CN109810179B - Separated nucleic acid molecule and method for preparing porcine circovirus type 2 Cap protein - Google Patents

Abstract

The invention discloses a separated nucleic acid molecule and a method for preparing porcine circovirus type 2 Cap protein, relating to the technical field of genetic engineering. The base sequence of the isolated nucleic acid molecule for coding the porcine circovirus type 2 Cap protein disclosed by the invention is shown in SEQ ID NO. 1. The nucleic acid molecule can efficiently express Cap protein in an Escherichia coli system through codon optimization. In addition, the method for preparing the porcine circovirus type 2 Cap protein can express soluble Cap protein in the form of virus-like particles by using the codon optimized Cap protein coding sequence, thereby realizing the purpose of mass production of the virus-like particles of the porcine circovirus type 2 Cap protein.

Description

Separated nucleic acid molecule and method for preparing porcine circovirus type 2 Cap protein

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a separated nucleic acid molecule and a method for preparing porcine circovirus type 2 Cap protein.

Background

Porcine circovirus type 2 (PCV 2) is the main pathogen of Postweaning Multisystemic Wasting Syndrome (PMWS) of piglets, and can cause the suppression of the immune system of pigs to generate secondary infection. Epidemic diseases such as pig dermatitis and nephritis syndrome, proliferative necrotizing pneumonia, pig respiratory syndrome, reproductive disturbance, congenital tremor and the like are all related to PCV-2, and the pig dermatitis and nephritis treatment agent has great harm to the pig industry. PCV2 is a regular icosahedral, envelope-free, single-stranded circular DNA virus with virions having an average diameter of about 17nm and a genome size of about 1.76 kb. PCV2 contains 11 Open Reading Frames (ORFs), wherein ORF2 encodes the only structural protein Cap protein, which is the main immunogenic protein of PCV2, and 60 Cap protein subunits are capable of self-assembling into a regular icosahedral virus-like particle in vitro.

Virus-like particles (VLPs) contain the major structural proteins of viruses, have structures similar to wild-type virus particles, but do not contain viral genetic material components, cannot replicate autonomously in vivo or in vitro, are non-infectious, but retain immunogenicity similar to that of wild-type virus particles, and can effectively stimulate humoral and cellular immunity of the body. The PCV2 VLPs are only composed of 1 capsid protein, have simple structure and can be prepared in different expression systems, such as an escherichia coli expression system, baculovirus expression in insect cells and a yeast expression system. The PCV2 Cap protein subunit vaccine prepared by the American Bridgger company and the French England company by utilizing an insect baculovirus expression system has good immune protection effect on pigs. However, the insect baculovirus expression system has high production cost, so that the subunit vaccine prepared by the insect baculovirus expression system has high price. The Escherichia coli expression system has short production period and low cost, and is an ideal host expression system suitable for preparing PCV2 Cap protein subunit vaccine. However, the purification scheme of virus-like particles usually adopts density gradient centrifugation or multi-step chromatography, but these methods have the disadvantages of long time consumption, low purification efficiency, etc.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide an isolated nucleic acid molecule for coding the Cap protein of porcine circovirus type 2.

It is another object of the present invention to provide a vector.

Another object of the present invention is to provide a recombinant bacterium.

The invention also aims to provide a method for preparing the porcine circovirus type 2 Cap protein.

The invention is realized by the following steps:

in one aspect, the invention provides an isolated nucleic acid molecule encoding a porcine circovirus type 2 Cap protein, the base sequence of which is shown in SEQ ID No. 1.

The isolated nucleic acid molecule for coding the Cap protein of porcine circovirus type 2 can efficiently express the Cap protein in an Escherichia coli system through codon optimization.

The amino acid sequence of the Cap protein is shown as SEQ ID NO. 4.

In another aspect, the invention provides a vector comprising a nucleic acid molecule as described above.

Further, in some embodiments of the invention, the vector is a recombinant expression vector or a recombinant cloning vector.

Further, in some embodiments of the invention, the vector is derived from the nucleic acid molecule inserted into the XhoI cleavage site of the pET28a vector.

Further, in some embodiments of the invention, the vector further comprises an expression mCherry gene sequence located upstream of the nucleic acid molecule to express a fusion protein of the mCherry protein and the Cap protein.

The mCherry protein with a histidine tag is added at the N end of the Cap protein, so that the soluble expression of the protein can be improved, and the protein can be purified by a nickel column, thereby overcoming the purification problem of the circovirus VLP.

Wherein, the sequence of the mCherry gene is shown as SEQ ID NO. 2.

The amino acid sequence of the mCherry protein is shown as SEQ ID NO. 3.

In another aspect, the present invention provides a recombinant bacterium comprising a nucleic acid molecule as described above.

Further, in some embodiments of the present invention, the recombinant bacterium is obtained by transforming E.coli with the vector as described in any one of the above.

In another aspect, the present invention provides a method for preparing porcine circovirus type 2 Cap protein, comprising the steps of:

culturing the recombinant strain, and separating and purifying the culture product to obtain the Cap protein.

Further, in some embodiments of the invention, the isolating and purifying comprises:

collecting the cultured recombinant bacteria, carrying out ultrasonic crushing after heavy suspension by using the solution B, centrifuging, collecting supernatant, transferring the supernatant into a nickel ion affinity chromatography column, washing by using the solution B, washing by using the solution W, eluting by using the solution E, and collecting eluent.

Wherein, the solution B contains the following components: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

solution W contains the following components: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

solution E contained the following ingredients: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

wherein the concentration of imidazole in the solution B is 18-22mM, the concentration of imidazole in the solution W is 38-42mM, and the concentration of imidazole in the solution E is 0.8-1.2M.

Further, in some embodiments of the invention, solution B contains: 20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 1% Triton X-100,20mM imidazole.

Further, in some embodiments of the invention, solution W contains: 20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 40mM imidazole.

Further, in some embodiments of the invention, solution E contains: 20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 1M imidazole.

Further, in some embodiments of the invention, the isolating and purifying further comprises:

and dialyzing the eluent to remove imidazole, adding protease into the eluent, removing mCherry label protein from the eluent through nickel column chromatography, and collecting flow-through liquid to obtain a solution containing Cap protein.

According to the method for preparing the porcine circovirus type 2 Cap protein, provided by the invention, the coding sequence of the Cap protein is subjected to codon optimization, so that the soluble Cap protein in the form of virus-like particles can be expressed, the effect of producing the virus-like particles of the porcine circovirus type 2 Cap protein in a large scale is realized, and compared with the existing production method for producing porcine circovirus antigens and insect cell baculovirus by using whole viruses, the method provided by the invention has the characteristics of high yield, low production cost, short production period and the like.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a schematic structural diagram of a vector expressing a porcine circovirus type 2 Cap protein constructed in an example.

FIG. 2 shows the results of 12% SDS-PAGE electrophoretic analysis of the purified proteins in the examples.

FIG. 3 shows the results of the examination and identification of the virus-like particle solution by electron microscopy in the examples.

FIG. 4 shows the result of SDS-PAGE detection of mCherry-PCV2d Cap fusion protein expression in the examples, wherein: m. protein standard molecular weight, 1. expressed mCherry-PCV2d Cap fusion protein.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Construction of vector for expressing porcine circovirus 2 d-type Cap protein

1 chemical synthesis porcine circovirus 2d type Cap protein coding sequence

Synthesizing a corresponding gene sequence with optimized codon as shown in SEQ ID NO.1 according to a GeneBank porcine circovirus 2d type Cap protein sequence (ADG 07989).

2 PCR amplification of PCV2d Cap Gene

The PCV2d Cap gene sequence was amplified by PCR, electrophoresed in 1% agarose, and the DNA sequence was purified by a gel recovery kit. The amplification primer sequences are as follows:

F：CTGGTGCCGCGCGGCAGC ATGACCTACC CGCGTCGTCGTTTC；

R:GTGGTGGTGGTGGTGCTCGAGTTATTTCGGGTTCAGCGGC GGGTCT。

PCR amplification System (50. mu.l):

PCR amplification procedure:

3 PCR product purification and recovery

(1) Preparing 1% agarose gel (containing dye), adding PCR product sample into the sample adding hole, and performing electrophoresis at constant voltage of 100V for 15 min;

(2) cutting the target DNA strip on a gel cutting instrument, putting the DNA strip into a clean EP tube, and purifying and recovering DNA fragments according to a DNA gel recovery kit of Tiangen biochemistry technology.

4 connecting the PCR product with a plasmid vector

pET28a-mCherry plasmid vector was digested with XhoI, and the digestion system (50. mu.l) was as follows: mu.l of pET28a-mCherry plasmid (100 ng/. mu.l), 2. mu.l of NdeI, 8. mu.l of ultrapure water.

And (3) carrying out enzyme digestion at 37 ℃ for 3 hours, then adding 6 XDNA loading buffer solution, carrying out 1% gel electrophoresis, carrying out electrophoresis at constant pressure of 100V for 15min, and then purifying and recovering DNA fragments, wherein the method refers to the step 3.

5, connecting by an EasyGeno rapid recombinant cloning kit, wherein the connection system is as follows:

composition (I)	Volume of
		2 × EasyGeno assembly mixed liquor	5μl
PCV2d Cap DNA fragment	2.5μl
		pET28a-mCherry vector fragment	2.5μl

Incubation was carried out at 50 ℃ for 15min, then placed on ice for transformation into E.coli TOP10 competent cells.

6 transformation

Adding appropriate amount of plasmid (volume not more than 4 μ L) obtained in step 5 into 50 μ L of Escherichia coli competent cells, ice-cooling for 30min, heat-shocking at 42 deg.C for 90s, immediately returning to ice, and ice-cooling for 2 min; adding 400 μ L LB culture medium, and culturing at 37 deg.C with shaking table for 45-60 min; 50-100. mu.L of the culture broth was applied to LB solid medium containing ampicillin (100. mu.g/mL) and cultured overnight at 37 ℃ in an inverted state.

7 screening and sequencing confirmation

Picking up a plurality of single colonies from a culture dish, culturing the single colonies in 5mL LB culture medium overnight, lifting plasmids through a plasmid extraction kit, carrying out enzyme digestion for identification, and finally sending the plasmids to a sequencing company for sequencing to confirm that the sequence is correct. The structural diagram of the constructed vector for expressing the porcine circovirus type 2d Cap protein is shown in FIG. 1 and is named as pET28a-mCherry-PCV2d, and the mCherry gene sequence (SEQ ID NO.2) is positioned at the upstream of the Cap protein coding sequence (SEQ ID NO.1) and is driven by a T7 promoter so as to express a fusion protein (mCherry-PCV2 d).

Example 2

Preparation of porcine circovirus type 2 Cap protein

(1) Transformation expression strain BL21(DE3)

The expression vector pET28a-mCherry-PCV2d with correct sequencing was transformed into BL21(DE3) competent cells, and the transformation procedure was the same as above.

(2) Testing protein expression

Picking a single colony to 20mL of LB culture medium for overnight culture, amplifying the ratio of 2% to 1L of LB culture, inducing with IPTG after 3 hours, inducing at 30 ℃ for 4 hours, centrifugally collecting thalli, and analyzing and identifying protein expression by 12% SDS-PAGE electrophoresis, wherein the result is shown in figure 4, a clear target band can be observed, and the molecular weight is 59 kD.

(3) Purification of

The collected cells were resuspended in 30mL of solution B (20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 1% Triton X-100,20mM imidazole), disrupted by ultrasonication, the disrupted cell solution was centrifuged at 12000rpm at 4 ℃ for 30 minutes, and the supernatant solution was transferred to a new 50mL centrifuge tube and filtered through a 0.22 μm filter. The clear protein solution was collected and used.

Taking about 10mL of nickel ion affinity chromatography filler, adding the filler into a chromatographic column, standing to allow the filler to sink to the bottom of the chromatographic column, and adding 5 times of column volume solution B for balancing.

The collected clarified protein solution was applied to a column, followed by washing with 3 column volumes of solution B, then with 3 column volumes of solution W (20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 40mM imidazole), and finally with solution E (20mM Tris-HCl, pH 7.0; 500mM NaCl, 5% glycerol, 1M imidazole), and the eluate was collected to give a purified protein solution 1 (lane 1 in FIG. 2), and the collected purified protein solution 1 was dialyzed to remove the high concentration imidazole.

Detecting the protein concentration of the purified protein solution 1, adding protease according to a proportion of 1%, cutting off the mCherry label at 4 ℃ overnight to obtain a protein solution 2 (a lane 2 in figure 2), then removing the mCherry label protein from the protein solution 2 through nickel column chromatography, collecting flow-through liquid, and obtaining a protein solution 3 after enzyme digestion. The collected protein solution 3 was dialyzed against the displacement solution to form PCV2d Cap protein into virus-like particles (VLP) to obtain a virus-like particle solution 4 (lane 3 in FIG. 2), which was found to have a concentration of 0.1mg/ml, corresponding to a yield of Cap protein of about 50mg per liter of LB medium.

The results of analyzing the protein solution obtained from each purification step by 12% SDS-PAGE are shown in FIG. 2. FIG. 2, lane 1, shows that purified mCherry-PCV2d Cap has many small bands besides the main target protein band, and these small bands are not translated completely, and after protease is added to cut the mCherry tag, the mCherry tag is removed by nickel column purification, and these small bands are also removed, so that a relatively pure single target protein can be obtained, and the purity is high (see lane 3).

(4) Electron microscope detection and identification

And (3) sucking 10 microliters of the prepared protein sample solution, namely the virus particle solution 4, by using a pipette gun, dripping the prepared protein sample solution on a copper net with a supporting membrane, standing for 2 minutes, sucking excessive liquid from the edge of a liquid bead by using filter paper, then adding 2% uranium acetate, dyeing for 1 minute, sucking the dye solution by using the filter paper, drying, and then placing in an environmental transmission electron microscope H-9500 Hitachi for observation. The results are shown in FIG. 3. The electron micrograph shows that a large number of spherical particles around 20nm can be observed, which indicates that we purified untagged Cap protein forms VLP particles.

From the data, the method for preparing the porcine circovirus type 2 Cap protein provided by the embodiment of the invention can be used for simply, conveniently and quickly purifying the virus-like particles from the escherichia coli lysate, and obtaining the high-purity virus-like particles through one-step gel filtration chromatography, so that the purification step is simple, a large amount of time is saved, and the loss caused by purification is reduced.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Chengdu Tianbang biological products GmbH

<120> an isolated nucleic acid molecule and a method for preparing porcine circovirus type 2 Cap protein

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 705

<212> DNA

<213> Artificial sequence

<400> 1

atgacctacc cgcgtcgtcg tttccgtcgt cgtcgtcacc gtccgcgttc tcacctgggt 60

cagatcctgc gtcgtcgtcc gtggctggtt cacccgcgtc accgttaccg ttggcgtcgt 120

aaaaacggta tcttcaacac ccgtctgtct cgtaccatcg gttacaccgt taaaaaaacc 180

accgttcgta ccccgtcttg gaacgttgac atgatgcgtt tcaacatcaa cgacttcctg 240

ccgccgggtg gtggttctaa cccgctgacc gttccgttcg aatactaccg tatccgtaaa 300

gttaaagttg aattctggcc gtgctctccg atcacccagg gtgaccgtgg tgttggttct 360

accgctgtta tcctggacga caacttcgtt accaaagcta acgctctgac ctacgacccg 420

tacgttaact actcttctcg tcacaccatc acccagccgt tctcttacca ctctcgttac 480

ttcaccccga aaccggttct ggaccgtacc atcgactact tccagccgaa caacaaacgt 540

aaccagctgt ggctgcgtct gcagaccacc ggtaacgttg accacgttgg tctgggtacc 600

gctttcgaaa actctatcta cgaccaggac tacaacatcc gtatcaccat gtacgttcag 660

ttccgtgaat tcaacctgaa agacccgccg ctgaacccga aataa 705

<210> 2

<211> 834

<212> DNA

<213> Artificial sequence

<400> 2

atgggcagca gccatcatca tcatcatcac agcagcggcc tggaagttct gttccagggg 60

ccccatatgg ctagcatgac tggtggacag caaatgggtc gcggatccat ggtgagcaag 120

ggcgaggagg ataacatggc catcatcaag gagttcatgc gcttcaaggt gcacatggag 180

ggctccgtga acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag 240

ggcacccaga ccgccaagct gaaggtgacc aagggtggcc ccctgccctt cgcctgggac 300

atcctgtccc ctcagttcat gtacggctcc aaggcctacg tgaagcaccc cgccgacatc 360

cccgactact tgaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc 420

gaggacggcg gcgtggtgac cgtgacccag gactcctccc tgcaggacgg cgagttcatc 480

tacaaggtga agctgcgcgg caccaacttc ccctccgacg gccccgtaat gcagaagaag 540

accatgggct gggaggcctc ctccgagcgg atgtaccccg aggacggcgc cctgaagggc 600

gagatcaagc agaggctgaa gctgaaggac ggcggccact acgacgctga ggtcaagacc 660

acctacaagg ccaagaagcc cgtgcagctg cccggcgcct acaacgtcaa catcaagttg 720

gacatcacct cccacaacga ggactacacc atcgtggaac agtacgaacg cgccgagggc 780

cgccactcca ccggcggcat ggacgagctg tacaagctgg tgccgcgcgg cagc 834

<210> 3

<211> 278

<212> PRT

<213> Artificial sequence

<400> 3

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Glu Val

1 5 10 15

Leu Phe Gln Gly Pro His Met Ala Ser Met Thr Gly Gly Gln Gln Met

20 25 30

Gly Arg Gly Ser Met Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile

35 40 45

Ile Lys Glu Phe Met Arg Phe Lys Val His Met Glu Gly Ser Val Asn

50 55 60

Gly His Glu Phe Glu Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu

65 70 75 80

Gly Thr Gln Thr Ala Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro

85 90 95

Phe Ala Trp Asp Ile Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala

100 105 110

Tyr Val Lys His Pro Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe

115 120 125

Pro Glu Gly Phe Lys Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly

130 135 140

Val Val Thr Val Thr Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile

145 150 155 160

Tyr Lys Val Lys Leu Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val

165 170 175

Met Gln Lys Lys Thr Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr

180 185 190

Pro Glu Asp Gly Ala Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu

195 200 205

Lys Asp Gly Gly His Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala

210 215 220

Lys Lys Pro Val Gln Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu

225 230 235 240

Asp Ile Thr Ser His Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu

245 250 255

Arg Ala Glu Gly Arg His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys

260 265 270

Leu Val Pro Arg Gly Ser

275

<210> 4

<211> 234

<212> PRT

<213> Artificial sequence

<400> 4

Met Thr Tyr Pro Arg Arg Arg Phe Arg Arg Arg Arg His Arg Pro Arg

1 5 10 15

Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro

20 25 30

Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg

35 40 45

Leu Ser Arg Thr Ile Gly Tyr Thr Val Lys Lys Thr Thr Val Arg Thr

50 55 60

Pro Ser Trp Asn Val Asp Met Met Arg Phe Asn Ile Asn Asp Phe Leu

65 70 75 80

Pro Pro Gly Gly Gly Ser Asn Pro Leu Thr Val Pro Phe Glu Tyr Tyr

85 90 95

Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr

100 105 110

Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn

115 120 125

Phe Val Thr Lys Ala Asn Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr

130 135 140

Ser Ser Arg His Thr Ile Thr Gln Pro Phe Ser Tyr His Ser Arg Tyr

145 150 155 160

Phe Thr Pro Lys Pro Val Leu Asp Arg Thr Ile Asp Tyr Phe Gln Pro

165 170 175

Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Thr Gly Asn

180 185 190

Val Asp His Val Gly Leu Gly Thr Ala Phe Glu Asn Ser Ile Tyr Asp

195 200 205

Gln Asp Tyr Asn Ile Arg Ile Thr Met Tyr Val Gln Phe Arg Glu Phe

210 215 220

Asn Leu Lys Asp Pro Pro Leu Asn Pro Lys

225 230

Claims (10)

1. An isolated nucleic acid molecule encoding a porcine circovirus type 2 Cap protein, characterized in that the base sequence thereof is shown in SEQ ID No. 1.

2. A vector comprising the nucleic acid molecule of claim 1.

3. The vector of claim 2, wherein the vector is a recombinant expression vector or a recombinant cloning vector.

4. The vector according to claim 2 or 3, wherein said vector is derived from the insertion of said nucleic acid molecule into the XhoI cleavage site of the pET28a vector.

5. The vector of claim 4, further comprising an expression mCherry gene sequence located upstream of the nucleic acid molecule to express a fusion protein of mCherry protein and Cap protein.

6. A recombinant bacterium comprising the nucleic acid molecule of claim 1.

7. The recombinant bacterium according to claim 6, wherein the recombinant bacterium is obtained by transforming Escherichia coli with the vector according to any one of claims 2 to 5.

8. A method for preparing porcine circovirus type 2 Cap protein is characterized by comprising the following steps:

culturing the recombinant bacterium according to claim 6 or 7, and separating and purifying the Cap protein from the culture product.

9. The method of claim 8, wherein the separating and purifying comprises:

collecting the cultured recombinant bacteria, carrying out ultrasonic crushing after heavy suspension by using the solution B, centrifuging, collecting supernatant, transferring the supernatant into a nickel ion affinity chromatography column, washing by using the solution B, washing by using the solution W, eluting by using the solution E, and collecting eluent;

wherein, the solution B contains the following components: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

solution W contains the following components: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

solution E contained the following ingredients: Tris-HCl, NaCl, glycerol, Triton X-100 and imidazole;

wherein the concentration of imidazole in the solution B is 18-22mM, the concentration of imidazole in the solution W is 38-42mM, and the concentration of imidazole in the solution E is 0.8-1.2M.

10. The method of claim 9, wherein the separating and purifying further comprises:

and dialyzing the eluent to remove imidazole, adding protease into the eluent, removing mCherry label protein from the eluent by nickel column chromatography, and collecting flow-through liquid to obtain a solution containing Cap protein.

Images