CN109781972B - Immune quantitative detection method and application - Google Patents
Immune quantitative detection method and application Download PDFInfo
- Publication number
- CN109781972B CN109781972B CN201910042577.1A CN201910042577A CN109781972B CN 109781972 B CN109781972 B CN 109781972B CN 201910042577 A CN201910042577 A CN 201910042577A CN 109781972 B CN109781972 B CN 109781972B
- Authority
- CN
- China
- Prior art keywords
- sample
- antigen
- antibody
- standard
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses an immune quantitative detection method, which comprises the following steps: step S1, establishing a standard curve equation of competition index-concentration through the standard substance and the antagonist; and S2, detecting the competitive index of the sample, and calculating the concentration of the antigen to be detected in the sample by using a standard curve equation according to the competitive index of the sample. The immune quantitative detection method of the invention establishes the correlation between the immune reaction of the sample and the standard substance by introducing a specially designed antigen (antagonist), then processes the fluorescence intensity data into a competitive index by a two-color fluorescence reaction, and establishes a dose-competitive index standard curve for quantification; the competitive index is used as a quantitative reaction relation, so that the influence of immunoreaction condition difference is solved, the stored standard curve can be used for quantification, the standard curve is not required to be made along with a sample every time, and the contradiction between accurate quantification and simplicity and convenience of immunoassay (including immunochromatography) is perfectly solved.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to an immune quantitative detection method and application.
Background
There are two quantification schemes for immunoassays: standard curve quantitation and relative comparison semiquantitation were made. The standard curve is generally in the linear range of detection, a plurality of (five or more) standard substances with known concentration synchronously react with the sample, the determination is carried out according to the dose-response relation, the points are connected and the standard curve is generated by fitting, and the concentration of the standard substances is calculated according to the reaction value of the sample. Semi-quantitative immunoassay is to roughly determine the concentration of a sample by comparing the degree of reaction of the sample with the degree of reaction of a standard concentration (generally only one), is commonly used in a single test, has the advantages of simplicity and convenience, but has large quantitative error and low accuracy.
However, in both the standard curve method and the semi-quantitative method, the standard substance and the sample are reacted with each other, the correlation degree of the reaction between the standard substance and the sample is not strong, and the accuracy of the final quantitative result is affected by the occurrence of a problem in either of the two methods.
Disclosure of Invention
The invention provides an immune quantitative detection method and application to realize rapid and accurate immune quantitative detection.
In one aspect, the invention provides an immune quantitative detection method, which comprises the following steps:
step S1, establishing a standard curve equation of competition index-concentration through the standard substance and the antagonist;
and S2, detecting the competitive index of the sample, and calculating the concentration of the antigen to be detected in the sample by using the standard curve equation according to the competitive index of the sample.
In the immune quantitative detection method provided by the invention, the antigen in the standard substance and the antigen to be detected in the sample comprise a first antibody recognition site and a second antibody recognition site, and do not comprise a third antibody recognition site; the antagonist is an antigen comprising a first antibody recognition site and a third antibody recognition site, free of a second antibody recognition site; the second antibody is labeled with a first fluorescent substance, and the third antibody is labeled with a second fluorescent substance.
In the method for quantitative immunoassay of the present invention, the third antibody can recognize a site of a genetically engineered antigen-tagged protein (including but not limited to MyC, His, GST, HA, GFP, CFP, YFP, luciferase, etc.) or others, and cannot recognize an antigen in the standard and a site on an antigen to be detected in the sample.
In the method for quantitative immunoassay provided by the present invention, a binding substance and a ligand (including but not limited to avidin and biotin, enzyme and substrate, receptor and ligand, protein and aptamer, etc.) that are specifically reactive may be used instead of the third antibody and its antigenic site.
In the quantitative immunoassay method provided by the present invention, the step S1 includes:
step S11, reacting the mixture of the standard substance and the antagonist with a marker liquid, and removing unreacted liquid;
step S12 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index, which is the fluorescence intensity of the first fluorescent substance/the fluorescence intensity of the second fluorescent substance;
step S13, changing the concentration of the standard substance, and repeating the step S11 and the step S12 to obtain a corresponding competition index;
and step S14, drawing the standard curve equation by using the concentration of the standard substance and the corresponding competition index.
In the quantitative immunoassay method provided by the present invention, the step S2 includes:
step S21, reacting the mixture of the sample and the antagonist with a marker liquid, and removing unreacted liquid;
step S22 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index;
and step S23, calculating the concentration of the antigen to be detected in the sample according to the competition index of the sample and the standard curve equation.
Correspondingly, the invention also provides an application of the immune quantitative detection method in quantitative detection of procalcitonin in serum by using a microplate reaction method.
Correspondingly, the invention also provides an application of the method for quantitatively detecting procalcitonin in serum by using the immunochromatography method through the immune quantitative detection method.
Compared with the prior art, the immune quantitative detection method has the following advantages: the immune quantitative detection method of the invention establishes the correlation between the immune reaction of the sample and the standard substance by introducing a specially designed antigen (antagonist), then processes the fluorescence intensity data into a competitive index by a two-color fluorescence reaction, and establishes a dose-competitive index standard curve for quantification; the competitive index is used as a quantitative reaction relation, so that the influence of immunoreaction condition difference is solved, the stored standard curve can be used for quantification, the standard curve is not required to be made along with a sample every time, and the contradiction between accurate quantification and simplicity and convenience of immunoassay (including immunochromatography) is perfectly solved.
Drawings
FIG. 1 is a flow chart of a quantitative immunoassay method according to an embodiment of the present invention;
FIG. 2 is a graph showing a standard curve with fluorescence intensity as an ordinate;
fig. 3 shows a standard curve with competition index as ordinate.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to limit the scope of the present invention.
The invention introduces specially designed antigen (antagonist) to establish the correlation between the immune reaction of the sample and the standard substance, then processes the fluorescence intensity data into competition index through double-color fluorescence reaction, and establishes a standard curve of dosage-competition index for quantification. Research shows that, within a certain range, the detection results of the same sample are not greatly different, and the difference of the competitive indexes is very small, so that the accuracy of immune quantification can be completely reflected by using the competitive indexes.
Referring to fig. 1, the quantitative immunoassay method provided by the present invention comprises the following steps:
step S1, establishing a standard curve equation of competition index-concentration through the standard substance and the antagonist;
and S2, detecting the competitive index of the sample, and calculating the concentration of the antigen to be detected in the sample by using the standard curve equation according to the competitive index of the sample.
Specifically, in the present invention, a two-color immunofluorescence competition reaction mode is used to correlate the standard with the sample reaction via the antagonist. The specific design is as follows: the same fluorescent label is used for the sample (standard) detection, another fluorescent label is used for the antagonist, and FITC, PE, RB200, TRITC, CY3, CY5, lanthanide series: eu, Tb, etc. The two fluorescent materials are matched by paying attention to the fact that the fluorescence with crossed emission spectra avoids simultaneous use, for example, FITC and PE, and two fluorescent materials with approximate fluorescence intensity are matched as much as possible.
Further, in the present invention, the antigen to be tested (i.e., the antigen in the standard and the sample) contains a first antibody recognition site and a second antibody recognition site, and no third antibody recognition site; a specifically designed antigen (i.e., an antigen in an antagonist) comprises a first antibody recognition site and a third antibody recognition site, with the second antibody recognition site deleted. The third antibody can recognize genetically engineered antigen tag proteins (such as MyC, His, GST, HA, GFP, CFP, YFP, luciferase and the like) or other sites, and can not recognize the antigen in the standard and the site on the antigen to be detected in the sample. The third antibody and its antigenic site may be replaced by other specific reactive binders and ligands (e.g., avidin and biotin, enzyme and substrate, receptor and ligand, protein and aptamer, etc.).
The invention is mainly used for the immune quantitative detection for detecting the antigen by adopting a double-antibody sandwich method. For the double antibody sandwich assay: the first antibody and the second antibody are both antibodies aiming at different sites on a certain antigen. The first antibody acts as a solid phase (coating) antibody and the second antibody acts as a labeled antibody. The third antibody may be a universal tag antibody, also used for labeling. The first antibody and the second antibody labeled with the first fluorescent substance can form a double-antibody sandwich structure with the antigen to be detected (namely, the antigen in the standard substance and the sample). The first antibody and the third antibody labeled with the second fluorescent substance can form a double antibody sandwich structure with a specially designed antigen (i.e., the antigen in the antagonist).
Specifically, an antigen to be detected and an antagonist (specially designed antigen) with a certain concentration are added into a reaction system at the same time, the antigen to be detected and the antagonist compete with a solid-phase first antibody to react, if the antigen to be detected does not exist in a sample, the number of the first antibody sites is occupied by the antagonist, the first antibody sites are gradually occupied by the antigen to be detected along with the increase of the concentration of the antigen to be detected, the number of the sites occupied by the antagonist is reduced, two unreacted antigens are removed, the antigen to be detected and the antagonist react with a second antibody and a third antibody which are labeled differently, unreacted labeled antibodies are washed away, two kinds of fluorescence are read respectively, the relative concentrations of the antigen to be detected and the antagonist can be reflected by the two fluorescence intensities, and the competition index of the antigen to be detected and the antagonist is calculated. Within a certain range, the concentration of the antigen to be detected is positively correlated with the competition index of the special antigen reaction with a certain concentration, and the dosage-competition index relationship can be established for quantification.
Further, step S1 includes:
step S11, reacting the mixture of the standard substance and the antagonist with a marker liquid, and removing unreacted liquid;
step S12 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index, which is the fluorescence intensity of the first fluorescent substance/the fluorescence intensity of the second fluorescent substance;
step S13, changing the concentration of the standard substance, and repeating the step S11 and the step S12 to obtain a corresponding competition index;
and step S14, drawing the standard curve equation by using the concentration of the standard substance and the corresponding competition index.
Further, step S2 includes:
step S21, reacting the mixture of the sample and the antagonist with a marker liquid, and removing unreacted liquid;
step S22 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index;
and step S23, calculating the concentration of the antigen to be detected in the sample according to the competition index of the sample and the standard curve equation.
In the present invention, a standard curve of competition index-concentration is established using six (or more) antigens (standards) to be measured of known concentration according to the above reaction principle, a standard curve equation is fitted, and the equation is recorded. When detecting the sample, only the competition index of the sample needs to be detected, and the concentration of the antigen to be detected in the sample is calculated by utilizing a fitting equation according to the competition index.
The immune quantitative detection method provided by the invention has the following advantages:
1. only a standard curve needs to be established once, and by using a stable parameter of a competitive index and introducing an internal reference of a special antigen (antagonist), the efficiency of immune response is fully embodied, and the error of each experiment of the immune response is avoided.
2. The competitive index takes the reactivity of the antigen and the antibody into consideration, and compared with the direct use of fluorescence intensity, the detection stability is higher each time, and a standard curve does not need to be established each time.
3. The linear range of the standard curve can be changed by adjusting the concentration of the antagonist, and the adaptability is wider.
4. The standard curve can be built in a detection instrument, and the method is more advantageous for single test (such as POCT technology like test paper strips).
The following two examples illustrate the application of the quantitative immunoassay method of the present invention.
Example one
Microplate immunoassay for quantitative determination of procalcitonin in serum (PCT)
1.1 two antigen designs: both antigens are prepared by genetic engineering methods. One is antigen I, an antigen comprising recognition sites for antibody 1 and antibody 2, and not comprising a recognition site for antibody 3; the other is antigen II (specifically designed antigen) which contains recognition sites for antibody 1 and antibody 3 but cannot contain recognition site for antibody 2. The antigen I is used for preparing a standard substance after accurate quantification; antigen II was used to prepare antagonists after accurate quantification.
For PCT antigen I, complete antigen design is adopted, firstly, a gene sequence (mRNA) of PCT is searched, and after a rare codon in the gene sequence is replaced, a primer is designed:
PCT P5’ctcgaggcaccattcaggtctgcc
PCT P3’gaattcgttggcattctggggcatg
PCR amplifies the whole gene, introduces into pTrxA expression vector, prepares pTrxA-PCT plasmid, transforms into BL21 colibacillus, uses isopropyl-beta-D-thiogalactoside (IPTG) to induce and express full-length PCT fusion protein (fusion TrxA protein), purifies through HIS column, and uses the concentration of calibration protein as standard substance for standby.
PCT antigen II contains only the first 50 amino acid design, which is contained in the binding site of antibody 1, and this 50 amino acid antigen plus the antigen fused to GST constitutes the PCT antigen II design. Designing a primer:
NPCT P5’ctcgaggcaccattcaggtctgcc
NPCT P3’gaattc ggagccctctctctcttgct
the primer is used for PCR amplification of a PCT gene, a nucleotide sequence containing the pre-PCT 150bp is inserted into a pGEX-4T-1 expression vector through enzyme cutting sites at two ends of a PCR product and is transformed into BL21 escherichia coli to express a PCT antigen fragment with a GST label, and the fused antigen is purified through a GST column and has a nominal concentration of 12.3 mg/ml; the antagonist is obtained by diluting to a concentration of 1.0ng/ml with PBS containing 30% fetal calf serum, and storing at 4 ℃ for later use.
1.2 three antibody designs: all three antibodies are monoclonal antibodies. Selecting 2 antigen sites on the complete antigen to be detected, preparing corresponding antibody 1 and antibody 2, wherein the antibody 3 can not be an antibody for identifying the antigen sites to be detected, but can be an antibody for identifying genetically engineered antigen tag protein (such as MyC, His, GST, HA, GFP, CFP, YFP, luciferase and the like) or other sites. For the PCT antigen, the antibody 1 recognition site is located within the first 50 amino acids; the antibody 2 recognition site is located within the next 50 amino acids. The antibody 3 recognition site is the site of the GST protein. Antibody 1 acts as a coating antibody. The antibody 2 is labeled with a fluorescent substance CY3, the antibody 3 is labeled with a fluorescent substance CY5, and the two are mixed in proportion and diluted with PBS containing protective protein BSA to form a labeled working solution.
1.3 microplate quantification method, the reaction steps are divided into one-step method and two-step method
1.3.1 one-step procedure:
1.3.1.1 microplate coating: the antibody 1 is diluted to working concentration by buffer solution, and then the antibody 1 is coated on a micropore plate by a physical adsorption or chemical crosslinking method.
1.3.1.2 adding 50ul of standard substance or sample to be tested into a microporous plate, adding 50ul of diluted antagonist and 50ul of working solution of marker, reacting at 37 ℃ for 60min, throwing off unreacted liquid, and washing the plate with cleaning solution for 5 times.
1.3.1.3PCT standard concentration settings: 0.0 ng/ml; 0.1 ng/ml; 0.2 ng/ml; 0.5 ng/ml; 1.0 ng/ml; 2.0 ng/ml.
1.3.1.4 the intensity of the two fluorescences is detected, the competition index is calculated, and a standard curve is drawn by using the concentration of the standard substance and the competition index. And quantitatively calculating the concentration of the sample according to the standard curve and the competition index of the sample.
1.3.2 two-step Process
1.3.2.1 microplate coating: the antibody 1 is diluted to working concentration by buffer solution, and then the antibody 1 is coated on a micropore plate by a physical adsorption or chemical crosslinking method.
1.3.2.2 adding the standard substance or the sample to be detected into a microporous plate, adding the diluted antagonist, reacting for 60min at 37 ℃, throwing off unreacted liquid, and washing the plate for 5 times by using a cleaning solution.
1.3.2.3 and then 100ul of the working solution of the marker is added, and the reaction is carried out for 60min at 37 ℃. The unreacted liquid was thrown off and the plate was washed 5 times with washing solution.
1.3.2.4 detecting the intensity of the two fluorescences, calculating a competition index, and drawing a standard curve by using the concentration of the standard substance and the competition index. And quantitatively calculating the concentration of the sample according to the standard curve and the competition index of the sample.
1.3.2.5PCT standard concentration settings: 0.0 ng/ml; 0.1 ng/ml; 0.2 ng/ml; 0.5 ng/ml; 1.0 ng/ml; 2.0 ng/ml.
1.3.2.6PCT normal reference values: <0.1ng/ml (no infection); PCT of more than or equal to 0.1ng/ml and less than or equal to 0.5ng/ml indicates mild local bacterial infection; PCT ≧ 0.5ng/ml indicates the onset of more than moderate infection.
1.4 detection result: the research as methodology is respectively carried out on sensitivity test, precision test, specificity, repeatability and accuracy test and a standard curve; effect of varying the concentration of antagonist on the assay results.
1.4.1 sensitivity: the minimum detection limit and the linear range of the detection kit take the average value of 0ng/ml competition index +10 times SD as a positive judgment standard, and the minimum detection limit reaches 0.05 ng/ml.
1.4.2 precision: detecting the same specimen in multiple batches, and calculating the average value, standard deviation and variation coefficient of the original competition index value and concentration value to be less than or equal to 10%.
1.4.3 specificity: the influence of other high-concentration antigens on the detection of the reagent is detected, and the antigen has no cross reaction with proteins such as Bovine Serum Albumin (BSA), C-reactive protein (CRP), Serum Amyloid A (SAA) and human serum albumin.
1.4.4 repeatability: using 3 batches of reagents, the same specimen results were tested for consistency with the test results S within ± 5.0% of the mean.
1.4.5 accuracy: the difference between the assay concentration of the sample of known concentration and the target value is within 5.0% of the target value.
1.4.6 Standard Curve: data from 6 standard curves determined using 3 batches of the kit were analyzed for stability and error. The standard substance of 6 batches is detected, and a standard curve is drawn. The detected fluorescence values were found to differ significantly, but the competition index for each specimen from lot to lot was found to differ only slightly.
Fig. 2 and 3 are standard curves of six sets of data prepared using fluorescence intensity and competitive index as ordinate, respectively, and the difference between the fluorescence intensity and the competitive index is large and small, as can be seen from the error bars. Indicating that the competitive index is relatively stable in different immune responses. But the presence of antagonists may affect the minimum detection limit and detection range of the method.
Example two
Quantitative detection of PCT in serum by immunochromatography
2.1 chromatography membrane coating: antibody-coated chromatographic membrane by physical adsorption method, preparing antibody 1 with concentration of about 5ug/ml in carbonate buffer (pH8.5) or phosphate buffer (pH8.5), streaking at detection zone with dot-film streaking instrument, and coating control zone with excessive protein A (G) or anti-mouse antibody (secondary antibody). Air drying at 4 deg.C overnight, sealing the chromatographic membrane with sealing solution (phosphate buffer solution containing 2% bovine serum albumin) at 4 deg.C overnight, drying the sealing solution, and air drying at 37 deg.C to obtain the final product.
2.2 the chromatographic device is similar to the colloidal gold device and is composed of a sample pad, a marker pad, a chromatographic carrier and a water-absorbent material which are sequentially combined. The sample pad is pre-loaded with a quantity of antagonist. Two fluorescently-conjugated antibodies (CY 3-antibody 1 and CY 5-antibody 2) were placed on the label pad at the same time according to a certain ratio.
2.3 chromatography
2.3.1 Add 50ul of sample (standards) to the pad and chromatography begins.
2.3.2 the sample fluid passes through the marker pad carrying the antagonist in the sample pad, the antigen in the sample reacts with antibody 2-CY3 in the marker pad, and the antagonist reacts with antibody 3-CY5 to form a complex.
2.3.3 flow of liquid continues to chromatography along the chromatographic membrane to the reaction zone, antibody 1 competes with antigen-antibody 2-CY3 complex and antagonist-antibody 3-CY5 complex for binding, respectively, and unreacted antibody 2-CY3 and antibody 3-CY5 continue to chromatography to the control band for binding to protein A (G) or secondary antibody. The remaining liquid stream continues to chromatography into the upper absorbent material.
2.3.4 analysis of results: the fluorescence intensities of CY3 and CY5 of the test strips were read to calculate a competition index. And (4) making a standard curve by using the standard substance and the competitive index thereof, and storing the standard curve in a detection instrument or an electronic computer. The corresponding concentrations are then calculated from the competition index of the sample by an equation fitted inside the standard curve. The two fluorescence intensities of the quality control band respectively indicate the quality of the two fluorescent antibodies, and under the normal condition, the fluorescence intensity should be stronger, and the ratio of the two fluorescence intensities is relatively fixed. If the quality control band is abnormal, the problem of the fluorescent marker is prompted.
2.4 results of detection
2.4.1 sensitivity: the minimum detection limit and the linear range of the detection kit take the average value of 0ng/ml competition index +10 times SD as a positive judgment standard, and the minimum detection limit reaches 0.05 ng/ml.
2.4.2 precision: detecting the same specimen in multiple batches, and calculating the average value, standard deviation and variation coefficient of the original competition index value and concentration value to be less than or equal to 10%.
2.4.3 specificity: the influence of other high-concentration antigens on the detection of the kit is detected, and the kit has no cross reaction with proteins such as BSA, CRP, SAA, human serum albumin and the like.
2.4.4 repeatability: using 3 batches of reagent, the same specimen results were tested for consistency with the results S error within 5.0% of the mean.
2.4.5 accuracy: the difference between the assay concentration of the sample of known concentration and the target value is within 5.0% of the target value.
2.4.6 Standard Curve: data from 6 standard curves determined using 3 batches of the kit were analyzed for stability and error. The standard substance of 6 batches is detected, and a standard curve is drawn. The detected fluorescence values were found to differ significantly, but the competition index for each specimen from lot to lot was found to differ only slightly.
Claims (5)
1. An immune quantitative detection method is characterized by comprising the following steps:
step S1, establishing a standard curve equation of competition index-concentration through the standard substance and the antagonist;
step S2, detecting the competitive index of the sample, and calculating the concentration of the antigen to be detected in the sample by using the standard curve equation according to the competitive index of the sample;
the antigen in the standard substance and the antigen to be detected in the sample comprise a first antibody recognition site and a second antibody recognition site, and do not comprise a third antibody recognition site; the antigen in the antagonist comprises a first antibody recognition site and a third antibody recognition site, and no second antibody recognition site; labeling the second antibody with a first fluorescent substance, and labeling the third antibody with a second fluorescent substance;
the step S1 includes:
step S11, reacting the mixture of the standard substance and the antagonist with a marker liquid, and removing unreacted liquid;
step S12 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index, which is the fluorescence intensity of the first fluorescent substance/the fluorescence intensity of the second fluorescent substance;
step S13, changing the concentration of the standard substance, and repeating the step S11 and the step S12 to obtain a corresponding competition index;
step S14, drawing the standard curve equation by using the concentration of the standard substance and the corresponding competition index;
the step S2 includes:
step S21, reacting the mixture of the sample and the antagonist with a marker liquid, and removing unreacted liquid;
step S22 of detecting the fluorescence intensity of the first fluorescent substance and the second fluorescent substance, and calculating a competition index;
and step S23, calculating the concentration of the antigen to be detected in the sample according to the competition index of the sample and the standard curve equation.
2. The method of claim 1, wherein the third antibody recognizes a genetically engineered antigen-tagged protein and fails to recognize the antigen in the standard and the site on the antigen to be detected in the sample.
3. The method of claim 1, wherein a specific reaction binder and ligand are used in place of the third antibody and its antigenic site.
4. Use of the method of any one of claims 1 to 3 for the quantitative determination of procalcitonin in serum by microplate reaction.
5. Use of the method of any one of claims 1 to 3 for the quantitative determination of procalcitonin in serum by immunochromatography.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910042577.1A CN109781972B (en) | 2019-01-16 | 2019-01-16 | Immune quantitative detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910042577.1A CN109781972B (en) | 2019-01-16 | 2019-01-16 | Immune quantitative detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109781972A CN109781972A (en) | 2019-05-21 |
| CN109781972B true CN109781972B (en) | 2022-02-18 |
Family
ID=66500824
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910042577.1A Active CN109781972B (en) | 2019-01-16 | 2019-01-16 | Immune quantitative detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109781972B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111340091B (en) * | 2020-02-21 | 2022-08-23 | 上海艾瑞德生物科技有限公司 | Training method of CNN (CNN) model for classifying immune data and application of CNN model |
| CN113219167A (en) * | 2021-01-13 | 2021-08-06 | 广东菲鹏生物有限公司 | Dual competition detection method and product |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4666865A (en) * | 1984-01-13 | 1987-05-19 | Centocor, Inc. | Immunoassay for biologically active human interferon-gamma employing unique monoclonal antibodies |
| FR2652900B1 (en) * | 1989-10-11 | 1994-01-28 | Clonatec Sa | IMMUNOLOGICAL ANALYSIS TYPE "SANDWICH" ITS APPLICATION TO ANTENATAL IN VITRO SCREENING FOR TRISOMY 21 AND NECESSARY FOR ITS IMPLEMENTATION. |
| CN101201353B (en) * | 2006-12-14 | 2012-11-14 | 上海透景生命科技有限公司 | Method and reagent box for expanding immune detecting measurable range |
| CN104714017A (en) * | 2015-02-06 | 2015-06-17 | 北京豪迈生物工程有限公司 | Method for quantitatively detecting procalcitonin |
| GB201508832D0 (en) * | 2015-05-22 | 2015-07-01 | Novartis Ag | A method for detecting an analyte |
| CN106526171A (en) * | 2015-09-11 | 2017-03-22 | 睿嘉生物科技股份有限公司 | Immune detection kit |
| CN105891510A (en) * | 2016-04-08 | 2016-08-24 | 四川新健康成生物股份有限公司 | Coating film and test strip for CRP (C-reactionprotein) immunofluorescence chromatography detection, and use method of test strip |
| CN106008720A (en) * | 2016-05-25 | 2016-10-12 | 深圳市国创纳米抗体技术有限公司 | Fusion protein of horseradish peroxidase and antibody fragment and application |
-
2019
- 2019-01-16 CN CN201910042577.1A patent/CN109781972B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109781972A (en) | 2019-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9778252B2 (en) | Analyte detection | |
| CA1334278C (en) | Determination of ambient concentrations of several analytes | |
| CN100420947C (en) | Method for quantitative determination of specific analyte with single trapping agent and reagent kit therefor | |
| JP5166240B2 (en) | In vitro method for simultaneous detection and identification of various series of antibiotics and analysis kit by this method | |
| US7704730B2 (en) | Multiplexed assay methods | |
| JP5703460B2 (en) | Method for measuring protein content | |
| US8956823B2 (en) | Anti-antibody reagent | |
| US20110306511A1 (en) | Methods for multiplex analyte detection and quantification | |
| US20100009394A1 (en) | Universal tandem solid-phases based immunoassay | |
| US20170138937A1 (en) | Detection of analytes | |
| US20210164974A1 (en) | Chromatographic strip comprising multiple test lines, diagnostic kit comprising same, and qualitative, semi-quantitative or quantitative analysis method comprising multiple competitive reaction measurement steps | |
| CN109781972B (en) | Immune quantitative detection method and application | |
| CN205193076U (en) | Biotin - rapid detection cards of avidin system | |
| DK2786150T3 (en) | DETECTION OF MULTIPLE ANALYTES | |
| CA2745442A1 (en) | Test element having combined control and calibration zone | |
| CN114107019B (en) | Microfluidic chip for simultaneously detecting nucleic acid and protein, detection method and application | |
| US8722345B2 (en) | Methods for measuring protein content | |
| KR101548284B1 (en) | A Novel Method for Detecting an Analyte and Kits Using It | |
| CN114167052A (en) | Kit for quantitative detection of NT-proBNP/ST2 by time-resolved fluorescence immunochromatography and application thereof | |
| WO2007016665A2 (en) | Single use fluorescent assays for determination of analytes | |
| CN117529663A (en) | Method for digital immunosensory of single molecules using label immobilization and amplification strategies | |
| RU2519023C2 (en) | Method for detecting wide dynamic range analyte concentration | |
| Findlay et al. | Enzyme immunoassay and related bioanalytical methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |