CN109777877B

CN109777877B - Detection kit for auxiliary diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof

Info

Publication number: CN109777877B
Application number: CN201910208293.5A
Authority: CN
Inventors: 黄毅; 高翔; 孙杰; 周圣军; 聂晟
Original assignee: Ningbo First Hospital
Current assignee: Ningbo Haier Shi Gene Technology Co ltd
Priority date: 2019-03-19
Filing date: 2019-03-19
Publication date: 2022-01-04
Anticipated expiration: 2039-03-19
Also published as: CN109777877A

Abstract

The invention discloses a method for preparingPTBP1The detection kit for the promoter region DNA methylation auxiliary diagnosis of cerebral aneurysm is provided with a pair ofPTBP1Methylation specific amplification primers and a methylation specific sequencing primer in a gene promoter region: wherein, the upstream primer has a nucleotide sequence shown as SEQ ID NO.1, the downstream primer has a nucleotide sequence shown as SEQ ID NO.2, and the methylation specificity sequencing primer is shown as SEQ ID NO.3, has the advantages that the diagnosis kit can conveniently and rapidly realize the detection of the cerebral aneurysm on the molecular level, has high detection efficiency and strong pertinence, and is simultaneously based on the detection of the cerebral aneurysmPTBP1The medicament taking methylation of the gene promoter region as a target spot is expected to become a new means for auxiliary diagnosis, detection and screening of the cerebral aneurysm.

Description

Detection kit for auxiliary diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof

Technical Field

The invention relates to the technical field of auxiliary diagnosis of cerebral aneurysm, in particular to a detection kit for auxiliary diagnosis of cerebral aneurysm and application thereof, and especially relates to a kit for detecting cerebral aneurysm related to cerebral aneurysmPTBP1A kit for DNA methylation degree of a gene promoter region and application thereof.

Background

Cerebral aneurysms refer to abnormal saccular or fusiform expansion of the local vessel wall of an intracranial artery, most commonly at the bifurcation of a vessel in the internal carotid artery system. Cerebral aneurysm rupture hemorrhage is the leading cause of subarachnoid hemorrhage, and is 3 rd in cerebrovascular accident cases, second only to cerebral infarction diseases and hypertensive cerebral hemorrhage. Although a benign disease, cerebral aneurysm has a very high disability rate and death rate once it breaks down and bleeds, and seriously threatens human health. It is mainly related to high intracranial pressure, cerebral vasospasm, space occupying effect of intracerebral hematoma, hydrocephalus, epilepsy and the like caused by rupture and bleeding of cerebral aneurysm. Therefore, the research of early and rapid diagnosis of the cerebral aneurysm has very important significance for preventing and treating the disease, improving prognosis and reducing social cost.

Polypyrimidine binding protein 1(Polypyrimidine trap binding protein 1,PTBP1) Is a highly conserved RNA binding protein, and can be selectively spliced to regulate and control protein. PTBP1 is expressed in various parts of the human body and is involved in many biological processes. Its expression can regulate the expression of a series of target gene mRNAs to maintain cell structure, movement, cell cycle, immunity and protein metabolism. The expression of the PTBP1 protein was found to affect the development and progression of cancer. For example, the PTBP1 protein is highly expressed in colorectal cancer tissues and is associated with poor prognosis in patients; the PTBP1 protein is closely related to breast cancer tumorigenesis and tumor cell growth.PTBP1Alternative splicing functions of genes may affect the way neurons form during embryonic phases, resulting in different complex morphologies and brain sizes.PTBP1Can be used as a biomarker of Parkinson's disease. The research shows that the PTBP1 protein can regulate the metabolism and proliferation of adventitia fibroblast of a pulmonary hypertension patient. However, at present, nothing is disclosed at home and abroadPTBP1The gene methylation and the relevant research of the cerebral aneurysm are reported.

Disclosure of Invention

The invention aims to solve the technical problem of providing a detection kit for assisting in diagnosing cerebral aneurysm, which is convenient to detect, strong in pertinence and high in accuracy, and application thereof aiming at the current situation of the prior artPTBP1The detection method is simple, rapid, noninvasive and high in efficiency.

The technical scheme adopted by the invention for solving the technical problems is as follows:

PTBP1 methylation-based detection kit for auxiliary diagnosis of cerebral aneurysm, wherein the detection kit comprises a pair of detection kitsPTBP1Methylation specific amplification primer and primer for gene promoter regionPTBP1Promoter region DNA methylation specific sequencing primers:

PTBP1promoter region DNA methylation specific nucleotide sequence of the upstream primer:

5’- GTATTTGTGGTTATTGTGGAAATAGT -3’；

PTBP1promoter region DNA methylation specific nucleotide sequence of the downstream primer:

5’- Biotin - AAAACCCTCAAAACTCCATATTAATT -3’；

PTBP1nucleotide sequence of promoter region DNA methylation specific sequencing primer:

5’- GGTTATTGTGGAAATAGTT -3’。

the application of the detection kit for the auxiliary diagnosis of the cerebral aneurysm based on the PTBP1 methylation can be used for the auxiliary diagnosis, detection or screening of the drugs for the cerebral aneurysm.

Compared with the prior art, the invention has the advantages that: the invention discloses a method for detecting the correlation with cerebral aneurysmPTBP1A detection kit for methylation degree of a gene promoter region and application thereof,PTBP1the DNA methylation level of the gene promoter region is positively correlated with the prevalence rate of the cerebral aneurysm.PTBP1The high methylation level of the DNA in the gene promoter region can causePTBP1The low expression of the gene causes the change of related signal paths, thereby causing the disorder of cerebral artery and blood vessel to cause diseases. Thus, toPTBP1The medicine with the gene promoter region DNA methylation as the target spot is expected to become a new means for auxiliary diagnosis, detection and screening of the cerebral aneurysm.

The traditional diagnosis of cerebral aneurysm is based on imaging means, and patients often have related symptoms before being treated in hospitals. The cerebral aneurysm has no sign before rupture, the death rate is extremely high, and approximately 1/3 patients with the cerebral aneurysm die after the disease is sent to a hospital for treatment. The invention is to detectPTBP1The detection kit based on the DNA methylation level of the gene promoter region can conveniently and quickly realize the detection of the cerebral aneurysm on the molecular level, has high detection efficiency and strong pertinence, and is favorable for the early discovery of the cerebral aneurysmAnd timely treatment.

Drawings

FIG. 1 is a drawing ofPTBP1The specific positions of the detected sequence of the gene promoter region are Chr19: 796,392-797,191, (GRCh37/hg19) and the detailed positions of the detected 6 CpG sites;

FIG. 2 isPTBP1Examples of the results of DNA methylation level measurements in the promoter region of the gene (percentages shown in the figure are the degree of methylation at corresponding CpG sites, as indicated by 5%, 6%, 4%, 7%, 3%, 0% for CpG1 to CpG6, respectively);

FIG. 3 shows the relationship between cerebral aneurysm and control groupPTBP1Differential DNA methylation in the promoter region of the gene (patients with cerebral aneurysms)PTBP1The degree of gene methylation is significantly higher than that of the control group);

FIG. 4 shows the relationship between the male cerebral aneurysm and the control groupPTBP1Differential DNA methylation in the promoter region of the gene (patients with cerebral aneurysms)PTBP1The degree of gene methylation is significantly higher than that of the control group);

FIG. 5 shows the relationship between female cerebral aneurysm and control groupPTBP1Differential DNA methylation in the promoter region of the gene (patients with cerebral aneurysms)PTBP1The degree of gene methylation is significantly higher than that of the control group);

FIG. 6 is a drawing showingPTBP1Gene promoter region DNA methylation and sensitivity and specificity for cerebral aneurysms (AUC = 0.78, sensitivity at optimal cut-off 75.0%, specificity 79.2%).

Detailed Description

The invention is described in further detail below with reference to the accompanying examples.

5’- GTATTTGTGGTTATTGTGGAAATAGT -3’；

PTBP1promoter region DNA methylNucleotide sequence of chemospecific downstream primer:

5’- Biotin - AAAACCCTCAAAACTCCATATTAATT -3’；

5’- GGTTATTGTGGAAATAGTT -3’。

Based onPTBP1The detection method of the detection kit for the promoter region DNA methylation auxiliary diagnosis of the cerebral aneurysm comprises the following steps:

step one, extracting whole blood genome DNA of a detection sample, and detecting the concentration of the DNA;

secondly, carrying out bisulfite conversion on the sample DNA by a bisulfite treatment kit;

step three, carrying out methylation detection on the converted sample;

and step four, analyzing data.

The following are specific examples of the present invention, in which reagents, raw materials and equipment used are commercially available, except for the specific limitations of the present invention.

1. Collection of study subjects

Collecting volunteers, collecting case groups according to international diagnostic standards of cerebral aneurysm, taking healthy volunteers as control groups, investigating the general conditions of the volunteers in a questionnaire form, and simultaneously taking venous blood to perform general blood biochemical detection, wherein the specific steps are as follows:

48 patients with cerebral aneurysm confirmed by magnetic resonance imaging and angiography were collected from a hospital, age 48.08 ± 5.69 years; gender matched, age matched 48 normal persons were collected as a control group, age 46.63 ± 6.04 years. The control group excluded cardiovascular and cerebrovascular diseases, and other serious diseases such as malignant tumor, serious liver and kidney diseases, etc. All research objects carry out fasting blood drawing to detect general biochemical indexes such as blood fat, blood sugar and the like, and simultaneously, 3ml of venous blood is drawn into an EDTA anticoagulant tube for extracting genome DNA.

2. Extraction of genomic DNA

DNA was extracted according to a standard procedure using a QIAGEN Whole genome DNA extraction kit. Detecting the concentration of the obtained DNA by using a nucleic acid protein analyzer forPTBP1Detection of the methylation level of gene DNA.

3. DNA methylation level determination

The present study adopted pyrosequencing technology pairPTBP1DNA methylation level analysis was performed at 6 CpG sites (FIG. 1) in the gene promoter region (GRCh37/hg19, Chr19: 796, 392-. The basic principle of this technique: after bisulfite treatment of the DNA sample, Polymerase Chain Reaction (PCR) amplification is used to maintain the methylated cytosine (C) base unchanged while the unmethylated C is converted to uracil (U), and PCR sequencing is performed using sequencing primers to determine which site is methylated. In the research, PyroMark Assay Design software is adopted for primer Design, and PCR amplification primers and sequencing primers used for experiments are as follows:

(1) PTBP1promoter region DNA methylation specific upstream primer (Forward primer)

5’- GTATTTGTGGTTATTGTGGAAATAGT -3’；(SEQ ID NO.1)；

(2) PTBP1Promoter region DNA methylation specific downstream primer (Reverse primer)

5’- Biotin - AAAACCCTCAAAACTCCATATTAATT -3’(SEQ ID NO.2)；

(3) PTBP1Promoter region DNA methylation specific Sequencing primer (Sequencing primer)

5’- GGTTATTGTGGAAATAGTT -3’(SEQ ID NO.3)。

The specific experimental steps are as follows:

step A. Bisulfite conversion of the sample DNA was performed using QIAGEN EpiTect Bisulfite treatment Kits (EpiTech Bisulfite Kits; Qiagen; # 59104).

Step B, taking 20ng of the DNA sample converted in the step A, adding the DNA sample into a PCR amplification system, and adding 10 mu L of 5 x buffer GC (KAPA); dNTP (10mM/each) 1. mu.L; primer (up50pM/ul) 1 μ L; primer (down50pM/ul) 1 uL; template 2. mu.L; taq (5U/. mu.L) 0.2. mu.L; finally, the total volume is adjusted to 50 mu L according to the DNA concentration.

The PCR amplification procedure was as follows: first, denaturation at 95 ℃ for 3 min; then 40 cycles of annealing reaction are carried out, wherein the annealing reaction comprises 94 ℃ for 30s, 56 ℃ for 30s and 72 ℃ for 1 min; then, 72 ℃ extension reaction was carried out for 7 min.

Step c. pyrosequencing:

1) adding 2 mu L of reaction binding beads, 38 mu L of binding buffer solution and 40 mu L of PCR products into a 96-hole PCR reaction plate, and fully and uniformly mixing for 10min at room temperature;

2) starting a vacuum pump to absorb the binding beads and the PCR product suspension, and sequentially immersing the binding beads and the PCR product suspension in 70% ethanol, 0.2M NaOH and a washing buffer solution for 5s respectively;

3) turning off the vacuum pump, placing the binding beads on the probe and the PCR product in 40 μ L of annealing buffer solution (containing 1.5 μ L of sequencing primer), denaturing at 85 ℃ for 2 min, cooling to room temperature, and annealing and hybridizing the primer and the template;

4) calculating the dosage according to Pyrosequencing software sequence design information, and sequentially adding a substrate mixture, an enzyme mixture and four dNTPs (QIAGEN) into a reagent cabin;

5) the reagent chamber and the 96-well reaction plate were placed in a Pyrosequencing detector (PyroMark Q96 ID, QIAGEN) for reaction, and then the methylation status of each site was automatically analyzed using Pyro Q-CpG software carried in a pyrosequencer (see fig. 2 for the methylation level detection result).

4. Analysis of results

The results were statistically analyzed using SPSS 22.0 software in this study. By case-control group comparison, we found that in patients with cerebral aneurysmsPTBP1The mean methylation degree of the gene promoter region was higher than that of the control group (see figure 3,p <0.0001), wherein the methylation level of all CpG sites except site 3 is higher than that of the normal human group (see FIG. 3,

sites

1,2,4,5,p <0.001; at the position 6 of the amino acid sequence,p <0.05). In addition, we also found that in males (see figure 4,p <0.001) and women (see figure 5,p <0.05) patients with cerebral aneurysmsPTBP1The mean degree of methylation in the promoter region of the gene was significantly increased. And isPTBP1Analysis of the sensitivity and specificity of gene promoter region methylation with cerebral aneurysms (see figure 6) showed AUC = 0.78, 95% CI = 0.69-0.88, sensitivity at the optimal cut-off point of 75.0%, specificity of 79.2%.

The detection kit for the auxiliary diagnosis of the cerebral aneurysm has the advantages of accuracy, reliability, flexibility, rapidness, economy and economy. Adopt above-mentioned kit toPTBP1The methylation level of the gene promoter region is detected, so that the reference can be rapidly and reliably provided for the auxiliary diagnosis, detection or drug screening of the cerebral aneurysm.

While the preferred embodiments of the present invention have been illustrated, various changes and modifications may be made by one skilled in the art without departing from the scope of the present invention.

Sequence listing

<110> Ningbo City first Hospital

<120> detection kit for assisted diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof

<141> 2019-03-19

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence (Unknown)

<400> 1

gtatttgtgg ttattgtgga aatagt 26

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence (Unknown)

<400> 2

aaaaccctca aaactccata ttaatt 26

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Unknown)

<400> 3

ggttattgtg gaaatagtt 19

Claims

1. The application of a pair of PTBP1 gene promoter region methylation specific amplification primers and a PTBP1 promoter region DNA methylation specific sequencing primer in preparing a detection kit for the auxiliary diagnosis of cerebral aneurysm is characterized in that:

nucleotide sequence of PTBP1 promoter region DNA methylation specific upstream primer:

5’- GTATTTGTGGTTATTGTGGAAATAGT -3’；

nucleotide sequence of PTBP1 promoter region DNA methylation specific downstream primer:

5’- Biotin - AAAACCCTCAAAACTCCATATTAATT -3’；

nucleotide sequence of PTBP1 promoter region DNA methylation specific sequencing primer:

5’- GGTTATTGTGGAAATAGTT -3’。