CN109797216B - Application of RORA gene in marker for predicting acute myocardial infarction risk - Google Patents
Application of RORA gene in marker for predicting acute myocardial infarction risk Download PDFInfo
- Publication number
- CN109797216B CN109797216B CN201910219544.XA CN201910219544A CN109797216B CN 109797216 B CN109797216 B CN 109797216B CN 201910219544 A CN201910219544 A CN 201910219544A CN 109797216 B CN109797216 B CN 109797216B
- Authority
- CN
- China
- Prior art keywords
- gene
- myocardial infarction
- rora
- acute myocardial
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses an application of RORA gene in a marker for predicting acute myocardial infarction risk, relates to the fields of gene diagnosis and biomedicine, in particular to detection and application of a peripheral blood myocardial infarction marker, more particularly relates to application of a gene expression product and a biological agent in preparation of medicines for predicting myocardial infarction and diagnosing, and belongs to the technical fields of gene diagnosis and biomedicine.
Description
Technical Field
The invention discloses an application of RORA gene in a marker for predicting acute myocardial infarction risk, relates to the fields of gene diagnosis and biomedicine, in particular to detection and application of a peripheral blood myocardial infarction marker, more particularly relates to application of a gene expression product and a biological agent in preparation of medicines for predicting myocardial infarction and diagnosing, and belongs to the technical fields of gene diagnosis and biomedicine.
Background art:
coronary heart disease ranks the first cause of death in the united states and in many developed countries. It is also expected to be a major cause of death worldwide in the next decades, especially the risk of potentially fatal acute myocardial infarction in the course of coronary heart disease. However, since the 60's of the 20 th century in the united states, there has been a downward trend in coronary heart disease mortality. The efforts in the united states to reduce risk factors for coronary heart disease have benefited from efforts directed primarily to controlling risk factors and improving treatment of myocardial infarction. The coronary artery is the only blood vessel supplying the blood to the heart, and its shape is like the coronary artery, so it is called coronary artery. The blood vessel is also hardened and changed in an atheroma manner along with the change of age environment and self genetic genes, which is the same as the whole blood vessel, causes the blood circulation disorder of the heart, and causes myocardial ischemia and hypoxia, namely the coronary heart disease.
A number of epidemiological studies have demonstrated that smoking, diabetes, hyperlipidemia, hypertension, and obesity are independent risk factors for coronary heart disease. Furthermore, therapeutic measures directed to these risk factors above have proven effective in reducing the risk of future coronary heart disease events. These 5 risk factors are often referred to as "traditional" risk factors due to their role in the pathogenesis of coronary heart disease. Although the importance of these traditional risk factors in the development of coronary heart disease is well recognized, it is generally accepted that there are around 50% of patients with coronary heart disease who do not have these traditional risk factors involved. This suggests that other non-traditional risk factors, genetic factors, and environmental factors play important roles in coronary heart disease as well. Coronary heart disease and other chronic diseases are complex polygenic diseases with polygenic combined action, and the causes of coronary heart disease are various, so until now, people cannot accurately predict and prevent the occurrence of myocardial infarction, and a more effective detection means is needed.
Disclosure of Invention
The invention provides an application of RORA gene in a marker for predicting the risk of acute myocardial infarction, and aims to provide a myocardial infarction risk prediction for patients who have been diagnosed with coronary heart disease definitely, and the acute myocardial infarction risk prediction and diagnosis preparation detects the RORA gene and/or the expression product of the gene. Furthermore, the RORA gene andor the expression product of the RORA gene is highly expressed in peripheral blood of acute myocardial infarction. Furthermore, the method for the fluorescent quantitative detection of the expression level of the RORA gene andor the expression product of the gene.
The invention aims to provide the RORA gene andor gene expression product with high and low expression level in the acute myocardial infarction risk prediction and diagnosis preparation detection, and adopts a gene chip, a gene expression detection method in peripheral blood, a fluorescence quantification method and a related biological preparation.
The RORA gene of the invention firstly designs a primer pair used in the fluorescent quantitative PCR detection, and the sequence is as follows:
the sequence of the upstream primer is as follows: 5 'CTGACGCCCACCTACAACT 3';
the sequence of the downstream primer is as follows: 5'GCCTGATGCTGGTGTGTAGT 3'.
The RORA gene primer needs to play a role under specific conditions and systems, and the RORA gene fluorescence quantitative PCR detection system and reaction conditions of the invention are as follows:
RORA fluorescent quantitative PCR reaction system: each reaction system comprises 10ul Fast qPCR Master Mix, 0.4ul each of upstream and downstream primers (the concentration is 10 umol/L), 6.2ul of double distilled water without nuclease, DNA buffer2ul and 1ul of cDNA template. Fluorescent quantitative PCR reaction conditions: and (3) amplifying by using a real-time fluorescent quantitative PCR system. RORA reaction conditions were 95 ℃ for 5 minutes of pre-denaturation; 40 cycles: denaturation at 95 ℃ for 3 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 20 seconds; the dissolution and amplification curves were 95 ℃ for 15 seconds, 60 ℃ for 1 minute, and 95 ℃ for 15 seconds. All samples were measured in duplicate at least three times with the GAPDH gene (one gene constantly expressed in vivo, and the RORA gene as a control) as the reference gene, and the results were averaged.
The level of gene expression in peripheral blood may reflect the change and development of cardiovascular diseases, and is a significant, convenient and cost-effective means for detecting biomarkers of cardiovascular diseases. The analysis result of the differential gene expression profile of the peripheral blood myocardial infarction patient shows that: there are a number of genes differentially expressed in peripheral blood leukocytes of patients with myocardial infarction and stable coronary heart disease.
The invention has the advantages that:
the application of the RORA gene in the acute myocardial infarction risk prediction marker is provided, the RORA gene can be used as a new myocardial infarction risk prediction and diagnosis and treatment target, the RORA gene and an expression product thereof are used for preparing the acute myocardial infarction risk prediction marker and a diagnosis preparation, and the RORA gene has important clinical application significance and development value.
Drawings
FIG. 1 is a fluorescent quantitative PCR amplification curve of the RORA gene of the present invention;
FIG. 2 is a melting curve of the RORA gene fluorescence quantitative PCR specific primer of the present invention;
FIG. 3 is a comparison curve of the RORA gene mRNA expression level in the acute myocardial infarction group and the stable coronary heart disease group according to the present invention;
FIG. 4 is a ROC curve showing relative expression levels of the RORA gene of the present invention.
Detailed Description
The present invention is further illustrated by the following specific examples, which are intended to be purely exemplary of the invention and are not to be considered as limiting the invention. Those skilled in the art will appreciate that various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention.
The invention mainly adopts RORA gene fluorescence quantitative PCR to screen out the expression quantity of the relevant gene of the stable coronary heart disease patient suffering from acute myocardial infarction, and combines molecular biological experiments and clinical case correlation analysis to prove that the gene is the diagnosis and treatment marker of acute myocardial infarction.
Test example 1
The following tests show the therapeutic effects of the present invention
1. Collection of cases
Patients who are subjected to concurrent coronary angiography for cardiovascular medical hospitalization in the Miri-Ledi Hospital, jilin university, from 3 months to 7 months in 2018 are selected, 113 patients who are definitely diagnosed as acute myocardial infarction are acute myocardial infarction groups according to the global unified definition of myocardial infarction published in 2012, and 85 patients who are diagnosed as stable coronary heart disease according to the definition of stable coronary heart disease published in ESC guidelines in 2013 are coronary atherosclerosis groups. And according to the coronary artery angiography result, the severity of coronary artery vascular lesions of the study object is scored according to a Gensini scoring system, wherein the lesions are more severe as the score is higher.
2. Exclusion criteria:
1. myocardial infarction associated with Percutaneous Coronary Intervention (PCI) or Coronary Artery Bypass Graft (CABG).
MI type II. Secondary to myocardial infarction associated with an imbalance in blood supply: such as increased catecholamine levels or myocardial infarction caused by coronary spasm.
3. With cardiac or non-cardiac operated myocardial infarction.
4. Myocardial damage combined with multifactorial or uncertain disease: severe heart failure, irritable heart disease, severe pulmonary embolism or pulmonary hypertension, sepsis and critically ill patients, renal failure, severe acute neurological diseases such as stroke, subarachnoid hemorrhage, etc.
5. Suffering from an immune system disorder and/or taking hormones.
6. (active or latent) history or evidence of tuberculosis infection.
7. A history of ongoing, chronic or recurrent infectious diseases.
8. Severe infectious diseases and malignant tumors are combined. A patient suspected or confirmed to be in an immunodeficient state.
9. Clinical data or coronary angiography data are not complete. The detailed record clinical data includes: blood lipid level, fasting blood glucose level, resting blood pressure, family history of coronary heart disease, smoking history, coronary artery angiography data, and other clinical disease conditions (such as hypertension and diabetes) are combined.
3. RORA gene expression in peripheral blood of acute myocardial infarction patient group and control group
Method
1.1 Peripheral blood collection, total RNA extraction and cDNA Synthesis
5ml of fasting peripheral venous Blood is left from the morning of each study object, total RNA extraction is carried out on the obtained peripheral Blood by using a Blood Total RNA extraction Kit (Blood Total RNA Kit, new Zealand Biochemical reagent development Co., ltd., hangzhou) according to the Kit specification, and the quality and concentration of RNA are detected by using a microplate reader (Biotek Epoch) and 1.0% agarose electrophoresis. The qualified RNA samples had A260/A280 values between 1.8 and 2.0, and A260/A230 values greater than 2. The agarose gel electrophoresis revealed bright 28S and 18S rRNA bands, with 28S rRNA bands being approximately twice as bright as 18S rRNA. A reverse transcription kit (Fastking one-step method except the first strand synthesis premix of genome cDNA, tiangen Biochemical technology Co., ltd., beijing) is adopted, 1ug of qualified total RNA is taken for reverse transcription, and a cDNA sample is obtained and stored below-20 ℃ so as to be convenient for the next step of real-time fluorescence quantitative PCR.
1.2.2 Real-time fluorescent quantitative PCR (polymerase chain reaction) detection of RORA (Rora gene)
PCR amplification was performed using a green fluorescent quantitation kit (Taq qpcr synthetic premix). RORA gene fluorescence quantitative PCR reaction system: each reaction system comprises 10ul Fast qPCR Master Mix, 0.4ul each of upstream and downstream primers (the concentration is 10 umol/L), 6.2ul of double distilled water without nuclease, DNA buffer2ul and 1ul of cDNA template. RORA gene fluorescent quantitative PCR reaction conditions: and (3) amplifying by using a real-time fluorescent quantitative PCR system. The reaction conditions were 95 ℃ pre-denaturation for 5 min; 40 cycles: denaturation at 95 ℃ for 3 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 20 seconds; the dissolution and amplification curves were 95 ℃ for 15 seconds, 60 ℃ for 1 minute, and 95 ℃ for 15 seconds. All samples were measured in duplicate at least three times using the GAPDH gene (one gene constantly expressed in vivo and SOCS3 gene as a control) as a reference gene, and the results were averaged. The resulting cycle threshold (Ct) for each sample is expressed as relative expression 2- Δ Ct (Δ Ct = Ct for the gene of interest — Ct for the reference gene) and compared. The relative expression of the acute myocardial infarction group and the control group is statistically analyzed by a 2-delta Ct method, and the delta-delta Ct = the delta Ct of the acute myocardial infarction group-the delta Ct of the control group. The PCR primers were designed based on the RORA gene sequences provided in NCBI database and synthesized by Jiangsu Jinzhi Biometrics, and the primer sequences are shown in Table 1
TABLE 1 RORA RT-PCR primer sequences
F a , sequence from sense strands.
R b , sequence from anti-sense strands。
GAPDH: a gene which is constantly expressed in vivo and functions as a control for the RORA gene
4. Correlation analysis of relative expression quantity of RORA gene and characters of blood fat, blood sugar and the like of acute myocardial infarction patient
1.1 methods statistical analysis
Performing statistical analysis on data by using SPSS 24.0 software, performing statistical description on measurement data by using X +/-S according to normal distribution, performing independent T test analysis on difference among groups, performing statistical analysis description on difference among groups by using median and quartile spacing which are not according to normal distribution, and performing use rank sum test on difference among groups; counting data are subjected to statistical analysis description by adopting frequency, and differences among groups are analyzed by using x verification; AMI-associated risk factors were analyzed using binary logistic regression.
2.1 Clinical data analysis
The clinical data analysis results of the study subjects show that: no significant statistical differences were noted between the two groups in terms of gender, history of hypertension, history of smoking, and serum triglyceride levels (TG), serum total cholesterol levels (TC), and low density lipoprotein cholesterol levels (LDL-C), high density lipoprotein cholesterol (HDL-C), etc., as detailed in Table 2.
Table 2;
2.2 Identification of real-time fluorescent quantitative PCR amplification product of RORA gene
The real-time fluorescence quantitative PCR detection result of the peripheral blood RNA shows that: the RORA gene amplification curve is a significantly smooth "sigmoid", see figure 1. The dissolution curve shows a single dissolution peak, and the amplified product has higher specificity, which is shown in figure 2.
2.3 Relative expression of mRNA level of RORA gene in AMI group and SCAD group, delta Ct value of each sample obtained by q-PCR comparative analysis is the average value obtained by repeating 3 times for a single sample. The results show that AMI group 2 -△Ct 0.622 (0.233-1.157), SCAD group 2 -△Ct 0.396 (0.0786-0.753), two groups differed statistically significantly (p < 0.05). The relative expression quantity of RORA gene mRNA in peripheral blood of AMI patients is obviously higher than that of SCAD patients, and the relative expression quantity is 1.57 times of that of SCAD group. See figure 3 for details.
2.4 Correlation analysis of relative expression level of RORA gene and age
The data in this group show that the mRNA level expression of the RORA gene, the patient's age in AMI andthere was a difference between the two comparison sets of SCAD. Further analyzing whether the expression level of RORA gene mRNA is related to the age of the patient. All included subjects were classified by cut off value of the ROC curve with age as AMI, based on all subjects: relative expression levels of RORA gene mRNA levels in 2 for each subject in the older (> 65) and younger (65) groups -△Ct Shows that the correlation between the respective groups and the RORA gene expression level was compared. The results show that: the results of no difference in the amount of RORA gene mRNA expression between the aged group and the aged group (P = 0.207) are detailed in table 3.
TABLE 3
2.5 Using Logistic regression to analyze the expression level of mRNA of RORA gene and the relationship between patient age and acute myocardial infarction, all the study objects were divided into high expression groups according to the relative expression amount cut off value of RORA gene (2) -△Ct >0.958 And low expression group (2) -△Ct ≦ 0.958), and further analyzing correlation between RORA gene mRNA level expression amount, patient age and AMI by stepwise binary Logistic regression. The results show that: the high expression of the RORA gene is an independent risk factor of AMI, compared with the low expression of the RORA, the risk of AMI in a RORA gene high expression group is increased by 2.990 times, and the AMI risk is increased by 1.618 times in advanced age. See table 4 for details.
Table 4:
2.6 RORA gene relative expression in acute myocardial infarction diagnosis ROC curve and cut off value
Relative RORA expression quantity 2 obtained by real-time fluorescence quantitative PCR of each sample of the acute myocardial infarction group and the control group -△CT Values ROC curves are plotted, see figure 4. From fig. 4, it can be known that the relative expression amount of the RORA gene has a certain reference value for the diagnosis of acute myocardial infarction, and the area under the curve (AUC) is 0.621 ± 0.043. About to sign fingerThe relative expression quantity cut off value of the RORA gene determined by the maximum value of the number is 0.958, the sensitivity for diagnosing AMI is 0.366, the specificity is 0.840, the positive predictive value is 43.1 percent, and the negative predictive value is 62.5 percent.
Sequence listing
<110> Jilin university
Application of <120> RORA gene in marker for predicting acute myocardial infarction risk
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> upstream primer (Artificial sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> downstream primer (Artificial sequence)
<400> 2
Claims (1)
- Use of RORA gene and its expression product in preparing acute myocardial infarction risk prediction marker and diagnosis preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910219544.XA CN109797216B (en) | 2019-03-22 | 2019-03-22 | Application of RORA gene in marker for predicting acute myocardial infarction risk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910219544.XA CN109797216B (en) | 2019-03-22 | 2019-03-22 | Application of RORA gene in marker for predicting acute myocardial infarction risk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109797216A CN109797216A (en) | 2019-05-24 |
| CN109797216B true CN109797216B (en) | 2023-03-24 |
Family
ID=66563948
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910219544.XA Active CN109797216B (en) | 2019-03-22 | 2019-03-22 | Application of RORA gene in marker for predicting acute myocardial infarction risk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109797216B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593121A (en) * | 2020-07-07 | 2020-08-28 | 吉林大学 | Application of G0S2 gene in acute myocardial infarction risk prediction marker |
| WO2022189445A1 (en) * | 2021-03-08 | 2022-09-15 | Sanofi | Cardiovascular disease |
| CN113999901B (en) * | 2021-10-28 | 2023-07-21 | 中国医学科学院阜外医院 | Myocardial specific methylation markers |
| CN115287345A (en) * | 2022-05-26 | 2022-11-04 | 中山大学深圳研究院 | Application of PDE4DIP gene in acute myocardial infarction early detection kit |
| CN115261448A (en) * | 2022-05-26 | 2022-11-01 | 中山大学深圳研究院 | Myocardial infarction risk factor detection method based on isothermal nucleic acid amplification qPCR technology and PCR thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007071824A1 (en) * | 2005-12-20 | 2007-06-28 | Oy Jurilab Ltd | Novel genes and markers associated with high-density lipoprotein -cholesterol (hdl-c) |
-
2019
- 2019-03-22 CN CN201910219544.XA patent/CN109797216B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007071824A1 (en) * | 2005-12-20 | 2007-06-28 | Oy Jurilab Ltd | Novel genes and markers associated with high-density lipoprotein -cholesterol (hdl-c) |
Non-Patent Citations (4)
| Title |
|---|
| Genetic Insights into Cardiometabolic Risk Factors;John B Whitfield;《Exp ther med》;20140215;第35卷(第1期);第15-36页 * |
| High retinoic acid receptorrelated orphan receptor A;Heyu Meng;《Retrospective Clinical Research Report》;20210608;第49卷(第6期);第1-13页 * |
| Identification of potentially relevant genes for myocardial;QIANG ZHAO;《EXPERIMENTAL AND THERAPEUTIC MEDICINE》;20180215;第15卷(第2期);第1456-1464页 * |
| 二烯丙基二硫对人胃癌细胞维甲酸相关孤核受体α表达的影响;石莺;《中国全科医学》;20110711;第14卷(第15期);第1679页第1.2.5.1节以及第2.3节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109797216A (en) | 2019-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109797216B (en) | Application of RORA gene in marker for predicting acute myocardial infarction risk | |
| US10538813B2 (en) | Biomarker panel for diagnosis and prediction of graft rejection | |
| EP2593567B1 (en) | Biomarkers for diagnosis of stroke and its causes | |
| US20180251819A1 (en) | Gene signatures of inflammatory disorders that relate to the liver | |
| CN109735616A (en) | Purposes of the SOCS3 gene in acute myocardial infarction AMI risk profile marker | |
| CN107058554B (en) | Purposes of the PRMT5 genes as prediction diagnosis and treatment acute myocardial infarction AMI label | |
| Rainer et al. | Comparison of plasma β-globin DNA and S-100 protein concentrations in acute stroke | |
| EP2633078B1 (en) | Peripheral blood gene markers for early diagnosis of parkinson's disease | |
| CN106929596B (en) | Application of CPNE3 gene as marker for predicting diagnosis and treatment of acute myocardial infarction | |
| KR101895767B1 (en) | A biomarker composition for diagnosis of atherosclerosis | |
| CN112011608A (en) | Platelet treatment guidance method based on drug gene polymorphism and thromboelastogram | |
| CN106801101B (en) | Application of MED6 gene as acute myocardial infarction risk prediction marker | |
| EP2212441A2 (en) | Predictive models and methods for diagnosing and assessing coronary artery disease | |
| US20180105881A1 (en) | Method for determining the survival prognosis of a patient suffering from pancreatic cancer | |
| US20210087634A1 (en) | Determination of risk for development of cardiovascular disease by measuring urinary levels of podocin and nephrin messenger rna | |
| US11328791B2 (en) | Method for determining the risk of developing acute kidney injury in a human subject with acute myocardial infarction and inhibiting such development | |
| CN111593121A (en) | Application of G0S2 gene in acute myocardial infarction risk prediction marker | |
| Cox et al. | Gene expression profiles in whole blood and associations with metabolic dysregulation in obesity | |
| KR102328157B1 (en) | Biomarker for predicting pregnosis of type 2 diabetes | |
| US11655507B2 (en) | Method for diagnosing Parkinson's disease using nasal mucus, composition therefore, and kit comprising the same | |
| EP4144864A1 (en) | An in vitro method for diagnosis for ischemic vascular diseases and related complications | |
| CN110684840A (en) | Application of GBGT1 gene in marker for predicting acute myocardial infarction risk | |
| KR20130141044A (en) | A marker for early diagnosis of acute myocardial infarction | |
| CN116218986A (en) | Kit for diagnosing whether Alzheimer disease exists or not and application of kit | |
| CN117721196A (en) | Application of TBL1XR1 in preparation of product for evaluating coronary heart disease risk |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |