CN109771412A - The drug and rat model construction method of reangiostenosis after mitigation balloon injured - Google Patents
The drug and rat model construction method of reangiostenosis after mitigation balloon injured Download PDFInfo
- Publication number
- CN109771412A CN109771412A CN201811630908.5A CN201811630908A CN109771412A CN 109771412 A CN109771412 A CN 109771412A CN 201811630908 A CN201811630908 A CN 201811630908A CN 109771412 A CN109771412 A CN 109771412A
- Authority
- CN
- China
- Prior art keywords
- rip3
- mlkl
- rip1
- drug
- balloon injured
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention belongs to pharmaceutical technology field, the drug and rat model construction method of reangiostenosis after a kind of mitigation balloon injured are disclosed, the drug for mitigating reangiostenosis after balloon injured is naringenin；Rat model construction method include: using 2F sacculus induced male balloon injury of rat carotid arteries model, and the 1st, 3,7 and 14 day observation neointimal hyperplasia pathologic process；Then, rat Nar (25,50,100mg/kg/d) are given by administration by gavage daily, continues 14 days.For the present invention these results indicate that the vascellum endometrial hyperplasia that Nar can inhibit balloon injured to induce by inhibiting release and the oxidative stress of inflammatory factor, this may be related with regulation RIP1-RIP3-MLKL signal path.
Description
Technical field
The invention belongs to a kind of drug of reangiostenosis after pharmaceutical technology field more particularly to mitigation balloon injured and greatly
Mouse model construction method.
Background technique
Pipe restenosis is proved to be the major defect of percutaneous coronary intervention (pci) (PCI), and PCI is that stenosis is coronal dynamic
Primary treatments of arteries and veins vascular lesion, and it is characterized in that neointimal hyperplasia, this be a kind of complexity cell and molecule it is anti-
It answers.In recent years, the abnormality proliferation table of endothelial dysfunction and Intima area medium vessels smooth muscle cell (VSMC) has been accepted extensively
Type is the trigger point of reangiostenosis.Although the molecule and cell mechanism of reangiostenosis not yet illustrate completely, more and more
Evidence show PCI induction inflammatory reaction and oxidative stress play an important role in the pathologic process of endometrial hyperplasia.Largely
Research points out that inflammation plays vital adjustment effect in many vascular diseases.It is reported that MAPK and NF- kB activation is adjusted
Inflammatory process participates in the endothelial cell damage of TNF-α induction；In addition the vascular inflammation in the dyslipidemia of diet induced may be by
The adjusting of oxidative stress and inflammatory cytokine.Various cell factors and inflammatory mediator facilitate the pathogenesis of restenosis, example
Such as pro-inflammatory cytokine IL-1 β and TNF-α, play an important role during the occurrence and development of neointimal hyperplasia.In view of
These discoveries, the inflammatory reaction and oxidative stress for reducing PCI induction may be to reduce neointimal hyperplasia and reangiostenosis
Effective way.
Nowadays, a large amount of evidences show that receptor interacting protein kinases (RIPs) is a kind of crucial tune of procedural gangrenosum acne
One of section mechanism, this is a kind of cell death of inflammatory forms.Known RIP1 and RIP3 passes through its RIP homotype interaction motif
(RHIM) oligomerization that structural domain mediates forms heterodimer filiform bracket, but the signal based on the bracket in necrosomes
Conducted events are not yet fully solved.Mixing pedigree kinase domain sample albumen (MLKL) is functional r IP3 substrate, passes through it
Kinases spline structure domain is in conjunction with RIP3 but lacks its own kinase activity.As the typical mechanism of gangrenosum acne apoptosis, report
RIP1-RIP3-MLKL signal transduction path is closely related with inflammation, can promote pathological inflammatory process, and and its in cell
Function in death is unrelated.Many proinflammatory cytokines such as TNF-α can also cause gangrenosum acne apoptosis.However, not yet studying
Effect of the RIP1-RIP3-MLKL signal path after balloon injured in the pathologic process of reangiostenosis.
Naringenin (Naringenin, Nar) is a kind of natural flavanone kind composition, has a variety of pharmacological activities
The effects of effect, including antibacterial, anticancer.It is some studies have shown that Nar has the treatment of injury of blood vessel relevant to inflammatory reaction latent
Power, but there has been no the researchs about Nar to the potential inhibiting effect of reangiostenosis, especially to the concern of anti-inflammatory effect.
In conclusion problem of the existing technology is:
The pathology mistake of regulation RIP1-RIP3-MLKL signal path reangiostenosis after balloon injured is not yet studied at present
Effect in journey.
In the prior art, the effect to naringenin on treatment reangiostenosis, lacks directive significance.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of drugs of reangiostenosis after mitigation balloon injured
And rat model construction method.Based on the above, present invention assumes that naringenin (Nar) can mediate regulation RIP1-RIP3-MLKL
Signal path, the access play crucial work in adjusting inflammatory cytokine to mitigate in rat carotid artery restenosis after balloon injured
With.Therefore, influence of the research Nar to the total intimal hyperplasia of balloon injured posterior neck first.Then, it has studied and inhibits inflammation thin
Whether intracellular cytokine release and the relevant this effect of oxidative stress are related with regulation RIP1-RIP3-MLKL signal path.
The invention is realized in this way blood after a kind of RIP1-RIP3-MLKL signal path mitigation balloon injured by regulation
The drug of pipe restenosis, the medicine for mitigating reangiostenosis after balloon injured by regulation RIP1-RIP3-MLKL signal path
Object is naringenin.
Another object of the present invention is to provide subtracted described in a kind of verifying by regulating and controlling RIP1-RIP3-MLKL signal path
The construction method of the rat model of the medicine effect of reangiostenosis, the construction method packet of the rat model after light balloon injured
Include following steps:
Step 1, using 2F sacculus induced male balloon injury of rat carotid arteries model；
Step 2, in the pathologic process of the 1st, 3,7 and 14 day observation neointimal hyperplasia；
Step 3 is given rat Nar 25mg/kg/d, 50mg/kg/d and 100mg/kg/d by administration by gavage or is waited daily
The CMC-Na of volume continues 14 days；
Step 4 detects experiment.
Further, survey method includes:
Toy ultrasound detection:
Inner film thickness in blood vessel (IMT) is observed and measured using B-Mode, there is the 30MHz peak value petty action for arteria carotis
Object ultrasonic probe；The diastasis longitudinal direction image at least continuously beaten three times is obtained, the endometrial morphology to nearly wall and remote wall is clear
As it can be seen that using digitlization graduated scale manual measurement.
Further, detection method further comprises: histopathology form inspection:
HE dyeing is used for the inspection of histopathology form.The digitized image being sliced by 53 microscopic analysis of IX, and make
It is analyzed with CellSens imaging software with 100x magnifying power and 200x magnifying power: measurement neointima area (NIA), middle film surface
Product (MA) and interior elastic plate wrapping area (IELA), and calculate NIA/MA ratio and NIA/IELA ratio.
Further, detection method further comprises: immunohistochemistry:
After tissue is fixed with 4% paraformaldehyde, 5 μm of paraffin sections and PCNA antibody and CD163 antibody are incubated at 4 DEG C
Overnight；It will be sliced and secondary antibody incubates 1 hour at 37 DEG C, and haematoxylin redyeing be dyed and used with DAB, then film making observation.
Another object of the present invention is to provide one kind to mitigate sacculus to by regulation RIP1-RIP3-MLKL signal path
The detection method of the drug of reangiostenosis includes: ELISA measurement after damage:
Measure the expression of IL-1 β and TNF-α in blood serum sample；All programs are operated according to kit specification.
Further, detection method further comprises: biochemistry detection:
Pass through the level of colorimetric determination oxidative stress correlation factor；SOD activity, MDA and GSH content kit are used for blood
Clear biochemistry detection.
Further, detection method further comprises: real-time quantitative RT-qPCR measurement:
Total serum IgE is extracted using trizol kit, then according to using primeScriptTMReverse Transcriptase kit is by 4.0mg
RNA reverse transcription is at cDNA；Use iQTMSYBR Green Supermix carries out real-time quantitative RT-qPCR.
Further, PCR amplification condition be recycle within 94 DEG C × 3 minutes and 40 (94 DEG C × 15 seconds, 60 DEG C × 20 seconds and 72 ×
DEG C 40 seconds).
Advantages of the present invention and good effect are as follows:
The present invention uses 2F sacculus induced male balloon injury of rat carotid arteries model, and observes at the 1st, 3,7 and 14 day
The pathologic process of neointimal hyperplasia.Then, rat Nar (25,50 and 100mg/kg/d) is given by administration by gavage or is waited daily
The CMC-Na of volume continues 14 days.Ultrasonic examination and histopathological examination show that Nar dose-dependently inhibits sacculus to lead
Pipe induction endometrial hyperplasia, Nar can reduce in inner film thickness (IMT), neointimal area (NIA), neointimal area/middle film
Area (NIA/MA) and neointimal area/interior elastic plate wrapping area (NIA/IELA).Immunohistochemistry shows that Nar is reduced
The protein expression of PCNA.There are highly expressed CD163 in aortic tunica intima, this shows that inflammatory damage occurs after balloon injured
Wound.ELISA the result shows that, Nar it is significant reduce interleukin-1 ' beta ' (IL-1 β) and tumor necrosis factor-alpha (TNF-α) excess
It generates.By detecting the activity of superoxide dismutase (SOD) and the level of malonaldehyde (MDA) and glutathione (GSH), hair
Existing Nar can prevent oxidative stress caused by balloon injured.In addition, RT-qPCR, which proves to handle by Nar, further lowers receptor
Interaction protein kinases (RIP1), receptor interacting protein 3 (RIP3) and mixing pedigree kinase domain sample (MLKL)
MRNA expression.These results indicate that Nar can inhibit endangium caused by balloon injured by inhibiting the release of inflammatory factor
Hyperplasia, this may be related with regulation RIP1-RIP3-MLKL signal path.
Detailed description of the invention
Fig. 1 is that the present invention implements the rat model construction method flow chart provided.
Fig. 2 is the progress figure that the present invention implements rat carotid artery endometrial hyperplasia after the balloon injured provided.(A) (C) petty action
The middle inner film thickness (n=3) of arteria carotis communis after object ultrasound detection balloon injured.The position of inner membrance in arrow expression.(B) it and does evil through another person
Art group is compared, and the HE of 1,3,7 and 14 day arteria carotis communis dyes (n=6 or 10) after balloon injured, with 100, and × and 200 × are put
Big rate shoots photo；(D-F) quantitative analysis of neointimal area (NIA), the ratio calculation of NIA/MA and NIA/MA.
Fig. 3 is that the present invention implements the naringenin provided to the influence diagram of rat freshman endometrial hyperplasia after balloon injured.
Fig. 4 is the present invention naringenin implementing to provide to new intima after balloon injured, PCNA and CD163 immunohistochemistry with
And quantization figure；The influence diagram expressed with IL-1 β in serum and TNF-α content.
Fig. 5 is that the naringenin that present invention implementation provides is active to SOD, the influence diagram of MDA and GSH content, and to RIP1-
The influence of RIP3-MLKL signal path mrna expression amount.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
The pathology mistake of regulation RIP1-RIP3-MLKL signal path reangiostenosis after balloon injured is not yet studied at present
Effect in journey.
Application principle of the invention is described in detail with reference to the accompanying drawing.
As shown in Figure 1, the construction method of rat model provided in an embodiment of the present invention, comprising the following steps:
S101, using 2F sacculus induced male balloon injury of rat carotid arteries model；
S102, in the pathologic process of the 1st, 3,7 and 14 day observation neointimal hyperplasia；
S103 gives rat Nar (25,50 and 100mg/kg/d) or isometric CMC-Na by stomach-filling daily, continues
14 days；
S104 detects experiment.
Application of the invention is further described below with reference to concrete analysis.
In embodiments of the present invention, chemicals and reagent needed for test provided by the invention are as follows:
Naringenin (mw:272.25；Purity: HPLC >=98%) it is purchased from Fei Yu Bioisystech Co., Ltd (Jiangsu Province, China)；
2F Forgarty ball conduit is purchased from Edwards Life Sciences (USA).Anti-PCNA and anti-CD163 antibody is purchased from
Abcam(USA)；RT-qPCR primer is synthesized and is purified by Invitrogen (Chinese Shanghai) customization.Every other reagent is state
It is pure to produce analysis.
In embodiments of the present invention, provided by the invention as follows to experiment progress detection method:
(1) toy ultrasound detection
Toy ultrasound detection:
Inner film thickness in blood vessel (IMT) is observed and measured using B-Mode, there is the 30MHz peak value petty action for arteria carotis
Object ultrasonic probe；The diastasis longitudinal direction image at least continuously beaten three times is obtained, the endometrial morphology to nearly wall and remote wall is clear
As it can be seen that using digitlization graduated scale manual measurement.
(2) histopathology form inspection
HE dyeing is used for the inspection of histopathology form.The digitized image being sliced by 53 microscopic analysis of IX, and make
It is analyzed with CellSens imaging software with 100x magnifying power and 200x magnifying power: measurement neointima area (NIA), middle film surface
Product (MA) and interior elastic plate wrapping area (IELA), and calculate NIA/MA ratio and NIA/IELA ratio.
(3) immunohistochemistry
After tissue is fixed with 4% paraformaldehyde, 5 μm of paraffin sections and PCNA antibody and CD163 antibody are incubated at 4 DEG C
Overnight；It will be sliced and secondary antibody incubates 1 hour at 37 DEG C, and haematoxylin redyeing be dyed and used with DAB, then film making observation.
(4) ELISA is measured
Measure the expression of IL-1 β and TNF-α in blood serum sample.All programs are operated according to kit specification.
(5) biochemistry detection
Pass through the level of colorimetric determination oxidative stress correlation factor.SOD activity, MDA and GSH content kit are used for blood
Clear biochemistry detection.
(6) quantitative real-time RT-PCR
Total serum IgE is extracted using trizol kit (Takara), is then used according to the manufacturer's instructions
primeScriptTMReverse Transcriptase kit (Takara) is by 4.0mg RNA reverse transcription at cDNA.Use iQTMSYBR Green
Supermix (Bio-rad) carries out real-time PCR.PCR cycle condition be 94 DEG C × 3 minutes and 40 recycle (94 DEG C × 15 seconds, 60
DEG C × 40 seconds 20 seconds and 72 × DEG C).By comparing CTMethod calculates data, expresses by reference gene of β-actin.Gene magnification
Primer is as shown in table 1.
Application of the invention is further described combined with specific embodiments below.
Embodiment:
1, material and method
1.1, chemicals and reagent
Naringenin (mw:272.25；Purity: HPLC >=98%) it is purchased from Fei Yu Bioisystech Co., Ltd (Jiangsu Province, China)；
2F Forgarty ball conduit is purchased from Edwards Life Sciences (USA).Anti-PCNA and anti-CD163 antibody is purchased from
Abcam(USA)；RT-qPCR primer is synthesized and is purified by Invitrogen (Chinese Shanghai) customization.Every other reagent is state
It is pure to produce analysis.
1.2, Animal Model
(n=6-10,280-320g, SPF grades) of male Sprague-dawley rat dynamic purchased from Medical University Of Chongqing's experiment
Object center (credit number: SCXK (Chongqing) 2018-0003).It raises in key lab, the Basic pharmacology Ministry of Education, Zunyi Medical College
SPF grades of animal houses raise animal with 12 hours periodicity of illuminations, give sufficient diet and drinking-water.During all zooperies meet
State's experimental animal guidance operating specification.
Carotid thrombosis model is established according to the following steps: using yellow Jackets (60mg/kg) anesthetized rat, then edge
Neck middle position notch exposes left common carotid, and silk thread ligatures distal end external carotid artery, and internal carotid and arteria carotis communis are used
Artery clamp folder closes middle clinopodium polycephalum.2F Fogarty conduit is introduced by the arteriotomy in external carotid artery and advances to musculus hyoideus
Proximal edge and unclamp arteria carotis communis artery clamp.In order to generate injury of carotid artery, fill sacculus with physiological saline (0.3mL)
It is full of, and is drawn it out three times from musculus hyoideus proximal edge to from carotid bifuracation.After damage, external carotid artery is ligatured with 6-0 silk thread.
The artery clamp of internal carotid, restoration of blood flow are taken out simultaneously.Muscle and skin are finally sutured, 80,000 IU penicillin of intraperitoneal injection carry out
It is anti-infective.
1.3, animal packet and administration
Zoopery is divided into two parts.30 rats are randomly divided into 5 groups (preoperative and 1 day, 3 days, 7 days, 14 days postoperative),
Observe the progress of BI.Remaining 60 rat is randomly divided into 6 groups: sham-operation group, sham-operation group+Nar 100mg/kg/d group, model
Group and Nar (25,50,100mg/kg/d) group model.Nar is suspended by CMC-Na.Sham-operation and model group give same volume
CMC-Na.14 days after BI, rat is put to death.
1.4, toy ultrasound detection
(B-Mode Vevo2100, Fujifilm Visualsonics, Canada) is used to observe and measure inner membrance in blood vessel
Thickness (IMT), have for arteria carotis 30MHz peak value toy ultrasonic probe (MS400,
FujifilmVisualSonics, average beam frequency range 22-55MHz)；It is vertical to obtain the diastasis at least continuously beaten three times
To image, the endometrial morphology to nearly wall and remote wall is high-visible, uses digitlization graduated scale manual measurement.
1.5, histopathology form inspection
HE dyeing is used for the inspection of histopathology form.Pass through 53 microscope of IX (Olympus, Japan) analysis slice
Image, and analyzed using CellSens (Olympus, Japan) imaging software with 100x magnifying power and 200x magnifying power: it surveys
It measures neointima area (NIA), media area (MA) and interior elastic plate wrapping area (IELA), and calculates NIA/MA ratio and NIA/
IELA ratio.
1.6, immunohistochemistry
After tissue is fixed with 4% paraformaldehyde, 5 μm of paraffin sections and PCNA antibody and CD163 antibody are incubated at 4 DEG C
Overnight；It will be sliced and secondary antibody incubates 1 hour at 37 DEG C, and haematoxylin redyeing be dyed and used with DAB, then film making observation.
1.7、ELISA
Measure the expression of IL-1 β and TNF-α in blood serum sample.All programs are operated according to kit specification.
1.8, biochemistry detection
Pass through the level of colorimetric determination oxidative stress correlation factor.SOD activity, MDA and GSH content kit are used for blood
Clear biochemistry detection.
1.9, real-time quantitative RT-qPCR
Total serum IgE is extracted using trizol kit (Takara), is then used according to the manufacturer's instructions
primeScriptTMReverse Transcriptase kit (Takara) is by 4.0mg RNA reverse transcription at cDNA.Use iQTMSYBR Green
Supermix (Bio-rad) carries out real-time PCR.PCR cycle condition be 94 DEG C × 3 minutes and 40 recycle (94 DEG C × 15 seconds, 60
DEG C × 40 seconds 20 seconds and 72 × DEG C).By comparing CTMethod calculates data, expresses by reference gene of β-actin.Gene magnification
Primer is as shown in table 1.
Table 1
Primer sequences for RT-qPCR
| Gene | Forward primer(5’-3’) | Reverse primer(5’-3’) |
| RIP 1 | AGGAACACAACAAGCAGAGGGA | CACAATGGCGAAGCTGTACACAT |
| RIP3 | CTGGTGACAGGATTCATGGAGAA | CAGCAGAACATTGGAGGGCTT |
| MLKL | GAGAACAAGAAGCAGGAGCCAG | AAGATTCCATCCGCAGAGGG |
| β-actin | CTGAGAGGGAAATCGTGCGT | AGGGAGGAAGAGGATGCGG |
1.10, statistical analysis
Data are expressed as mean+SD.Use 5.0 editions (GraphPad Software of GraphPad Prism
Lnc., SanDiego, CA) statistical software analysis data.Using the multiple comparative test of Tukey, pass through one-way analysis of variance
(ANOVA) data are analyzed.P < 0.05 is considered to have statistical significance.
2, application of the invention is further described below with reference to result.
The pathologic process of rat freshman endometrial hyperplasia after 2.1 balloon injureds
Ultrasound detection is carried out to observe the sub- dielectric thickness (Fig. 2A) of CCA after balloon injured.As shown in Figure 2 A, CCA is the 1st
It, thickens 3.14%, 27.19%, 69.05% and 99.92% (P < 0.05, Fig. 2 C) for the 3rd day, the 7th day and the 14th day respectively.
Vascular tissue's morphological analysis is shown, compared with sham-operation group, intracavitary region obviously narrows, the intimal thickening of balloon injured CCA
(Fig. 2 B).Cell imaging system the result shows that, compared with sham-operation group, neointima area, NIA/MA ratio and NIA/IELA
The significant increase (P < 0.05, Fig. 2 D, E, F) of ratio.All results show, with the extension of time after balloon injured, CCA's
Neointimal hyperplasia obviously increases, especially at the 14th day.
Influence of 2.2 naringenins to rat freshman endometrial hyperplasia after balloon injured
After balloon injury model foundation, Nar (25,50 and 100mg/kg/d) is given by stomach-filling.Pass through ultrasound detection
The endometrial hyperplasia situation of arteria carotis communis that (Fig. 3 A) and HE dyeing (Fig. 3 B) are observed show that Nar is significant and reduce in interior film thickness
Degree, neointima area, NIA/MA and NIA/IELA ratio, and effect have dose dependent (P < 0.05, Fig. 3 B, 3D, 3E and
3F).In addition, sham-operation group and simple Nar (100mg/kg/d) administration group are without obvious statistical difference, this shows Nar to normal
Blood vessel is without negative effect.These results of study show that Nar can inhibit vascellum endometrial hyperplasia.
The influence that 2.3 naringenins express neointima PCNA after balloon injured
In order to observe the potential impact that Nar adjusts VSMCs phenotype in balloon injured artery, contaminated by immunohistochemistry
Color detects the protein expression of PCNA, and PCNA is the typical characteristics object of phenotypic differentiation.As shown in Figure 4 A, PCNA positive cell is dyed
Brown, the expression of PCNA is negligible in false control group, and that there are a large amount of PCNA in the inner membrance of balloon injured group is positive thin
Karyon.However, compared with model control group, the quantity of PCNA positive nucleus in Nar (25,50 and 100mg/kg/d) processing group
Significant reduction (Fig. 4 C).
The influence that 2.4 naringenins express neointima CD163 after balloon injured
In order to detect influence of the Nar to macrophage polarization induction inflammatory reaction, immunohistochemistry dye also has been carried out to CD163
Color.CD163 is the typical characteristics object of macrophage.As shown in Figure 4 B, CD163 positive cell dyes brown, in balloon injured group
Inner membrance in there are a large amount of CD163 positive nucleus.However, compared with model control group, Nar (25,50 and 100mg/kg/d)
The significant reduction (Fig. 4 D) of the quantity of CD163 positive nucleus in processing group.
2.5 naringenins are to new intima after balloon injured, the influence diagram 4E and 4F of -1 β of serum IL and the expression of TNF-α content.
ELISA detection has been carried out to study the influence that Nar generates the inflammatory cytokine that balloon injured induces.Such as Fig. 4 E
With shown in 4F, compared with sham-operation group, the horizontal significant raising of model group IL-1 β and TNF-α, and Nar treatment can be with dose-dependant
Property to reduce IL-1 β and TNF-α horizontal (P < 0.05).
2.6 naringenins are to SOD activity, the influence of MDA and GSH content.
In order to assess the influence for the oxidative stress that Nar mediates balloon injured, SOD activity and MDA and GSH water are had evaluated
It is flat.As shown in Figure 5A, the reduction of the SOD activity as caused by balloon injured (P < 0.05) is reduced by giving Nar.In addition, Nar is inverse
The raising (P < 0.05, Fig. 5 B and 5C) of MDA caused by balloon injured and GSH level is turned.
2.7 naringenins are by inhibiting RIP1-RIP3-MLKL signal path to improve inflammatory reaction
Real-time quantitative RT-qPCR detection in (Fig. 5 D, 5E and 5F), balloon injury model group compared with false control group, RIP1,
RIP3 and MLKL mRNA expression raises 2.45,8.31 and 3.56 times (P < 0.05).Nar (50 and 100mg/kg/d's) applies
(P < 0.05) is expressed with significant recovery RIP1, RIP3 and MLKL mRNA.By 2.5 and 2.6 results it can be found that ELISA result is scorching
Property cell factor IL-1 β and TNF-α is horizontal and SOD activity, MDA and GSH result are all consistent with mRNA expression of results, show
RIP1-RIP3-MLKL signal path may be the key regulatory factor for inhibiting inflammatory cytokine release and anti-oxidation stress.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Claims (9)
1. a kind of drug for mitigating reangiostenosis after balloon injured by regulation RIP1-RIP3-MLKL signal path, feature
It is, the drug of reangiostenosis is shaddock ped after the RIP1-RIP3-MLKL signal path mitigation balloon injured by regulation
Element.
2. described in a kind of verifying claim 1 again by blood vessel after regulation RIP1-RIP3-MLKL signal path mitigation balloon injured
The construction method of the rat model of narrow medicine effect, which is characterized in that the construction method of the rat model includes following
Step:
Step 1, using 2F sacculus induced male balloon injury of rat carotid arteries model；
Step 2, in the pathologic process of the 1st, 3,7 and 14 day observation neointimal hyperplasia；
Step 3 gives rat Nar 25mg/kg/d, 50mg/kg/d and 100mg/kg/d or isometric by administration by gavage daily
CMC-Na, continue 14 days；
Step 4 is detected.
3. the construction method of rat model as claimed in claim 2, which is characterized in that detection method includes:
Toy ultrasound detection:
Inner film thickness IMT in blood vessel is observed and measured using B-Mode, there is the 30MHz peak value toy ultrasound for arteria carotis to visit
Head；The diastasis longitudinal direction image at least continuously beaten three times is obtained, the endometrial morphology to nearly wall and remote wall is clear, uses number
Change graduated scale manual measurement.
4. the construction method of rat model as claimed in claim 2, which is characterized in that detection method further comprises: tissue
Pathology form inspection:
HE dyeing is used for the inspection of histopathology form；The digitized image being sliced by 53 microscopic analysis of IX, and use
CellSens imaging software is analyzed with 100x magnifying power and 200x magnifying power: measurement neointima area NIA, media area MA
Area IELA is wrapped with interior elastic plate, and calculates NIA/MA ratio and NIA/IELA ratio.
5. the construction method of rat model as claimed in claim 2, which is characterized in that detection method further comprises: immune
Groupization:
After tissue is fixed with 4% paraformaldehyde, 5 μm of paraffin sections and PCNA antibody and CD163 antibody were incubated at 4 DEG C
Night；It will be sliced and secondary antibody incubates 1 hour at 37 DEG C, and haematoxylin redyeing be dyed and used with DAB, then film making observation.
6. blood vessel is narrow again after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path described in a kind of pair of claim 1
The detection method of narrow drug, which is characterized in that after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path
The detection method of the drug of reangiostenosis includes: ELISA measurement: the expression of IL-1 β and TNF-α in measurement blood serum sample；Institute
There is program to be carried out according to kit specification.
7. narrow again to blood vessel after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path as claimed in claim 6
The detection method of narrow drug, which is characterized in that after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path
The detection method of the drug of reangiostenosis further comprises: biochemistry detection:
Pass through the level of colorimetric determination oxidative stress correlation factor；SOD activity, MDA and GSH content kit is for serum
Biochemistry detection.
8. narrow again to blood vessel after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path as claimed in claim 6
The detection method of narrow drug, which is characterized in that after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path
The detection method of the drug of reangiostenosis further comprises: real-time quantitative RT-qPCR detection:
Total serum IgE is extracted using trizol kit, then according to using primeScriptTMReverse Transcriptase kit is by 4.0mg RNA
Reverse transcription is at cDNA；Use iQTMSYBR Green Supermix carries out real-time quantitative RT-qPCR.
9. narrow again to blood vessel after mitigating balloon injured by regulation RIP1-RIP3-MLKL signal path as claimed in claim 8
The detection method of narrow drug, which is characterized in that PCR amplification condition is to recycle for 94 DEG C × 3 minutes and 40；94 DEG C × 15 seconds,
40 seconds 60 DEG C × 20 seconds and 72 × DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811630908.5A CN109771412A (en) | 2018-12-29 | 2018-12-29 | The drug and rat model construction method of reangiostenosis after mitigation balloon injured |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811630908.5A CN109771412A (en) | 2018-12-29 | 2018-12-29 | The drug and rat model construction method of reangiostenosis after mitigation balloon injured |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109771412A true CN109771412A (en) | 2019-05-21 |
Family
ID=66497909
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811630908.5A Pending CN109771412A (en) | 2018-12-29 | 2018-12-29 | The drug and rat model construction method of reangiostenosis after mitigation balloon injured |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109771412A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115531621A (en) * | 2022-10-09 | 2022-12-30 | 中南大学湘雅二医院 | Pharmaceutical composition containing glycyrrhizic acid for coronary drug eluting stent and controlled release system thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1517086A (en) * | 2003-01-17 | 2004-08-04 | 上海凯曼生物科技有限公司 | Medical use of poly hydroxy flavone derivatives |
| CN101322700A (en) * | 2007-06-13 | 2008-12-17 | 中国科学院生物物理研究所 | Applications of naringenin and naringin as signal pathway inhibitor of transforming growth factor-beta 1 |
| CN102302483A (en) * | 2011-07-08 | 2012-01-04 | 中国科学院生物物理研究所 | Application of flavonoid small molecule medicine in anti-inflammation and associated diseases |
| CN103340849A (en) * | 2013-06-27 | 2013-10-09 | 北京大学 | Application of naringenin in preparing medicament for preventing and/or treating abdominal aortic aneurysm |
| CN105596324A (en) * | 2015-12-21 | 2016-05-25 | 郑金刚 | Application of naringenin to preparation of drugs for preventing and/or treating aortic dissection |
-
2018
- 2018-12-29 CN CN201811630908.5A patent/CN109771412A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1517086A (en) * | 2003-01-17 | 2004-08-04 | 上海凯曼生物科技有限公司 | Medical use of poly hydroxy flavone derivatives |
| CN101322700A (en) * | 2007-06-13 | 2008-12-17 | 中国科学院生物物理研究所 | Applications of naringenin and naringin as signal pathway inhibitor of transforming growth factor-beta 1 |
| CN102302483A (en) * | 2011-07-08 | 2012-01-04 | 中国科学院生物物理研究所 | Application of flavonoid small molecule medicine in anti-inflammation and associated diseases |
| CN103340849A (en) * | 2013-06-27 | 2013-10-09 | 北京大学 | Application of naringenin in preparing medicament for preventing and/or treating abdominal aortic aneurysm |
| CN105596324A (en) * | 2015-12-21 | 2016-05-25 | 郑金刚 | Application of naringenin to preparation of drugs for preventing and/or treating aortic dissection |
Non-Patent Citations (3)
| Title |
|---|
| CHANGWU XU ET AL: "Naringenin Inhibits Angiotensin II-Induced Vascular Smooth Muscle Cells Proliferation and Migration and Decreases Neointimal Hyperplasia in Balloon Injured Rat Carotid Arteries through Suppressing Oxidative Stress", 《BIOL. PHARM. BULL》 * |
| HUANG BO ET AL: "Naringenin attenuates carotid restenosis in rats after balloon injury via RIP1-RIP3-MLKL signaling pathway", 《首届东方药理论坛暨2018年全国心脑血管药理学术会议、上海市药理学会第十九届学术年会》 * |
| NARINGENIN INHIBITS NEOINTIMAL HYPERPLASIA FOLLOWING ARTERIAL RE: "Naringenin Inhibits Neointimal Hyperplasia Following Arterial Reconstruction With Interpositional Vein Graft", 《ANNALS OF PLASTIC SURGERY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115531621A (en) * | 2022-10-09 | 2022-12-30 | 中南大学湘雅二医院 | Pharmaceutical composition containing glycyrrhizic acid for coronary drug eluting stent and controlled release system thereof |
| CN115531621B (en) * | 2022-10-09 | 2023-06-27 | 中南大学湘雅二医院 | Pharmaceutical composition containing glycyrrhizic acid for coronary artery drug eluting stent and controlled release system thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cybulsky | Endoplasmic reticulum stress, the unfolded protein response and autophagy in kidney diseases | |
| Zhang et al. | SQSTM1-dependent autophagic degradation of PKM2 inhibits the production of mature IL1B/IL-1β and contributes to LIPUS-mediated anti-inflammatory effect | |
| Tarabra et al. | Effect of the monocyte chemoattractant protein-1/CC chemokine receptor 2 system on nephrin expression in streptozotocin-treated mice and human cultured podocytes | |
| Kawaguchi et al. | Prior starvation mitigates acute doxorubicin cardiotoxicity through restoration of autophagy in affected cardiomyocytes | |
| Liu et al. | Genetic or pharmacologic blockade of EGFR inhibits renal fibrosis | |
| Barile et al. | The RAGE axis in early diabetic retinopathy | |
| Strupler et al. | Second harmonic microscopy to quantify renal interstitial fibrosis and arterial remodeling | |
| Ding et al. | Linking of autophagy to ubiquitin-proteasome system is important for the regulation of endoplasmic reticulum stress and cell viability | |
| Steinbeck et al. | Store-operated calcium entry modulates neuronal network activity in a model of chronic epilepsy | |
| Li et al. | Rictor/mTORC2 protects against cisplatin-induced tubular cell death and acute kidney injury | |
| Miller et al. | Pronephric tubulogenesis requires Daam1-mediated planar cell polarity signaling | |
| Ozawa et al. | A selective cyclooxygenase-2 inhibitor suppresses the growth of endometriosis xenografts via antiangiogenic activity in severe combined immunodeficiency mice | |
| Lehmann et al. | The aryl hydrocarbon receptor ligand ITE inhibits TGFβ1-induced human myofibroblast differentiation | |
| Xu et al. | Endocannabinoids exert CB1 receptor-mediated neuroprotective effects in models of neuronal damage induced by HIV-1 Tat protein | |
| Ahmet et al. | Long-term low dose dietary resveratrol supplement reduces cardiovascular structural and functional deterioration in chronic heart failure in rats | |
| Prilloff et al. | Two faces of calcium activation after optic nerve trauma: life or death of retinal ganglion cells in vivo depends on calcium dynamics | |
| Lu et al. | Cold stress accentuates pressure overload-induced cardiac hypertrophy and contractile dysfunction: role of TRPV1/AMPK-mediated autophagy | |
| Wang et al. | Quercetin attenuates diabetic neuropathic pain by inhibiting mTOR/p70S6K pathway-mediated changes of synaptic morphology and synaptic protein levels in spinal dorsal horn of db/db mice | |
| Zhang et al. | Mitochondrial aldehyde dehydrogenase obliterates endoplasmic reticulum stress-induced cardiac contractile dysfunction via correction of autophagy | |
| Yamaguchi et al. | Time-dependent expression of renal vaso-regulatory molecules in LPS-induced endotoxemia in rat | |
| Wu et al. | Neuroprotective effect of upregulated sonic Hedgehog in retinal ganglion cells following chronic ocular hypertension | |
| Li et al. | Aggravation of acute kidney injury by mPGES-2 down regulation is associated with autophagy inhibition and enhanced apoptosis | |
| Gross et al. | Renal damage in the SHR/N-cp type 2 diabetes model: comparison of an angiotensin-converting enzyme inhibitor and endothelin receptor blocker | |
| Yang et al. | CD74 knockout attenuates alcohol intake-induced cardiac dysfunction through AMPK-Skp2-mediated regulation of autophagy | |
| Liu et al. | Roles of Na+/H+ exchanger type 1 and intracellular pH in angiotensin II-induced reactive oxygen species generation and podocyte apoptosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190521 |