CN109796781A - Ds DNA binding fluorescent dyes and its preparation and application - Google Patents
Ds DNA binding fluorescent dyes and its preparation and application Download PDFInfo
- Publication number
- CN109796781A CN109796781A CN201711134936.3A CN201711134936A CN109796781A CN 109796781 A CN109796781 A CN 109796781A CN 201711134936 A CN201711134936 A CN 201711134936A CN 109796781 A CN109796781 A CN 109796781A
- Authority
- CN
- China
- Prior art keywords
- fluorescent dyes
- dna binding
- reaction
- binding fluorescent
- formula
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of ds DNA binding fluorescent dyes, which has structure or its optical isomer shown in formula IV, wherein R1、R2, R ' be selected from H, C1‑8Alkyl, substituted or unsubstituted phenyl, sulfo group, one of carboxyl；The substituent group of the substituted-phenyl is selected from CN, COOH, NH2、NO2、OH、SH、C1‑8Alkylamino, C1‑8Amide groups, halogen or C1‑8Halogenated alkyl；X is halogen；n1、n2Integer selected from 0-8.The invention also discloses the preparation method and its usages of above-mentioned dyestuff.The present invention passes through two luminescent dye molecules containing benzothiazole of quaternary ammonium salt bridging, it is acted on by the pi-pi accumulation between molecule and molecule, reduce the fluorescence intensity before two molecules combine, obtain stronger amplified signal, to improve the sensitivity and stability of ds DNA binding fluorescent dyes, its cytotoxicity and the inhibition to PCR are reduced.
Description
Technical field
The present invention relates to nucleic acid dye fields, more particularly to a kind of novel double-stranded DNA (dsDNA) binding fluorescent dyes
And its preparation and application.
Background technique
Most representative in ds DNA binding fluorescent dyes is molecule ethidium bromide, and morning has been used for acrylic gel
Nucleic acid staining in electrophoresis.
Ds DNA binding fluorescent dyes apply equally to the real-time amplification of detection nucleic acid, such as PCR.Corresponding amplification produces
Object can be identified by DNA binding fluorescent dyes, after the dyestuff and double-strandednucleic acid interact, then with the wavelength for being suitable for
Excitation, can emit corresponding fluorescence signal.In PCR reaction process, simply by the presence of the DNA of double-strand, dyestuff in sample to be tested
The combination for the property of may be selected by, while can detecte fluorescence signal.When double-stranded DNA dissociation, signal can be reduced rapidly.It is this
The decaying of signal is equally applicable to monitoring of the fluorescence intensity to temperature-time curve.
Ds DNA binding fluorescent dyes can also be used in the detection of real-time PCR and curve analysis, at this point, most frequently making
Fluorescent dye is SYBRGreen I.SYBRGreen I is widely used because of its high-efficiency low-toxicity, but due to it
It itself cannot be used for common PCR buffer, need to add the additional agents such as DMSO, DBA；Meanwhile although increase can be passed through
MgCl2Concentration reduce its PCR depression effect, but the inhibitory effect of concentration dependant still remains, therefore SYBRGreen I exists
It is limited in multiplex PCR application.The study found that it is only able to detect the solubility curve of a product when carrying out double PCR amplification,
But electrophoretic analysis is but explicitly shown containing there are two products.Therefore, although SYBRGreen I application range is wider, exist
The disadvantages of usable concentration range is small, sequence combination deviation is big.
In addition, existing multiple nucleic acids dyestuff toxicity with higher itself, this is mainly due to dye molecules can be light
Penetrating cell of changing places film leads to gene mutation to combine with intracellular nucleic acid DNA, has certain carcinogenicity.
The EVAGreen dyestuff of discovery recent years, it is smaller to the inhibition of PCR, but because its synthesis step is complicated,
The intermediate price used is higher, wherein a step yield is relatively low, leads to high expensive.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of ds DNA binding fluorescent dyes, its sensitivity and steady
Qualitative good, cytotoxicity is low, small to the inhibition of PCR.
In order to solve the above technical problems, ds DNA binding fluorescent dyes of the invention, have structure shown in formula IV or its
Optical isomer:
Wherein,
R1、R2, R ' be each independently selected from: H, C1-8Alkyl, substituted or unsubstituted phenyl, sulfo group, one in carboxyl
Kind；The substituent group of the substituted-phenyl is selected from: CN, COOH, NH2、NO2、OH、SH、C1-8Alkylamino, C1-8Amide groups, halogen or
C1-8Halogenated alkyl；
X is halogen；
n1、n2Integer selected from 0-8.
The R1、R2, R ' preferably be selected from C1-4Alkyl.
The X is preferably I.
The n1、n2Preferably 1.
Further, IV structure of formula is more preferably with flowering structure: R1、R2, R ' be H, X I, n1、n2It is 1.
The second technical problem to be solved by the present invention is to provide the preparation method of above-mentioned ds DNA binding fluorescent dyes.
The preparation method of the ds DNA binding fluorescent dyes, step include:
1) 2- methylbenzothiazole and the halogenated alkyl chain reaction of both-end base, generate the 2- methylbenzene for being connected with halogenated alkyl chain
And thiazole, referred to as the first intermediate；
2) alcoholic solution of first intermediate and dimethylamine reacts, and two the first intermediate molecules are resided abroad by quaternary ammonium salt
Connection forms the second intermediate；
3) second intermediate and 4-N, the reaction of TMSDEA N diethylamine benzaldehyde, generate ds DNA binding fluorescent dyes.
The reaction of the step 1) carries out in acetonitrile solution, under inert gas shielding and stirring condition, is heated to reflux
24~48 hours.
The reaction of the step 2) carries out in methanol solution, using microwave reaction method, carries out under an increased pressure.
The reaction of the step 3) carries out in acetonitrile solution, using the mixed solution of piperidines and acetic acid as catalyst,
The volume ratio of acetic acid and piperidines is 1:1~1:3, preferably 1:2.
The third technical problem to be solved by the present invention is to provide the purposes of above-mentioned ds DNA binding fluorescent dyes, the double-strand
DNA binding fluorescent dyes can be used for the high-resolution solubility curve point of the real-time quantitative PCR detection or responsive type DNA unwinding of nucleic acid
Analysis.
The present invention is by the molecular structure of improvement ds DNA binding fluorescent dyes, and with quaternary ammonium salt overseas Chinese federation, two contain benzo
The luminescent dye molecule of thiazole is acted on by the pi-pi accumulation between molecule and molecule, is improving the same of molecular structure stabilized
When, the fluorescence intensity before two molecules combine is reduced, to obtain stronger amplified signal.Compared with existing nucleic acid dye,
Ds DNA binding fluorescent dyes of the invention, have the following advantages and beneficial effects:
1. passing through the alkane chain and the biggish fluorogen link of volume of three carbon atoms, the season in dyestuff is significantly reduced
Influence of the ammonium salt to DNA polymerase activity makes it, much smaller than the mainstream product in the market, reach EvaGreen to the inhibition of PCR
Level.
2. chemical stability is fabulous, will not be destroyed during normal storage, operation and PCR, in buffer solution
Dyestuff can be securely stored in room temperature or refrigerator, can also be with multigelation.
3. since molecule is per se with three positive charges, charge carrying amount with higher, therefore being not easy penetrating cell
Film improves security performance to reduce cytotoxicity.
4. can selectively be excited in the state of specifically binding double-strandednucleic acid, while fluorescence is released, therefore can
With the high-resolution solubility curve analysis for the detection of the real-time quantitative PCR of nucleic acid or responsive type DNA unwinding.
Detailed description of the invention
Fig. 1 is the nmr spectrum of II intermediate of formula prepared by the embodiment of the present invention 1.
Fig. 2 is the nmr spectrum of ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1.
Fig. 3 is the real time fluorescent quantitative of the nucleic acid of the ds DNA binding fluorescent dyes dyeing prepared through the embodiment of the present invention 1
PCR amplification curve electrophoretogram.From left to right, the corresponding ds DNA binding fluorescent dyes concentration of amplification curve is successively are as follows: 20,10,
5、1、0.50、0.10μM。
Fig. 4 is that the ds DNA binding fluorescent dyes for preparing the embodiment of the present invention 1 and Gelred dyestuff are dense in different dyes
Real-time fluorescence quantitative PCR amplified production electrophoretogram under degree.Wherein, (A) figure is Gelred dyestuff, and (B) figure is prepared by embodiment 1
Ds DNA binding fluorescent dyes.
Fig. 5 is to use ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 respectively with EB (ethidium bromide) dyestuff
In nucleic acid staining gel electrophoresis effect contrast figure obtained.Wherein, (A) figure is EB dyestuff, and (B) figure is prepared by embodiment 1
Ds DNA binding fluorescent dyes.
Fig. 6 is the cell of ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 and SYBR Safe nucleic acid dye
Toxicity security performance test comparison.Wherein, (A) figure is SYBR Safe nucleic acid dye, and (B) figure is double-strand prepared by embodiment 1
DNA binding fluorescent dyes.
Specific embodiment
To have more specific understanding to technology contents of the invention, feature and effect, now in conjunction with drawings and the specific embodiments,
Technical solution of the present invention is further described in detail:
The preparation of 1 ds DNA binding fluorescent dyes of embodiment
One, N-3- iodine propyl -2- methylbenzothiazole iodide (Formulas I intermediate) is prepared
In 250mL single-necked flask, sequentially add 1.0g (6.75mmol) 2- methylbenzothiazole, 6.0g (20.3mmol,
3eq) 1,3- diiodo propane, 40mL acetonitrile are heated to reflux for 24 hours under the conditions of Ar gas shielded and magnetic agitation, cooling to reaction solution
Afterwards, it is slowly added to 50mL acetone, there is solid precipitation under intense agitation, with filtered on buchner funnel, it is solid to obtain 2.65g khaki
Body, thick yield 88.4%.Obtained crude product is recrystallized with second alcohol and water (v/v=1:1), obtains 2260mg solid powder,
That is Formulas I intermediate, yield 75%.
This step reaction equation is as follows:
Two, N, N, N, N- dimethyl two-(3- propyl 2- methylbenzothiazole base) quaternary ammonium salt (II intermediate of formula) are prepared
It is molten that 1.0g (2.25mmol) intermediate I, the methanol of 250 μ L (670 μm of ol) dimethylamine are added in microwave reaction bottle
Liquid and 6mL anhydrous methanol, are put into microwave reactor and react 90min, and reaction temperature is 120 DEG C.To after reaction, by institute
It obtains reaction solution and removes methanol by Rotary Evaporators, obtain viscous liquid.Products therefrom is further passed through to preparation liquid phase color
Spectrum separation, after freeze-drying, obtains 1.21g buff powder, i.e. II intermediate of formula, yield 67.4%.
II intermediate of formula is in DMSO-d6In nuclear magnetic resonance (NMR) spectrogram as shown in Figure 1, through analyzing, structure is as follows:
Wherein, it is 2 that chemical shift, which is located at the corresponding number of hydrogen near 8.6, H in phenyl ring in corresponding benzothiazole ringa
2 hydrogen；Hydrogen near 8.3 corresponds in benzothiazole ring H in phenyl ringb2 hydrogen；Hydrogen near 8.0 corresponds to benzene
And H in phenyl ring on thiazole ringc2 hydrogen；Hydrogen near 7.4 corresponds in benzothiazole ring H in phenyl ringd2 hydrogen；It is located at
Hydrogen near 8.3 corresponds in benzothiazole ring H on methyle6 hydrogen；Hydrogen near 5.0 corresponds to H in linking armf4
A hydrogen；Hydrogen near 2.5 corresponds to H in linking armf4 hydrogen and solvent peak coincide together；Hydrogen near 3.2
Corresponding to H in linking armh4 hydrogen；Hydrogen near 3.3 is corresponding to H on quaternary ammonium salt methyl in linking armf6 hydrogen.
This step reaction equation is as follows:
Three, 3,3'- ((dimethylamino) is bis- (propane -3,1- diyl)) bis- (2- ((E) -4- (diethylamino) benzene are prepared
Vinyl) benzo [d] thiazole -3-) (III final product of formula)
By II intermediate of 0.6g (0.76mmol) formula and 294.0mg (1.66mmol, 2.2eq) 4-N, TMSDEA N diethylamine Ji Benjia
Aldehyde is dissolved in 20mL acetonitrile, is added in the three-necked flask equipped with magnetic stirring apparatus, is then delayed respectively into three-necked flask
It is slow that 0.5mL piperidines and 0.25mL acetic acid is added, in N2Under protection, it is heated to reflux 10h.Solvent is spun off, 40mL water is added in residue,
And be extracted with dichloromethane, remove unreacted 4-N, TMSDEA N diethylamine benzaldehyde.After aqueous solution is freeze-dried, then prepare
Liquid-phase chromatographic column is isolated and purified, and dark red solid 315.0mg, i.e. III final product of formula, yield 41.6% are obtained.
Final product is in DMSO-d6In nuclear magnetic resonance (NMR) spectrogram as shown in figure 3, through analyzing, structure is as follows:
Wherein, it is 2 that chemical shift, which is located at the corresponding number of hydrogen near 8.5, H in phenyl ring in corresponding benzothiazole ringa
2 hydrogen；Hydrogen near 8.3 corresponds in benzothiazole ring H in phenyl ringb2 hydrogen；Hydrogen near 7.9 corresponds to benzene
And H in phenyl ring on thiazole ringc2 hydrogen；Hydrogen near 7.5 corresponds in benzothiazole ring H in phenyl ringd2 hydrogen；It is located at
Hydrogen near 7.0 corresponds to H on benzothiazole fluorogene6 hydrogen；Hydrogen near 5.2 corresponds to H in linking armf4
Hydrogen；Hydrogen near 2.4 corresponds to H in linking armf4 hydrogen and solvent peak coincide together；Hydrogen near 3.1
Corresponding to H in linking armh4 hydrogen；Hydrogen near 3.3 is corresponding to H on quaternary ammonium salt methyl in linking armi6 hydrogen；Position
Hydrogen near 6.9 is corresponding to H on quaternary ammonium salt methyl in linking armj2 hydrogen；At in N, N ' diethylaniline 7.63
Bimodal hydrogen corresponds to Hk4 hydrogen；Positioned at N, 6.85 in N ' diethylaniline at bimodal hydrogen correspond to Hl4 hydrogen；Position
Correspond to H in the hydrogen of N, triplet of N ' the diethylaniline ethyl methylene at 3.40m8 hydrogen；Positioned at N, N ' diethyl
The hydrogen of triplet of the methyl at 1.12 corresponds to H in base aniline ethyln12 hydrogen.
This step reaction equation is as follows:
The amplification of 2 real-time fluorescence quantitative PCR of embodiment
For Influenza A H1N1 characteristic sequences, artificial synthesized one section of sequence gene as a purpose.Objective gene sequence is such as
Under:
cccaaagtgagggatcaagaagggagaatgaactattactggacactagtagagccgggagacaaaataacattcga
agcaactggaaatctagtggtaccgagatatgcattcgcaatggaaagaaatgctgg(SEQ ID NO:1)
Conventional PCR amplification is carried out to target gene, then amplified production is cloned on carrier pMD-18T, obtains sun
Property grain, the template as subsequent fluorescent quantitative PCR.
III compound of formula prepared using embodiment 1, using Bio-Rad IQ5 fluorescence quantitative PCR instrument, is carried out as fluorescent dye
Fluorescent quantitative PCR.The primer sequence difference of fluorescent quantitative PCR is as follows:
Upstream primer: CCCAAAGTGAGGGATCAAGA (SEQ ID NO:2)
Downstream primer: CCAGCATTTCTTTCCATTGC (SEQ ID NO:3)
25 μ L PCR reaction systems are as follows: 10 × PCR buffer, 2.5 μ L, 2.5mM dNTP, 2 μ L, 25mM MgCl2, 10 μM
Upstream primer 0.5 μ L, 10 μM of 0.125 μ L of downstream primer 0.5 μ L, 5U/ μ L rTap enzyme (TAKARA), template DNA (target gene
Pcr amplification product be cloned into resulting positive plasmid on carrier pMD-18T) 1.0 μ L are (containing 1.0 × 101~109Copy), fluorescence
1.0 μ L of dyestuff (ultimate density is respectively 20,10,5,1,0.50,0.10 μM), adds water polishing to 25.0 μ L of final volume.
PCR reaction condition are as follows: 94 DEG C of initial denaturation 30min；95 DEG C of amplification 30s, 52 DEG C of 30s, 72 DEG C of 30s, totally 35 are followed
Ring.
PCR amplification result is as shown in Figure 3.By Fig. 3 it can be confirmed that III compound of formula for preparing of the embodiment of the present invention 1 can be with
As fluorescent dye, the real-time amplification applied to nucleic acid is detected, anti-by the variation real-time monitoring quantitative fluorescent PCR of fluorescence intensity
It answers, realizes relative quantification, absolute quantitation and the qualitative analysis of gene.
3 dyeing effect comparative experiments of embodiment
One, it is compared with Gelred
Ds DNA binding fluorescent dyes (concentration is 5 μM) prepared by above-described embodiment 1 are commercialized core with 3X Gelred
Acid dye is respectively used to nucleic acid staining, dyes 30min, then water decolorization 15 minutes, with the dye of both gel electrophoresis method comparisons
Color effect, gel used are 15%acrylamide TBE gels (Criterion gels, Biored).Meanwhile in order into one
The depression effect for determining that dye strength reacts PCR is walked, PCR product is subjected to detected through gel electrophoresis, testing result such as Fig. 4 institute
Show, wherein (A) figure is Gelred dyestuff, and (B) figure is ds DNA binding fluorescent dyes prepared by embodiment 1, and M band is
The corresponding dye strength of marker, 1-8 band is successively are as follows: 20,10,5,1,0.5,0.25,0.1,0.05 μM.
From fig. 4, it can be seen that Gelred dyestuff only just has amplified production under three concentration of amplification curve；And it is of the invention
Ds DNA binding fluorescent dyes prepared by embodiment 1 have amplified production under all concentration, and under different dyes concentration
Pcr amplification product amount shows that ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 react PCR almost without difference
Substantially there is no depression effect, be particularly suited for the reaction of fluorescent dye real-time PCR.
Two, it is compared with EB
Ds DNA binding fluorescent dyes (concentration is 5 μM) and 5 μM of EB (ethidium bromide) point prepared by above-described embodiment 1
Not Yong Yu nucleic acid staining, dye 30min, then water decolorization 15 minutes carry out gel electrophoresis, and gel used is 15%
Acrylamide TBE gels (Criterion gels, Biored), gained gel electrophoresis test result is as shown in figure 5, from a left side
Successively to the right side are as follows: NEB low MW ladder 100ng, 50ng；It is exposed 2 seconds at EB Filter.
By Fig. 5, it can be seen that, ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 compare EB dyestuff, not only
The dyeing effect higher than EB dyestuff can be obtained, and there is very low toxicity.In addition, the nucleic acid usually after EB dyeing is in gel
There are serious trailing phenomenon in electrophoresis, and it is poor to DNA fragmentation subregion effect to will lead to different bases, and according under similarity condition
After the gel electrophoresis test result of acquisition using ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 it is found that dyed
Nucleic acid, is not present trailing phenomenon in gel electrophoresis, and different bases are more obvious to the differentiation of DNA fragmentation.
4 cytotoxicity experiment of embodiment
The ds DNA binding fluorescent dyes and 1X that Hela cell is prepared in the 1X embodiment of the present invention 1 respectively at 37 DEG C
It is cultivated 30 minutes in SYBR Safe.Gained sample is taken pictures under fluorescence microscope, and the time for exposure is 400ms.Embodiment 1 is made
Standby ds DNA binding fluorescent dyes select CY3 optical filter, and SYBR Safe selects FITC optical filter.Cytotoxicity security performance
Test results are shown in figure 6, is clear that by Fig. 6, and SYBR Safe penetrating cell film and can contaminate nucleic acid moiety quickly
Color, but ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 are almost seen not because being unable to penetrating cell film
To any substance being colored, it is seen that ds DNA binding fluorescent dyes prepared by the embodiment of the present invention 1 compare SYBR Safe core
Acid dye has higher safety to cell.
Sequence table
<110>Shanghai Biochip Co., Ltd
<120>ds DNA binding fluorescent dyes and its preparation and application
<130> CPC-NP-17-100723
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 134
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<400> 1
cccaaagtga gggatcaaga agggagaatg aactattact ggacactagt agagccggga 60
gacaaaataa cattcgaagc aactggaaat ctagtggtac cgagatatgc attcgcaatg 120
gaaagaaatg ctgg 134
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<400> 2
cccaaagtga gggatcaaga 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<400> 3
ccagcatttc tttccattgc 20
Claims (12)
1. ds DNA binding fluorescent dyes, which is characterized in that have structure or its optical isomer shown in formula IV:
Wherein,
R1、R2, R ' be each independently selected from: H, C1-8Alkyl, substituted or unsubstituted phenyl, sulfo group, one of carboxyl；Institute
The substituent group for stating substituted-phenyl is selected from: CN, COOH, NH2、NO2、OH、SH、C1-8Alkylamino, C1-8Amide groups, halogen or C1-8It is halogenated
Alkyl；
X is halogen；
n1、n2Integer selected from 0-8.
2. dyestuff according to claim 1, which is characterized in that the R1、R2, R ' be each independently selected from C1-4Alkyl.
3. dyestuff according to claim 1, which is characterized in that the X is I.
4. dyestuff according to claim 1, which is characterized in that the n1、n2It is 1.
5. dyestuff according to claim 1, which is characterized in that the R1、R2, R ' be H, the X be I, the n1、n2?
It is 1.
6. the preparation method of ds DNA binding fluorescent dyes, which comprises the following steps:
1) 2- methylbenzothiazole and the halogenated alkyl chain reaction of both-end base, generate the 2- methyl benzo thiophene for being connected with halogenated alkyl chain
Zole derivatives, referred to as the first intermediate；
2) alcoholic solution of first intermediate and dimethylamine reacts, and two the first intermediate molecules pass through quaternary ammonium salt overseas Chinese federation, shape
At the second intermediate；
3) second intermediate and 4-N, the reaction of TMSDEA N diethylamine benzaldehyde, generate ds DNA binding fluorescent dyes.
7. according to the method described in claim 6, it is characterized in that, the step 1), by 2- methylbenzothiazole and 1,3- bis-
Iodopropane reaction, obtains Formulas I intermediate, chemical equation are as follows:
The step 2) is reacted by Formulas I intermediate with dimethylamine, and II intermediate of formula, chemical equation are obtained are as follows:
The step 3), by II intermediate of formula and 4-N, the reaction of TMSDEA N diethylamine benzaldehyde obtains III final product of formula, chemical reaction
Formula are as follows:
8. method according to claim 6 or 7, which is characterized in that the reaction of the step 1) carries out in acetonitrile solution,
Under inert gas shielding and stirring condition, it is heated to reflux 24~48 hours.
9. method according to claim 6 or 7, which is characterized in that the reaction of the step 2) carries out in methanol solution,
Using microwave reaction method.
10. method according to claim 6 or 7, which is characterized in that the reaction of the step 3) in acetonitrile solution into
Row is used as catalyst using the mixed solution of piperidines and acetic acid, and the volume ratio of acetic acid and piperidines is 1:1~1:3.
11. according to the method described in claim 10, it is characterized in that, the volume ratio of the acetic acid and piperidines is 1:2.
12. the purposes of any one of Claims 1 to 5 ds DNA binding fluorescent dyes, which is characterized in that for nucleic acid
The high-resolution solubility curve analysis of real-time quantitative PCR detection or responsive type DNA unwinding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711134936.3A CN109796781A (en) | 2017-11-16 | 2017-11-16 | Ds DNA binding fluorescent dyes and its preparation and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711134936.3A CN109796781A (en) | 2017-11-16 | 2017-11-16 | Ds DNA binding fluorescent dyes and its preparation and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109796781A true CN109796781A (en) | 2019-05-24 |
Family
ID=66555298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711134936.3A Pending CN109796781A (en) | 2017-11-16 | 2017-11-16 | Ds DNA binding fluorescent dyes and its preparation and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109796781A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110642806A (en) * | 2019-09-17 | 2020-01-03 | 上海生物芯片有限公司 | Double-stranded DNA (deoxyribonucleic acid) combined fluorescent dye as well as preparation and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS59159165A (en) * | 1983-03-01 | 1984-09-08 | Fuji Photo Film Co Ltd | Electrophotographic sensitive body |
| JP2003043605A (en) * | 2001-07-27 | 2003-02-13 | Fuji Photo Film Co Ltd | Methine dye and silver halide photographic sensitive material containing the same |
| WO2011065980A2 (en) * | 2009-11-30 | 2011-06-03 | Enzo Life Sciences, Inc. | Dyes for analysis of protein aggregation |
| CN102115610A (en) * | 2010-01-05 | 2011-07-06 | 大连理工大学 | Fluorescent dye, preparation method and application thereof |
| CN102702769A (en) * | 2012-06-20 | 2012-10-03 | 大连理工大学 | Green fluorescence cyanine dye and preparation method as well as application thereof |
-
2017
- 2017-11-16 CN CN201711134936.3A patent/CN109796781A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS59159165A (en) * | 1983-03-01 | 1984-09-08 | Fuji Photo Film Co Ltd | Electrophotographic sensitive body |
| JP2003043605A (en) * | 2001-07-27 | 2003-02-13 | Fuji Photo Film Co Ltd | Methine dye and silver halide photographic sensitive material containing the same |
| WO2011065980A2 (en) * | 2009-11-30 | 2011-06-03 | Enzo Life Sciences, Inc. | Dyes for analysis of protein aggregation |
| CN102115610A (en) * | 2010-01-05 | 2011-07-06 | 大连理工大学 | Fluorescent dye, preparation method and application thereof |
| CN102702769A (en) * | 2012-06-20 | 2012-10-03 | 大连理工大学 | Green fluorescence cyanine dye and preparation method as well as application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110642806A (en) * | 2019-09-17 | 2020-01-03 | 上海生物芯片有限公司 | Double-stranded DNA (deoxyribonucleic acid) combined fluorescent dye as well as preparation and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4761086B2 (en) | Nucleic acid, labeling substance, nucleic acid detection method and kit | |
| Lu et al. | New pyridinium-based fluorescent dyes: A comparison of symmetry and side-group effects on G-Quadruplex DNA binding selectivity and application in live cell imaging | |
| EP2087043B1 (en) | New ds dna binding fluorescent dyes | |
| Ditmangklo et al. | Clickable styryl dyes for fluorescence labeling of pyrrolidinyl PNA probes for the detection of base mutations in DNA | |
| Karlsson et al. | Synthesis and DNA binding studies of a new asymmetric cyanine dye binding in the minor groove of [poly (dA-dT)] 2 | |
| CN113214672A (en) | Amide substituted azaindole-pentamethine cyanine dye, its synthesis method and application | |
| EA032769B1 (en) | Method for designing an excitonic nucleic acid probe and method for detecting a target sequence | |
| Spitsyn et al. | Synthetic route to novel zwitterionic pentamethine indocyanine fluorophores with various substitutions | |
| Gebhard et al. | Hybridization-Sensitive Fluorescent Probes for DNA and RNA by a Modular “Click” Approach | |
| CN109796781A (en) | Ds DNA binding fluorescent dyes and its preparation and application | |
| EP3124622B1 (en) | Fluorescent labeled single-stranded nucleic acid and use thereof | |
| CN111533692B (en) | Fluorescent molecular probe for detecting mercury ions and preparation method and application thereof | |
| CN110627715B (en) | Quinoline aromatic ethylene derivative and application thereof in preparation of fluorescent dye and fluorescent probe | |
| CA2591956A1 (en) | Probe for detecting nucleic acids | |
| EP2201009A2 (en) | Monomethine dyes | |
| EP1223226B1 (en) | Novel fluorescent dye and method of measuring nucleic acid | |
| CN113583467B (en) | Nucleic acid fluorescent dye and preparation and application thereof | |
| CN105001665B (en) | The preparation and its application of a kind of new nucleic acid dyestuff | |
| CN110642806B (en) | Double-stranded DNA (deoxyribonucleic acid) combined fluorescent dye as well as preparation and application thereof | |
| Pietrzak et al. | 5-Phenyl-1, 2, 3, 4-tetrahydronaphthalene derivatives: Synthesis, spectroscopic and electrochemical investigation | |
| CN114671843B (en) | Fluorescent compound, fluorescent modified nucleotide and kit | |
| Spitsyn et al. | Infrared fluorescent markers for microarray DNA analysis | |
| RU2725884C2 (en) | Deoxyuridine triphosphates marked with zwitterionic indocyanine dyes | |
| Okamoto | Thiazole Orange-tethered nucleic acids and ECHO Probes for fluorometric detection of nucleic acids | |
| CN104073019B (en) | A kind of unsymmetrical cyanine dye compound and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190524 |