

Preferably, the magnetic spirillum is Magnetospirillum gryphiswaldensense, more preferably M.gryphiswaldense MSR-1。

7. recombination magnetic spirillum according to claim 6, which is characterized in that the construction method of the recombination magnetic spirillum is as follows: At the multiple cloning sites of polynucleotide construct shown in SEQ ID NO:5 to pK18mobSacB carrier, gained recombinant vector turns It is moved into M.gryphiswaldense MSR-1, screening recon to obtain the final product.

8. nano antibody-magnetic corpusculum immunomagnetic beads compound, which is characterized in that the immunomagnetic beads compound is by right It is required that recombination magnetic spirillum described in 6 or 7 is cultivated, and obtained from culture by magnetic absorption.

9. nano antibody-magnetic corpusculum immunomagnetic beads compound method is prepared using the recombination magnetic spirillum of claim 6 or 7, It is characterised in that it includes cultivating in the fermentation medium the recombination magnetic spirillum, and inhaled from culture by magnetic It is attached to obtain nano antibody-magnetic corpusculum immunomagnetic beads compound；

Preferably, it the method includes thalline were collected by centrifugation, is then resuspended, ultrasonication is received finally by magnetic absorption Meter Kang Ti-magnetic corpusculum immunomagnetic beads compound.

10. following any application of immunomagnetic beads compound described in claim 8:

1) detection, absorption, the purification of tetrabromobisphenol A are used for；

2) detection reagent or kit of tetrabromobisphenol A are used to prepare.