CN109781985B

CN109781985B - Kit for detecting cancer radiotherapy sensitivity and application thereof

Info

Publication number: CN109781985B
Application number: CN201910149480.0A
Authority: CN
Inventors: 刘然义; 岳欣; 王雪涔; 黄文林
Original assignee: Sun Yat Sen University Cancer Center
Current assignee: Sun Yat Sen University Cancer Center
Priority date: 2019-02-27
Filing date: 2019-02-27
Publication date: 2021-10-29
Anticipated expiration: 2039-02-27
Also published as: CN109781985A

Abstract

The invention relates to a kit for detecting cancer radiotherapy sensitivity and application thereof in curative effect prediction, and the screening of molecular markers is completely based on a practical and effective screening mode in the international research level, namely whole genome RNAi library screening. Identification is carried out in vitro and in vivo based on a radiotherapy tolerance induction process, and RFC4 is finally found to be a gene which is extremely related to the radiotherapy tolerance of colorectal cancer. In addition, clinical retrospective research analysis and in vivo and in vitro function analysis are carried out on the RFC4 gene identified by screening, and the fact that the higher expression level can have positive correlation with the tumor regression failure is found, so that the RFC4 gene can be used for predicting the radiotheraphy tolerance/sensitivity degree. Based on the findings, the kit for predicting the treatment effect of the newly-assisted radiotherapy in the local progressive stage is obtained, and has very important practical significance for solving the problems of clinical treatment effect difference among individuals and blank prediction of the retraction effect/prognosis effect and better realizing accurate treatment.

Description

Kit for detecting cancer radiotherapy sensitivity and application thereof

Technical Field

The invention belongs to the field of molecular diagnosis, relates to a method capable of predicting the curative effect of local advanced rectal cancer radiotherapy, and particularly relates to a composition developed based on a colorectal cancer radiotherapy tolerance gene RFC4 and used for predicting radiotherapy sensitivity before treatment.

Background

In recent years, the incidence rate of rectal cancer in China rises year by year, and the health of people is seriously threatened. Especially, the low and middle local advanced rectal cancer has high surgical excision difficulty, high local recurrence risk and poorer prognosis. At present, the guidelines at home and abroad recommend a standard treatment mode of the rectal cancer in a local advanced stage by combining the resection of a new auxiliary radiotherapy and chemotherapy with the operation.

The neoadjuvant chemoradiotherapy can improve the local control rate, the surgical resection rate and the anal protection rate of tumors and reduce the recurrence rate, however, the neoadjuvant therapy also increases the toxic and side effects of the treatment while bringing the treatment benefits to patients, the beneficial population occupies less, and more problems still need to be solved. Especially in the field of radiotherapy: the clinical curative effect difference among individuals is large, and about half of tumors still have no obvious regression even if the new auxiliary radiotherapy with the same scheme and dosage is received, and even the tumors have the condition of progress; there is no system for predicting the regression effect and the prognosis effect and evaluating the toxicity. The accurate treatment can be better realized by answering the above problems, so that the development of a new tumor molecular marker for predicting the curative effect of the local advanced new auxiliary radiotherapy has important significance.

The discovered markers related to the sensitivity of the colorectal cancer chemoradiotherapy mainly focus on the research of p53, EGFR, TS, Ki-67, p21, Bcl-2/Bax and the like, and the EGFR, the TS expression level and the SNP polymorphism are probably the most valuable markers for predicting the effect of the chemoradiotherapy before operation. Unfortunately, despite the numerous studies to find some molecular markers that may have potential predictive value, no molecules that are truly used for clinically-assisted diagnosis and prediction of the efficacy of neoadjuvant radiotherapy and chemotherapy of rectal cancer, particularly markers that are specifically directed to the efficacy of radiotherapy, have been found to date.

At present, the key tumor molecular marker is clinically lacked for detecting the sensitivity of the local advanced rectal cancer radiotherapy, and no corresponding kit is used for detection temporarily.

Disclosure of Invention

In order to solve the problems in the prior art, the inventor finds that RFC4 is one of the members of Replication Factor C (RFC)5 subunits, and the inventor finds that the RFC can positively promote the repair of DNA double strand break damage of non-homologous end linkage on mechanism. Therefore, abnormal expression of RFC4 can indicate a radiotherapeutic tolerance and can be applied to diagnostic prediction.

The invention aims to provide a kit which can specifically detect the expression level of RFC4 gene and is used as a key basis for judging sensitivity/tolerance of radiotherapy.

It is an object of the present invention to provide a kit comprising: a primer pair group for detecting the expression level of the mRNA of the RFC4 gene and/or a RFC4 protein content detection reagent, wherein the primer pair group is selected from at least one pair of the following primer pairs:

(1) primer pair 1: the sequence of the upstream primer is shown as SEQ ID NO: 1, the sequence of the downstream primer is shown as SEQ ID NO: 2 is shown in the specification;

(2) and (3) primer pair 2: the sequence of the upstream primer is shown as SEQ ID NO: 3, the sequence of the downstream primer is shown as SEQ ID NO: 4 is shown in the specification;

(3) and (3) primer pair: the sequence of the upstream primer is shown as SEQ ID NO: 5, the sequence of the downstream primer is shown as SEQ ID NO: 6 is shown in the specification;

(4) and (3) primer pair 4: the sequence of the upstream primer is shown as SEQ ID NO: 7, the sequence of the downstream primer is shown as SEQ ID NO: 8 is shown in the specification;

(5) and (3) primer pair 5: the sequence of the upstream primer is shown as SEQ ID NO: 9, the sequence of the downstream primer is shown as SEQ ID NO: 10 is shown in the figure;

(6) and (3) primer pair 6: the sequence of the upstream primer is shown as SEQ ID NO: 11, the sequence of the downstream primer is shown as SEQ ID NO: 12 is shown in the specification;

(7) and (3) primer pair 7: the sequence of the upstream primer is shown as SEQ ID NO: 13, the sequence of the downstream primer is shown as SEQ ID NO: 14 is shown in the figure;

(8) and (3) primer pair 8: the sequence of the upstream primer is shown as SEQ ID NO: 15, the sequence of the downstream primer is shown as SEQ ID NO: 16 is shown in the figure;

(9) and (3) primer pair 9: the sequence of the upstream primer is shown as SEQ ID NO: 17, the sequence of the downstream primer is shown as SEQ ID NO: 18 is shown in the figure;

(10) a primer pair 10: the sequence of the upstream primer is shown as SEQ ID NO: 19, the sequence of the downstream primer is shown as SEQ ID NO: 20 is shown in the figure;

(11) a primer pair 11: the sequence of the upstream primer is shown as SEQ ID NO: 21, the sequence of the downstream primer is shown as SEQ ID NO: 22;

(12) primer pair 12: the sequence of the upstream primer is shown as SEQ ID NO: 23, the sequence of the downstream primer is shown as SEQ ID NO: shown at 24;

(13) a primer pair 13: the sequence of the upstream primer is shown as SEQ ID NO: 25, the sequence of the downstream primer is shown as SEQ ID NO: 26 is shown;

(14) primer pair 14: the sequence of the upstream primer is shown as SEQ ID NO: 27, the sequence of the downstream primer is shown as SEQ ID NO: shown at 28.

In this context, the primer set group means PCR primers for synthesizing the cDNA strand of the RFC4 gene in PCR for detecting the expression level of the RFC4 gene.

Preferably, the RFC4 protein content detection reagent is selected from RFC4 monoclonal antibody and/or RFC4 polyclonal antibody.

Preferably, the RFC4 protein content detection reagent is one or more selected from the group consisting of RFC4 monoclonal antibody (cat No. PA5-21538) from Invitrogen, RFC4 monoclonal antibody (cat No. ab156780) from Abcam, and RFC4 polyclonal antibody (cat No. ab96852) from Abcam.

Further, the kit also includes total RNA and total protein of human normal rectal tissue or cells.

Further, the kit also comprises one or more of PCR enzyme, PCR buffer solution, dNTPs and fluorescent substrate.

Preferably, the fluorogenic substrate is selected from Syber Green or a fluorescently labeled probe.

The invention also aims to provide a composition for preparing a kit for detecting the sensitivity and/or curative effect prediction of cancer radiotherapy and application thereof in curative effect prediction, wherein the composition comprises the following components in parts by weight: a primer pair group for detecting the expression level of the mRNA of the RFC4 gene and/or a RFC4 protein content detection reagent, wherein the primer pair group is selected from at least one pair of the following primer pairs:

Preferably, the cancer is an intestinal cancer, most preferably a rectal cancer and/or a colon cancer.

Preferably, the intestinal cancer is locally advanced rectal cancer.

The invention also aims to provide application of a reagent for detecting the expression level of RFC4 in preparing a composition for detecting the sensitivity and/or curative effect prediction of cancer radiotherapy.

Preferably, the reagent for detecting the expression level of RFC4 comprises a primer pair group for detecting the expression level of mRNA of the RFC4 gene and/or a RFC4 protein content detection reagent, and the primer pair group is selected from at least one pair of the following primer pairs:

Preferably, the cancer is intestinal cancer.

Preferably, the intestinal cancer is locally advanced rectal cancer.

The core marker molecule RFC4 of the invention is screened based on a whole genome RNAi library at a cellular level and is identified in vitro and in vivo, and the inventor of the invention explains and clarifies the function and action mechanism of the molecule. And, each item that it is regarded as the molecular marker is examined one by one, means and condition to detect its expression level have already been found, confirm it as the molecular diagnostic factor finally, apply to detecting clinically.

According to the invention, after the colorectal cancer cell line is selected, a whole genome shRNA library is used for screening and is identified step by step, and RFC4 is selected as a molecular marker. 145 biopsy tissues before local advanced rectal cancer treatment are selected, and the protein expression level of the biopsy tissues is detected by immunohistochemistry, so that the expression level of RFC4 is further proved to have obvious correlation with Tumor Regression Grade (TRG) of new-assisted radiotherapy and chemotherapy; RFC4 high expressing patients had significantly higher TRG and was positively correlated with poor prognosis. The invention eliminates the influence of RFC4 on the chemotherapy of colorectal cancer, directly clarifies that RFC4 is a tolerance factor of the local advanced colorectal cancer new-auxiliary radiotherapy, and can indicate the sensitivity of a patient to the radiotherapy.

The mRNA and protein of the RFC4 show obvious up-regulation trend in the process of induction of the cell radiotherapeutic tolerance, and the results indicate that the RFC4 gene expression can be induced by the radiotherapeutic, and the induction of the radiotherapeutic tolerance can be further caused.

In conclusion, the expression amount of RFC4 in the biopsy tissue before treatment of the patient (protein is characterized by immunohistochemistry, mRNA is characterized by RT-qPCR) can definitely indicate the sensitivity degree of the patient to radiotherapy and effectively predict the tumor recession condition of the patient. Therefore, the kit can be used for predicting the curative effect of radiotherapy.

Compared with the prior art, the invention has the following advantages:

the screening of the molecular marker is completely based on a practical and effective screening mode in the international research level, namely whole genome RNAi library screening. Identification is carried out in vitro and in vivo based on a radiotherapy tolerance induction process, and RFC4 is finally found to be a gene which is extremely related to the radiotherapy tolerance of colorectal cancer. In addition, in colorectal cancer classification, the standard treatment mode of local advanced rectal cancer is to realize tumor regression by adopting synchronous radiotherapy and chemotherapy (a new auxiliary treatment mode) before operation, but is limited by the insufficient prediction capability of the existing molecular marker, the curative effect of preoperative treatment on patients cannot be evaluated in advance, and for the difficulties, the inventor finds that the higher expression level of the RFC4 gene has positive correlation with the tumor regression failure by performing clinical retrospective research analysis and in-vitro and in-vivo functional analysis on the RFC4 gene screened and identified, and can be used for predicting the radiotherapy tolerance/sensitivity degree.

Based on the findings, the kit for predicting the radiotherapy curative effect of the colorectal cancer is obtained, and has very important practical significance for solving the problems of clinical curative effect difference among individuals and blank prediction of the retraction effect/prognosis effect and better realizing accurate treatment.

Drawings

FIG. 1 is a flow chart of the screening of whole genome shRNA libraries in colorectal cancer cells.

FIG. 2 is a flow chart of the construction of radiotherapy-resistant cells for colorectal cancer.

FIG. 3 shows the mRNA expression level of candidate genes of cells resistant to radiotherapy for colorectal cancer in resistant/sensitive strains.

FIG. 4 is a graph of immunohistochemical measurements of protein expression levels from pre-treatment biopsy samples from 145 patients with locally advanced rectal cancer.

FIG. 5 shows the results of experiments on the cellular level of RFC4 promoting the resistance of colorectal cancer cell to radiotherapy.

FIG. 6 shows the experimental results of the resistance of RFC4 to radiotherapy for colorectal cancer cells in a nude mouse transplanted tumor model.

FIG. 7 is an illustration of the correlation of the expression level of RFC4 in pre-treatment biopsy tissue with tumor grade regression.

FIG. 8 is a graph of the effect of Kaplan-Meier progression free survival analysis (PFS) RFC4 on prognosis of locally advanced colorectal cancer.

FIG. 9 is a graph of the effect of Kaplan-Meier Total survival analysis (OS) RFC4 on prognosis of locally advanced rectal cancer.

FIG. 10 is a Western blot depicting changes in protein levels of RFC4 during radiotherapy of cells.

FIG. 11 is a graph of the effect of RFC4 on chemotherapeutic drug sensitivity in colorectal cancer.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the specification, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The following are some of the experimental material sources used in the present invention:

colorectal cancer cell lines HCT116/HT29/HCT15/SW480 were purchased from the American Type Culture Collection (ATCC). Total RNA extraction and storage reagents, a real-time fluorescent quantitative PCR Kit SYBR Green PCR Kit, and RFC4 antibody (PA5-21538) for experiments were purchased from Invitrogen, USA. Immunohistochemical assay-related reagents, such as horseradish peroxidase-labeled secondary antibody, were purchased from Dako corporation, usa. Other reagents and materials used in the present invention are commercially available.

The experimental methods involved in the present invention are all conventional in the art unless otherwise specified.

Example 1 selection of Whole genome shRNA library in colorectal cancer cells and construction of radiotherapy-resistant cells

The screening process is shown in fig. 1, and specifically comprises the steps of transfecting a whole genome shRNA library (containing 75000 shRNA covering about 15000 genes) into a colorectal cancer cell line HCT116/HT29 in the form of a lentiviral vector (transfection efficiency, MOI: 0.4), after performing puromycin stable screening, dividing cells into an irradiation treatment group and a control group, culturing for 7 days after treatment, extracting DNA and amplifying, analyzing shRNA copy number change through next generation sequencing, and selecting genes with obviously reduced shRNA copy numbers of two cells as alternative genes.

Next, as shown in FIG. 2, the colorectal cancer cell line HCT116 was subjected to long-range stepwise radiation induction to construct a stable cell line that tolerated a radiation dose of 6Gy for further screening.

Example 2 quantitative PCR detection of mRNA levels of candidate genes in radiotheraphy-resistant and sensitive cells

Total RNA was extracted from the cells by Trizol method, and 2. mu.g of each total RNA was reverse-transcribed into cDNA. Then carrying out reverse transcription reaction according to the requirement of a reverse transcription system to obtain cDNA. The cDNA sequences of RFC4 and GAPDH (internal reference) were obtained by querying the gene database of NCBI, and PCR primers were designed based on the sequences as follows:

RFC4：

the sequence of the upstream primer is shown as SEQ ID NO: as shown in figure 1, the first and second main bodies,

the sequence of the downstream primer is shown as SEQ ID NO: 2, respectively.

GAPDH (internal reference):

the sequence of the upstream primer is as follows: AGAAGGCTGGGGCTCATTTG the flow of the air in the air conditioner,

the sequence of the downstream primer is as follows: AGGGGCCATCCACAGTCTTC are provided.

Real Time PCR: according to

Premix Ex TaqTM II (TaKaRa) protocol, the recipe for preparing PCR reaction solution is shown in Table 1 below (prepared on ice):

TABLE 1

Then, the RNase Free Eppendorf tube containing the PCR reaction solution is subjected to instantaneous high-speed centrifugation, and then PCR amplification reaction is carried out according to a two-step method.

As a result, as shown in FIG. 3, RFC4 was most significantly increased in the expression level of mRNA in the radiotherapeutic-resistant strain among the 6 candidate genes.

Example 3 RFC4 cases where protein expression levels varied before and after radiotherapy

The method for detecting the content change of the RFC4 protein at the cell level by using a protein immunization method mainly comprises the following steps: total protein was extracted from cells, protein loading buffer was prepared, SDS-PAGE was performed, electrotransfer was performed to PVDF membrane, and immunoblotting (primary antibody was incubated with anti-RFC4(PA5-21538) antibody (1: 1000) and anti- β -actin (8H10D10, Seikagaku Kogyo Co., Ltd.) (1: 1000)) was performed, etc.

As shown in FIG. 4, the protein level of RFC4 was also up-regulated as the radiation dose was increased. Combining the results in example 2, it was demonstrated that RFC4 is the most reliable radiotherapeutic resistance factor in the candidate genes.

Example 4 functional validation of RFC4 to promote radiotherapeutic tolerance in colorectal cancer cells

The ability of colorectal cancer cells with different expression levels of RFC4 to clonally form at various radiation doses was examined using a plate cloning experiment. The inventor selects to construct a HCT116/HCT15 stable cell strain with over-expression of RFC4 in a colorectal cancer cell line, and a RFC4 expression-reduced stable cell strain in HT29/SW480, and verifies the cell strain by a protein immunoblotting experiment method. The clonogenic capacity of cells after radiotherapy is expressed using a cell survival fraction curve.

The results are shown in FIG. 5, where RFC4 promotes tolerance to radiation therapy for colorectal cancer cells at the cellular level, and FIGS. 5a-5f show that overexpression of the RFC4 gene in the colorectal cancer cell lines HCT116/HCT15, respectively, results in significant improvement in tolerance; FIGS. 5g-5i show that the expression of the RFC4 gene was knocked down in HT29/SW480, resulting in significant sensitization. Wherein FIGS. 5a, 5d, 5g and 5j are the original results of the clonal formation of the cell line; FIGS. 5b, 5e, 5h and 5k represent the validation of the over-expression and knockdown expression results (by Western blotting) in 4 cell lines, respectively; FIGS. 5c, 5f, 5i and 5l show the analysis of the number of cell clones from the original results, and finally the cell survival fraction curves.

Meanwhile, a radiotherapy evaluation system of a nude mouse transplanted tumor model is established, subcutaneous tumor formation is carried out on nude mice mainly by using HCT116 overexpressed by RFC4 and a no-load control group, and sh1/sh2 HT29 cells expressed by RFC4 knocking-down and a no-load control group which are constructed, and after tumor mass reaches a certain volume, the tumor mass is peeled off and evenly distributed to each group of mice (the volume is 5 mm)³6-7), when the tumor volume reaches 150mm³Then irradiating the tumor part according to the irradiation dose of 26 y/day for 7 days continuously, observing and measuring the tumor volume continuously after receiving irradiation, killing the tumor after 4 weeks of irradiation, taking a picture, weighing and measuring the volume.

As a result, as shown in FIG. 6, and as shown in FIGS. 6a to 6c, it can be seen from the volume and weight of the tumor mass of the mouse that the over-expression of RFC4 can significantly promote the tolerance of radiotherapy, and as shown in FIGS. 6d to 6f, the knockdown expression of RFC4 can sensitize the radiotherapy. Wherein FIGS. 6a and 6d are photographs of tumor masses; FIGS. 6b and 6e are graphs of tumor volume versus time; fig. 6c and 6f are tumor weight statistics.

The combination of the above results shows that RFC4 has the function of promoting the radiotherapy tolerance of colorectal cancer in vivo and in vitro, and simultaneously has the function of being used as a key factor for predicting the radiotherapy tolerance/sensitivity of colorectal cancer.

EXAMPLE 5 clinical biopsy sample Collection

145 biopsy samples before local progression rectal cancer treatment at the center for tumor prevention and treatment of university of Zhongshan from 2006 month 9 to 2016 month 9 were selected.

For each enrolled case, patient enrollment required a definitive diagnosis of rectal adenocarcinoma; tumor 10cm below anus; preoperative staging tumor infiltration breaches the intestinal wall muscularis (T3), or with the rectal intestinal wall full lamina (T4a), or periintestinal lymph node involvement is shown by intra-rectal cavity ultrasound (N1-2); before receiving radiotherapy and chemotherapy, the rectum operation is not received; has no complicated symptoms such as tumor hemorrhage, acute and chronic infection and intestinal obstruction.

For all cases included in the study, the clinical pathology data were reported from the central case of tumor control at the university of Zhongshan, and the corresponding follow-up data were from the central follow-up department. The patient's tumor ratings were all rated according to the UICC/AJCC (eighth edition) criteria. The operation patients are followed up every three months within two years after operation, every half year within three to four years after operation, and every five years and later, and the recurrence/transfer/death of the patients are recorded and the date is recorded by follow-up. The last follow-up date was 31 months 12 in 2018.

Example 6 determination of the content of RFC4 protein in biopsy specimens before tissue treatment of locally advanced rectal cancer

The fresh biopsy tissue is embedded in paraffin for sealing, the paraffin specimen is stored at room temperature, and the cut white slice is stored in a refrigerator at 4 ℃. During the experiment, 145 paraffin sections of white slices were taken out, and subjected to xylene dewaxing, gradient alcohol hydration, and 0.3% H₂O₂Removing peroxidase in tissue with solution, repairing with citrate solution by microwave, incubating with anti-RFC4(PA5-21538) antibody (1: 200) and corresponding species secondary antibody from Invitrogen, developing DAB with hematoxylin, differentiating with hydrochloric acid alcohol, dehydrating with gradient alcohol, permeating xylene twice, and sealing with neutral gum.

Staining evaluation of tissue specimens was photographed by 100-. The scoring mode is as follows: the staining intensity was divided into negative, weak positive, positive and strong positive, and the scores were marked as 0, 1, 2 and 3, respectively. And observing the tissue sections under a microscope, evaluating the proportion of each part of tumor tissue and the respective staining score, and then weighting to finally obtain a scoring result.

The results are shown in FIG. 7, where 7a and 7b represent the 100 Xand 200 Xnegative staining results, respectively; wherein 7c and 7d represent weak positive staining results under 100 Xand 200 Xmicroscope, respectively; wherein 7e and 7f represent positive staining results under 100 × and 200 × mirror, respectively; wherein 7g and 7h represent strong staining results under 100 Xand 200 Xmirror, respectively.

Example 7 correlation of RFC4 expression levels in Pre-treatment biopsy tissue with tumor regression grade

In patients with rectal cancer, the Tumor Regression Grade (TRG) is an index for evaluating the response of tumors after neoadjuvant therapy, specifically by evaluating the number of residual Tumor cells, and is determined by scoring the following three major indices one by one: the degree of cytological changes including the effects of nuclear pyknosis, the degree of cellular necrosis and the number of eosinophils; matrix changes including degree of fibrosis, infiltration of inflammatory cells, degree of infiltration of inflammatory cells, and the like; there is also a distribution of ghost cells and keratin around the giant cells. Tumor regression grades are generally divided into four grades: TRG 0: complete retraction, no tumor cells exist, and pathology is completely relieved; TRG 1: moderate degree of reaction in tumors, most tumors regress, with a small fraction and single tumor cells; TRG 2: tumors are less responsive, tumor tissue is still present, and fibrosis is accompanied; TRG 4: tumors did not respond, minimal or no tumor was killed, and even progressed.

The correlation of the 145 cases is analyzed, and the result is shown in figure 8, wherein the high-level expression of RFC4 has obvious positive correlation with the rectal cancer regression.

Example 8 Kaplan-Meier survival analysis prognosis for patients with locally advanced rectal cancer

The expression cutoff of RFC4 (H-score 6.78) was determined using the point of highest specificity and strongest sensitivity of the ROC curve based on overall survival data and progression-free survival data for 145 locally advanced colorectal cancer cases, RFC4 was classified into two grades of high and low expression, and patient prognosis was analyzed using the Kaplan-Meier method in the SPSS 20.0 software.

Wherein high level expression means a H-Score of 6.78 or greater; H-Score indicates immunohistochemical staining intensity x positive ratio, and the regression effect can be directly predicted by correlating the specific Score of H-Score with the Score of tumor regression rating (TRG).

As shown in FIG. 9, the total survival time of the cases with high expression of RFC4 in tumor tissues (H-score ≧ 6.78) is significantly longer than that of the cases with low expression of RFC4 in tumor tissues (H-score < 6.78), P ═ 0.035. Figure 10 shows that the results for progression-free survival are also consistent, with P ═ 0.006.

Example 9 Effect of RFC4 on drug sensitivity to locally advanced colorectal cancer chemotherapy

The local advanced colorectal cancer neoadjuvant chemoradiotherapy is generally performed synchronously, and in order to further verify whether RFC4 is only resistant to radiotherapy and has no influence on chemotherapy. Therefore, the inventors evaluated the sensitivity of the relevant drugs at the cellular level using a cell proliferation assay (CCK-8) and a colony formation assay, respectively.

Results as shown in fig. 11, RFC4 promoted the tolerance of the drug doxorubicin (Dox), which causes double strand breaks in DNA, and etoposide (Eto) chemotherapeutic drugs in colorectal cancer cells, but not for colorectal cancer treatment, but only for controls; meanwhile, RFC4 does not influence the curative effect of chemotherapeutic drugs (5-fluorouracil, 5-Fu; oxaliplatin, Oxa) in the neoadjuvant therapy of the rectal cancer in the local advanced stage, which shows that RFC4 only influences the radiotherapy in the neoadjuvant therapy and can be used as an independent predictor to accurately predict the curative effect of the radiotherapy. Wherein, FIGS. 11a-11d correspond to proliferation and dose-response curves of etoposide, doxorubicin, oxaliplatin and 5-fluorouracil against RFC4 overexpression and empty vector group cells, respectively; FIG. 11e shows the half maximal Inhibitory Concentration (IC) of four drugs against cells of the group of RFC4 overexpressing and empty vector₅₀) Counting results; FIG. 11f is a raw picture of the four drugs affecting the ability of RFC4 to overexpress and clonally form empty vector group cells; FIG. 11g shows the statistics of the number of clones formed in FIG. 11 f.

The colorectal cancer cell line is selected, the whole genome shRNA library is used for screening and identifying step by step, and the experimental result shows that: during the process of inducing the cells to resist the radiation, the mRNA level of RFC4 is gradually increased, and the expression level of RFC4 is detected to be greatly increased in the radiotherapeutic resistant cell strains. Thus, examination of the expression level of RFC4 mRNA in pre-treatment biopsies thereof can be used to determine the degree of tolerance to radiotherapy.

After RFC4 was selected as a molecular marker, 145 biopsy tissues before the treatment of locally advanced rectal cancer (all of which received neoadjuvant chemoradiotherapy) were further selected by the present invention, and the protein expression level thereof was detected by immunohistochemistry. The experimental result shows that the expression level of the RFC4 protein is related to the condition of tumor regression after neoadjuvant therapy, specifically, the high-level expression is positively related to poor tumor regression, the low-level expression is positively related to good tumor regression, the correlation only indicates the result caused by radiotherapy factors, and is unrelated to chemotherapy; high expression of the RFC4 protein in tumors indicates poor prognosis and low expression indicates good prognosis. Therefore, the expression level of the RFC4 protein can be directly used for predicting the tumor regression condition caused by long-range radiotherapy in neoadjuvant therapy, namely the curative effect of the radiotherapy. This result further indicates that there is a clear correlation between high expression levels of RFC4 and tumor regression failure, and that it is positively correlated with poor prognosis. The invention eliminates the influence of RFC4 on the chemotherapy of colorectal cancer, directly clarifies that RFC4 is a tolerance factor of the local advanced colorectal cancer new-auxiliary radiotherapy, and can indicate the sensitivity of a patient to the radiotherapy.

Sequence listing

<110> center for preventing and treating tumors of Zhongshan university

<120> kit for detecting cancer radiotherapy sensitivity and application thereof

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 1

ccgctgacca aggatcgag 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 2

agggaacggg tttggctttc 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 3

ttgggcctga acttttccga t 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 4

agcgacttcc tgacacagtt a 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 5

gccgtgtccg ccttttaaga t 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 6

agataagaca gaatcgggtg gt 22

<210> 7

<211> 22

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 7

cagcagctag agaactcttt gg 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 8

cttcccatct gagcgacttc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 9

ctcctgggcc cgttattctc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 10

ctcctcgatc cttggtcagc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 11

cggaaacctg aggaacgagc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 12

tttttccacc cagggaacgg 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 13

gacttcgaga ccatctcgtc c 21

<210> 14

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 14

tggtcagcgg gggtttagta 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 15

acttcgagac catctcgtcc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 16

cttggtcagc gggggtttag 20

<210> 17

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 17

tatcgcggaa acctgaggaa c 21

<210> 18

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 18

agcgacttcc tgacacagtt 20

<210> 19

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 19

ctcgtccttt ttgtatcgcg g 21

<210> 20

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 20

gggaacgggt ttggctttct 20

<210> 21

<211> 21

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 21

taagtctcct gggcccgtta t 21

<210> 22

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 22

agggaacggg tttggctttc 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 23

cgtccttttt gtatcgcgga 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 24

catccacaca ttttgggcga 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 25

tcgtcctttt tgtatcgcgg 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 26

tcatccacac attttgggcg 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 27

gcacgagaag ccaggctaac 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Synthesis (Artificial)

<400> 28

taaaaggcgg acacggcttc 20

Claims

1. Use of a composition for the manufacture of a kit for detecting sensitivity to and/or prediction of efficacy of radiation therapy for rectal cancer, said composition comprising: a primer pair group for detecting the expression level of the mRNA of the RFC4 gene and/or a RFC4 protein content detection reagent, wherein the primer pair group is selected from at least one pair of the following primer pairs:

(9) and (3) primer pair 8: the sequence of the upstream primer is shown as SEQ ID NO: 15, the sequence of the downstream primer is shown as SEQ ID NO: 16 is shown in the figure;

(14) primer pair 14: the sequence of the upstream primer is shown as SEQ ID NO: 27, the sequence of the downstream primer is shown as SEQ ID NO: 28 is shown;

the RFC4 protein content detection reagent is selected from RFC4 monoclonal antibody and/or RFC4 polyclonal antibody.

2. Use of a reagent for detecting the expression level of RFC4 in the preparation of a composition for detecting sensitivity to and/or prediction of efficacy of radiotherapy for rectal cancer.

3. The use according to claim 2, wherein the reagent for detecting the expression level of RFC4 comprises a primer pair group for detecting the expression level of mRNA of the RFC4 gene and/or a RFC4 protein content detection reagent, and the primer pair group is selected from at least one of the following primer pairs:

4. Use according to claim 2 or 3, characterized in that said rectal cancer is a locally advanced rectal cancer.