CN109777785A - Hybridoma cell strain and its application - Google Patents
Hybridoma cell strain and its application Download PDFInfo
- Publication number
- CN109777785A CN109777785A CN201811607394.1A CN201811607394A CN109777785A CN 109777785 A CN109777785 A CN 109777785A CN 201811607394 A CN201811607394 A CN 201811607394A CN 109777785 A CN109777785 A CN 109777785A
- Authority
- CN
- China
- Prior art keywords
- cell strain
- monoclonal antibody
- hybridoma cell
- cry1c
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses the hybridoma cell strain for belonging to technical field of bioengineering and its applications.The object deposit number of hybridoma cell strain 3H3 1D2 is CGMCC No.16697, the object deposit number of hybridoma cell strain 5E10 1C6 is CGMCC No.16698.The invention also discloses monoclonal antibodies caused by hybridoma cell strain 3H3 1D2 and hybridoma cell strain 5E10 1C6.The monoclonal antibody indirect ELISA titer is respectively 1:1025000 and 1:1280000, antibody subtype is IgG2b, the monoclonal antibody can be with the endogenous Cry1C albumen in the recombinant CrylC albumen and transgenic paddy rice of specific recognition prokaryotic expression, to realize that qualitative and quantitative analysis of the insect resistance protein Cry1C in transgenic paddy rice lays the foundation.
Description
Technical field
The present invention relates to bioengineering fields, and in particular to arrives hybridoma cell strain and its application.
Background technique
Dipel (Bacillus thuringiensis, Bt) is a kind of gram-positive bacteria being widely present, should
The pest-resistant crystalline protein of bacterium secretion is current main biological pesticide；The insect resistance protein of secretion is according to amino acid sequence similarity quilt
It is divided into two classes: Cry and Cry delta-endotoxin.Wherein Cry albumen is to a variety of harmful insects (such as Lepidoptera, Diptera, coleoptera, line
Insects and protist etc.) larva have toxicity.Cry toxin has been transferred into crops and has made it have insect resistace.Cry1C albumen
It is one of Cry toxin.The crops for turning Cry gene at present mainly have corn, potato, rice, cotton etc..
The development and progress of transgenic technology have pushed the development of biology.Although GM food can satisfy people couple
The requirement of yield, insect resistace etc., but some potential threats also are brought to the life of the mankind simultaneously, such as certain genes are led
Entering host can make food generate toxicity later, and netically modified foods generate anaphylactogen, make one to develop drug resistance, nutritive value of food
It changes.Carry out GM food research and development and it is commercialized simultaneously, in order to which the safety to GM food is given
Comprehensive assessment is given, enables the customer to quickly distinguish GM food and wholefood, suitable method is established and transgenosis is eaten
Product transgenic ingredient is identified and is detected, and can promote agriculture GMO bio-safety management, ensure humans and animals and
The safety of microorganism, while can preserve the ecological environment, promote the further research of agriculture change gene biology technology.In order to turn
Cry1C albumen carries out quickly quantitative or qualitative analysis in trans-genetic hybrid rice or its derivative, studies and obtains anti-Cry1C albumen
Monoclonal antibody have very big meaning.
Summary of the invention
The purpose of the present invention is to provide Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C
Monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6), the monoclonal antibody of secretion are to realize insect resistance protein Cry1C
Qualitative and quantitative analysis in transgenic paddy rice lays the foundation.
The biological deposits of Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) provided by the invention are numbered
Biological deposits for CGMCC No.16697, the Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) are compiled
Number be CGMCC No.16698.
The preparation method of above-mentioned hybridoma cell strain, comprising the following steps:
A) Cry1C recombinant protein is obtained by prokaryotic expression；
B) animal is immunized: BALB/c mouse is immunized using Cry1C recombinant protein as antigen；
C) it cell fusion: collects the splenocyte of immune BALB/c mouse and is merged with SP2/0 cell；
D) cell strain built: being subcloned by limiting dilution assay, is subcloned progress ELISA detection in 5-7 days, until screening
The hybridoma cell strain of stably excreting positive antibody expand and is further cultured for and saves out.
In another embodiment, the splenocyte of mouse and the integration percentage of SP2/0 cell are 1 to above-mentioned preparation method:
(5-10)。
The present invention also provides caused by the Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2)
Monoclonal antibody caused by monoclonal antibody, Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6).
Said monoclonal antibody in another embodiment, Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/
3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) caused by monoclonal antibody class
Type is IgG2b.
Said monoclonal antibody in another embodiment, Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/
3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) caused by monoclonal antibody pass through
It is 1:1025000 and 1:1280000 that indirect ELISA, which detects obtained potency,.
The present invention also provides the preparation methods of said monoclonal antibody, and hybridoma cell strain is inoculated into mouse peritoneal
Ascites is prepared, Protein A- agarose affinity chromatography column purification is then carried out, obtains monoclonal antibody.
The present invention also provides application of the said monoclonal antibody in detection Cry1C insect resistance protein.
The present invention also provides said monoclonal antibodies in the reagent of preparation ELISA method detection Cry1C insect resistance protein
Using.
The present invention also provides said monoclonal antibodies to detect Cry1C insect resistance protein in preparation ELISA double antibody sandwich method
Reagent in application.
Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) provided by the invention and Cry1C monoclonal antibody are miscellaneous
It hands over tumor cell strain (PA1-1707016/5E10 1C6), has successively been preserved in Chinese microorganism strain guarantor on November 8th, 2018
Hide administration committee's common micro-organisms center, preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.Postcode: 100101,
Deposit number is followed successively by CGMCC No.16697 and CGMCC No.16698.
Compared with prior art, the invention has the following beneficial effects: the expression of the application utilizing works bacterial strain, purifying to obtain
High-purity insect resistance protein Cry1C as antigen, special, the sensitive lists of 2 plants of anti-Cry1C of secretion are prepared for by hybridoma technology
Anti- Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain (PA1-
1707016/5E10 1C6), the antibody indirect ELISA potency that the cell strain secretion odd contradictive hydroperitoneum obtains after purification is respectively 1:
1025000 and 1:1280000, antibody subtype are IgG2b, and the monoclonal antibody can be with the recombination of specific recognition prokaryotic expression
Endogenous Cry1C albumen in Cry1C albumen and transgenic paddy rice secretes the mouse monoclonal antibody hybridoma of anti-Cry1C insect resistance protein
The detection for being configured to the albumen in transgenic paddy rice of strain provides substance and technical support.
Detailed description of the invention
Fig. 1 is Cry1C recombinant protein SDS-PAGE electrophoresis result figure of the invention.
Fig. 2 is Cry1C recombinant protein monoclonal antibody screening western result figure of the invention.
Fig. 3 is that Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody of the invention are miscellaneous
Hand over the SDS-PAGE electrophoresis result figure of the monoclonal antibody of tumor cell strain (PA1-1707016/5E10 1C6) purifying.
Fig. 4 is monoclonal caused by Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) of the invention
Antibody titer figure.
Fig. 5 is Dan Ke caused by Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) of the invention
Grand antibody titer figure.
Fig. 6 is monoclonal caused by Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) of the invention
Antibody specificity detects the Cry1C Western result figure in Cry1C recombinant protein and transgenic paddy rice.
Fig. 7 is Dan Ke caused by Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) of the invention
Cry1C Western result figure in grand antibody specificity detection Cry1C recombinant protein and transgenic paddy rice.
Specific embodiment
With reference to the accompanying drawing, specific embodiments of the present invention will be described in detail, it is to be understood that guarantor of the invention
Shield range is not limited by the specific implementation.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples, it is unless otherwise specified, commercially commercially available.
1 hybridoma of embodiment obtains and its preparation of monoclonal antibody
1. the preparation of immunizing antigen
1.1 recombinant protein c ry1C express strain construction, thallus culture and cracking
The amplification of Cry1C encoding gene: using transgenic paddy rice T1C-19 genomic DNA as template, Cry1C-NdeI-F:
Catatggaggagaacaatcagaac and Cry1C-XhoI-R:ctcgagctacttttgtgctctttc is primer, is protected with height
True Fastpfu carries out PCR amplification, and the PCR product expanded is after the identification of (1.0%) agarose gel electrophoresis, by purpose band
Gel extraction is recycled with Universal DNA purification and recovery kit (Tiangeng), and recovery product is through restriction enzyme Nde I
It is connect overnight with the pET28a plasmid fragments for carrying out same digestion, glue recovery processing in 4 DEG C with Xho I digestion, through glue recycling,
It converts Trans10 competent cell (Beijing Quan Shijin), picked clones, carries out bacterium colony PCR identification, positive colony is by Beijing six
Huada gene company is closed to be sequenced.
It will identify correct recombinant expression carrier pET28a-Cry1C conversion e. coli bl21 (DE3) competent cell,
Bacterium solution is coated on the LB plate containing kanamycins (50 μ g/mL), and 37 DEG C are incubated overnight.Next day picking monoclonal on plate connects
In the LB liquid medium of kind kanamycins containing same concentrations, it is incubated overnight in 37 DEG C.Resulting expression bacterial strain bacterium solution and 50%
Glycerite mix in equal volume, in -80 DEG C of cold storage.
By the recombinant protein c ry1C expression bacterial strain recovery culture of preservation, bacterium solution is coated on containing kanamycins (50 μ g/mL)
LB plate on, 37 DEG C are incubated overnight.Picking monoclonal is inoculated with 37 DEG C of mistakes in liquid LB (the 50 μ g/mL containing kanamycins) culture medium
Night culture.It with the inoculation of 1% inoculum concentration, cultivates in 37 DEG C to OD within second day600It is 0.8 or so, 1mM IPTG is added and is stayed overnight in 16 DEG C
Induction expression protein.Induction terminates bacterium solution ice bath, and in 4 DEG C, thalline were collected by centrifugation by 4000rpm, 10min, abandons supernatant, thallus warp
It is suspended after PBS washing with lysate (50mM Tris pH7.5,300mM NaCl, 5%Glycerol and 20mM imidazoles)；Ultrasound
Broken (2s on/4s off, Amp:45%, Time:3min)；4 DEG C of 15000rpm are centrifuged 1hr, collect supernatant.
1.2 recombinant protein purification
Cellular lysate liquid supernatant and the Ni Sepharose 6FF Beads (GE Healthcare) through lysate balance are mixed
It closes, 2-3hrs, 3000rpm is combined to be centrifuged 3min and abandon supernatant in 4 DEG C；Protein-bonded Ni Sepharose 6FF beads warp
Cleaning solution (50mM Tris pH7.5,300mM NaCL, 5%Glycerol and 50mM imidazoles) is washed 2-3 times；Eluent is used again
(50mM Tris pH7.5,300mM NaCL, 5%Glycerol and 200mM imidazoles) elution.Collecting eluent is that albumen is thick
Pure solution.
The protein sample that affinity purification is obtained is dialysed to protein storage solution (50mM Tris pH7.5,300mM
NaCL, 5%Glycerol), and with the Superdex 200Increase 10/30GL (GE balanced through same solution
Healthcare it) is further purified, collects protein peak component and the purity through SDS-PAGE detection protein sample, it can by Fig. 1
, electrophoretically pure Cry1C albumen is finally obtained by gel filtration, molecular weight is about 70kDa.
2. immune animal
The SPF grade BALB/c female of 88 week old is immunized as antigen for the Cry1C recombinant protein of step 1.2 Quality Control qualification
Mouse (is purchased in Hubei Province Animal Experimental Study center, credit number: SCXK (Hubei Province) 2015-0018), antigen with it is isometric complete
Full Freund's adjuvant (head exempts from) and incomplete Freund's adjuvant (booster immunization) are mixed and are emulsified, and are fully mixed to Water-In-Oil state
It is immune to carry out subcutaneous multiple spot, 2-3 booster immunization in 2 weeks each immunization interval periods, carries out bioactivity later, be higher than > 1:
Abdominal cavity impact is carried out after 10000 in 1 week, is directly dissolved in the antigen of immunizing dose in the PBS of 250 μ L, specific immune time and
Immunizing dose is as shown in table 1:
1 immune time of table and immunizing dose
Immune example: one exempts from, and the antigen of 50ug is dissolved in PBS, is then mixed with adjuvant by volume 1:1.
3. cell fusion
After last impacts 3 days, positive control blood is collected, spleen is taken, is prepared into single cell suspension；SP2/ in logarithmic phase
It after the processing of 0 cell, is mixed in a certain proportion (1:5-1:10) with splenocyte, 50%PEG1450 acts on 1min, with basis culture
Base DMEM dilution terminates, and after low-speed centrifugal, then with the HAT culture medium for containing 20% fetal calf serum is gently suspended and is mixed, according to 2 ×
107/ plate is spread to preprepared feeder cells plate, is placed in 5%CO2, cultivate at 37 DEG C.
4. cell strain built
1) fusion plate detection:
Plate to be fused changes liquid cell length to about 10,000 cells of median size or more and starts to detect, qualified in ELISA Quality Control
(i.e. negative control OD450< 0.2, positive control OD450> 1.0) positive hole (general OD is selected after450>=0.5) it is subcloned.
2) subcloning procedures and detection:
Choose and detects positive value height (OD in fusion plate450> 2.0) hole carries out limiting dilution, with the monoclonal of every plate 60%
Hole number counting is subcloned, and the picking positive is worth higher monoclonal hole progress limiting dilution every time, every time subclone 5-7 days
ELISA detection can be carried out, until the monoclonal cell strain that finishing screen selects energy stably excreting positive antibody expands culture.
3) cell strain is established:
The cell strain for the stably excreting positive antibody that the subclone stage is filtered out, expansion is incubated at 24 orifice plates, after expansion
It collects supernatant and carries out antigen detection, its stability is verified using ELISA gradient dilution and western-blotting, passes through Fig. 2
It is found that Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain (PA1-
1707016/5E10 1C6) secretion monoclonal antibody energy specific detection arrive endogenous sample and recombinant protein c ry1C, collection cell expansion in
In 10cm culture dish, collects supernatant again and detect the potency of wherein antibody, pick out OD450> 2.0 2 plants of cell strains are incubated at
It in cell bottle, is frozen, i.e., Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody are miscellaneous
It hands over tumor cell strain (PA1-1707016/5E10 1C6), is successively preserved in Chinese microorganism strain on November 08th, 2018
Preservation administration committee common micro-organisms center (abbreviation CGMCC), deposit number are followed successively by CGMCC No.16697 and CGMCC
No.16698。
4) cell strain, which freezes, identifies that one in the same batch that must recover after cell strain freezes is identified, is reflected
Calibration is quasi-:
1. recovery viable count >=1,000,000 cell/；2. vibrant cell >=500,000/strain in living cells；3. recovery is thin
There cannot be other microorganisms (such as: bacterium fungi mycoplasma) in addition to cell strain cell to occur in born of the same parents；4. recovery cell
It grows into after certain amount to select the cell grown and make monoclonal and counts bed board, and the secretory antibody ability for detecting monoclonal is
No full sun has antibody-secreting；5. cells and supernatant also needs to make ELISA (OD450> 2.0), to determine whether to secrete positive antibody
While do the identification of western-blotting, as shown in Figure 3, Cry1C monoclonal antibody hybridoma cell strain (PA1-
1707016/3H3 1D2) and the monoclonal antibody of Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) secretion can be special
Detect endogenous sample and recombinant protein c ry1C.
5 for ascites
First injected with norphytane or atoleine row mouse peritoneal, after a week respectively by hybridoma cell strain 3H3 1D2 and
Hybridoma cell strain 5E10 1C6 is inoculated into two mouse peritoneals, is expanded culture after cell singling and is selected the training of 10% fetal calf serum
Base is supported, when cell density reaches with 1 × 106-2×106When/mL, 800rpm centrifugation collects precipitating, and after being resuspended with PBS, abdomen
Chamber is injected into mouse (atoleine) in vivo, after 7-10 days, collects ascites and prepares purifying.
6 antibody purifications
Ascites after collection selects Protein A- agarose affinity chromatography column purification after pretreatment, and specific steps are such as
Under:
1) buffer: start buffer pH7.0,20mM phosphate buffer；Elution buffer is the sweet ammonia of pH2.7 0.1mM
Hydrochlorate acid.
2) prepare collecting pipe: taking 1.5mL centrifuge tube, every centrifuge tube adds 70 μ L pH9.0 1M Tris-HCL.
3) preparation of samples: the sample precipitated through 50%SAS sets start buffer and carries out dialysed overnight, and through 0.22 μ
The filtration of m miillpore filter.
4) purification process: Protein A- agarose affinity chromatography column is balanced with enough start buffers (8-10mL)
(HiTrap Protein A 1mL, Pharmacia Biotech).Take sample to be purified (every milliliter of sample .2- containing protein 10
Then 21.1mg) 15-25mL upper prop, flow velocity 0.5mL/min successively use start buffer 7-8mL, elution with same flow velocity
Buffer 6-7mL, start buffer 5mL washing, every pipe 1mL collect eluent.
5) purity and the monoclonal antibody (McAb) of activity identification purifying identify its purity with SDS-PAGE, are detailed in Fig. 3, lead to
Fig. 4 is crossed it is found that Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain
The purified nearly all foreign protein of removal of (PA1-1707016/5E10 1C6) monoclonal antibody, there is 2 main bands of specificity
(55kDa and 30kDa).
7. the subgroup identification and titration of monoclonal antibody
By standard anti-the BALB/c mouse IgG1, IgG2a, IgG2b, IgG3, IgM of purified monoclonal antibody and sigma company
Antibody carries out ELISA detection, and testing result shows: monoclonal antibody type is IgG2b, using recombinant protein c ry1C as antigen, with indirect
ELISA method detection purified monoclonal antibody potency is measured through ELISA as shown in Figure 4, and the Cry1C monoclonal antibody hybridoma purified is thin
Born of the same parents' strain (PA1-1707016/3H3 1D2) monoclonal antibody titre is 1:1025000；As shown in Figure 5, it measures, purifies through ELISA
Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) the monoclonal antibody titre arrived is 1:1280000.
Monoclonal antibody caused by 2 Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) of table it is dense
Degree and hypotype
| Cry1C monoclonal antibody hybridoma cell strain number | Antibody (IgG) concentration | Antibody subtype |
| PA1-1707016/3H3 1D2 | 4.0mg/mL | IgG2b |
Monoclonal antibody caused by 3 Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) of table it is dense
Degree and hypotype
| Cry1C monoclonal antibody hybridoma cell strain number | Antibody (IgG) concentration | Antibody subtype |
| PA1-1707016/5E10 1C6 | 10.0mg/mL | IgG2b |
8. monoclonal antibody specificity detects
Transgenic paddy rice is extracted respectively and its it converts parent's intrinsic protein, runs SDS-PAGE glue, transferring film purified monoclonal antibody
(Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/3H3 1D2) and Cry1C monoclonal antibody hybridoma cell strain (PA1-
1707016/5E10 1C6)) it is used as primary antibody, Alexa FlurorTM 680goat anti-mouse IgG (H+L)
(Invitrogen) be secondary antibody, with Odyssey infrared740imager (9120, Li-COR Biosciences,
Lincolin, NE) infrared scanner western testing result, as shown in Figure 6, the Cry1C monoclonal antibody hybridoma purified is thin
Cry1C and recombinant protein c ry1C in born of the same parents' strain endogenous sample of (PA1-1707016/3H3 1D2) monoclonal antibody energy specific recognition；Pass through
Fig. 7 is it is found that Cry1C monoclonal antibody hybridoma cell strain (PA1-1707016/5E10 1C6) monoclonal antibody energy specific recognition that purifying obtains
Cry1C and recombinant protein c ry1C in endogenous sample.
Wherein, transgenic paddy rice protein extracting method:
Liquid nitrogen flash freezer is organized, is ground, 1mL (by sample size, general 0.5g adds 1-2mL) protein extract is added, 4 DEG C mix 30
Minute, (12,000rpm 4 DEG C of centrifugation 15min, take supernatant), protein extraction formula of liquid is shown in Table 4:
4 protein extraction formula of liquid of table
| Ingredient | Dosage |
| 1M Tris,pH 7.5 | 500uL |
| 1M NaCL | 1.5mL |
| 0.5M EDTA | 20uL |
| 50%glycerol | 2mL |
| 10%SDS | 1mL |
| Distilled water (DDH2O) | It is made into 10mL |
| Protease inhibitors (Roche) | Used time addition is a piece of |
| 1mM PMSF (phenylmethylsulfonyl fluoride, Sigma) | Used time adds 50uL |
The description of specific exemplary embodiment of the invention is in order to illustrate and illustration purpose.These descriptions are not wishing to
Disclosed precise forms are limited the invention to, and it will be apparent that according to the above instruction, much can be changed and be become
Change.The purpose of selecting and describing the exemplary embodiment is that explain the specific principles of the present invention and its practical application, from
And those skilled in the art can be realized and utilize a variety of different exemplary implementation schemes of the invention and various
Different selections and change.The scope of the present invention is intended to be limited by claims and its equivalents.
Claims (10)
1. hybridoma cell strain, which is characterized in that the hybridoma cell strain 3H3 that biological deposits number is CGMCC No.16697
The hybridoma cell strain 5E10 1C6 that 1D2, biological deposits number are CGMCC No.16698.
2. the preparation method of hybridoma cell strain described in claim 1, which comprises the following steps:
A) Cry1C recombinant protein is obtained by prokaryotic expression；
B) animal is immunized: BALB/c mouse is immunized using Cry1C recombinant protein as antigen；
C) it cell fusion: collects the splenocyte of immune BALB/c mouse and is merged with SP2/0 cell；
D) cell strain built: being subcloned by limiting dilution assay, is subcloned progress ELISA detection in 5-7 days, until filtering out steady
Surely the hybridoma cell strain for secreting positive antibody expand and is further cultured for and saves.
3. the preparation method of hybridoma cell strain according to claim 2, which is characterized in that the mouse boosting cell and SP2/
The integration percentage of 0 cell is 1:(5-10).
4. monoclonal antibody caused by hybridoma cell strain 3H3 1D2 described in claim 1, hybridoma cell strain 5E10 1C6
Generated monoclonal antibody.
5. the monoclonal antibody that hybridoma cell strain according to claim 4 generates, which is characterized in that the monoclonal is anti-
The type of body is IgG2b.
6. the monoclonal antibody that hybridoma cell strain according to claim 4 generates, which is characterized in that the hybridoma is thin
Obtained by monoclonal antibody caused by born of the same parents' strain 3H3 1D2 and hybridoma cell strain 5E10 1C6 is detected by indirect ELISA
Potency be respectively 1:1025000 and 1:1280000.
7. the preparation method of monoclonal antibody described in claim 4, which is characterized in that hybridoma cell strain is inoculated into mouse abdomen
Ascites is prepared in chamber, is then carried out Protein A- agarose affinity chromatography column purification, is obtained monoclonal antibody.
8. application of the monoclonal antibody described in claim 4 in detection Cry1C insect resistance protein.
9. application of the monoclonal antibody in detection Cry1C insect resistance protein according to claim 8, which is characterized in that described
Application of the monoclonal antibody in the reagent of preparation ELISA method detection Cry1C insect resistance protein.
10. application of the monoclonal antibody in detection Cry1C insect resistance protein according to claim 8, which is characterized in that described
Application of the grand antibody in the reagent for preparing ELISA double antibody sandwich method detection Cry1C insect resistance protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811607394.1A CN109777785B (en) | 2018-12-27 | 2018-12-27 | Hybridoma cell strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811607394.1A CN109777785B (en) | 2018-12-27 | 2018-12-27 | Hybridoma cell strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109777785A true CN109777785A (en) | 2019-05-21 |
| CN109777785B CN109777785B (en) | 2021-05-04 |
Family
ID=66497710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811607394.1A Active CN109777785B (en) | 2018-12-27 | 2018-12-27 | Hybridoma cell strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109777785B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110205300A (en) * | 2019-06-04 | 2019-09-06 | 中国农业科学院生物技术研究所 | Bar monoclonal antibody hybridoma cell strain, antibody of generation and preparation method thereof |
| CN114292820A (en) * | 2021-12-28 | 2022-04-08 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application of antibody |
| CN114426955A (en) * | 2021-12-28 | 2022-05-03 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application of antibody |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102120771A (en) * | 2010-12-23 | 2011-07-13 | 浙江大学 | Preparation method of rabbit monoclonal antibody for resisting Cry1c crystal protein |
| CN103145815B (en) * | 2013-03-06 | 2014-12-31 | 中国农业大学 | Method of purifying Bt toxalbumin from insect-resistant cotton seeds |
-
2018
- 2018-12-27 CN CN201811607394.1A patent/CN109777785B/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110205300A (en) * | 2019-06-04 | 2019-09-06 | 中国农业科学院生物技术研究所 | Bar monoclonal antibody hybridoma cell strain, antibody of generation and preparation method thereof |
| CN114292820A (en) * | 2021-12-28 | 2022-04-08 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application of antibody |
| CN114426955A (en) * | 2021-12-28 | 2022-05-03 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application of antibody |
| CN114426955B (en) * | 2021-12-28 | 2023-05-12 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof |
| CN114292820B (en) * | 2021-12-28 | 2023-05-12 | 中国农业科学院生物技术研究所 | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109777785B (en) | 2021-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113699118B (en) | Hybridoma cell strain, antibody produced by hybridoma cell strain and application of hybridoma cell strain | |
| CN108004215A (en) | Hybridoma cell strain and its antibody and preparation method of generation | |
| CN114292820B (en) | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof | |
| CN109777785A (en) | Hybridoma cell strain and its application | |
| CN114426955B (en) | Insect-resistant protein Cry3Bb hybridoma cell strain, antibody produced by same and application thereof | |
| CN109971726A (en) | Hybridoma cell strain and its antibody and preparation method of generation | |
| CN105198990B (en) | Antibody and the preparation method and application thereof for the detection of Bt Cry1 toxoid wide spectrums | |
| CN103992988B (en) | A kind of monoclonal antibody of the anti-canine distemper disease viral N proteins of hybridoma cell strain and generation thereof | |
| CN102453093A (en) | Screening and application of single-chain antibody against fumonisin | |
| CN112921005B (en) | Hybridoma cell strain, canine parvovirus VP2 protein monoclonal antibody produced by hybridoma cell strain and application of hybridoma cell strain | |
| CN116042533A (en) | Insect-resistant protein Cry1F hybridoma cell strain, antibody produced by same and application thereof | |
| CN117230020B (en) | G10 EPSPS monoclonal antibody hybridoma cell strain, antibody produced by same and application thereof | |
| Himananto et al. | Novel and highly specific monoclonal antibody to Acidovorax citrulli and development of ELISA-based detection in cucurbit leaves and seed | |
| CN110172097A (en) | A kind of monoclonal antibody and its application of Killing Mycobacterium Tuberculosis CFP-10 albumen | |
| CN110261606B (en) | Clostridium perfringens beta toxin antibody capture ELISA detection method | |
| CN105543177B (en) | Secrete hybridoma cell strain and its monoclonal antibody application of anti-citrus yellow vein clearing virus monoclonal antibody | |
| CN110205300A (en) | Bar monoclonal antibody hybridoma cell strain, antibody of generation and preparation method thereof | |
| CN112342198A (en) | PAT/PAT monoclonal antibody hybridoma cell strain, antibody produced by same and preparation method thereof | |
| CN117143831B (en) | Insect-resistant protein hybridoma cell strain, antibody produced by same and application thereof | |
| CN110894234B (en) | Monoclonal antibody capable of recognizing alternaria and hybridoma cell strain AaC5 thereof | |
| CN117143832B (en) | Insect-resistant protein Cry1Ah hybridoma cell strain, antibody produced by same and application thereof | |
| CN106544324A (en) | People's mycoplasma pneumoniae monoclonal antibody and its application | |
| CN102181402A (en) | Monoclonal antibody of high-pathogenicity porcine reproductive and respiratory syndrome (PRRS) virus and preparation method thereof | |
| CN108892724A (en) | A kind of preparation method of Vip3Aa20 rabbit polyclonal antibody | |
| CN104558168A (en) | Bt toxalbumin targeted Cry1B nano antibody as well as coding sequence and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |