CN109763174A - A kind of construction method in deaf-related gene library and application - Google Patents

Abstract

The present invention provides a kind of construction method in deaf-related gene library, for each coded sequence of deaf related genes, from 5 ' toward 3 ' directions, probe sequence is designed by sequence reverse complemental principle, in the jointing of each probe sequence, using oligonucleotides situ synthesis techniques, the extensive synthesis of oligonucleotides is carried out on chip；It elutes the oligonucleotides on chip to form oligonucleotide mixture with ammonium hydroxide；By the method for PCR, the primer of biotin labeling is had using 5 ' ends, forms the deaf related genes DNA probe library with biotin labeling.The present invention realizes the high flux examination method to deaf relevant known site, relatively individually carry out the detection of site screening and full-length genome or the sequencing of full exon more rapidly, it is economical, easy, and it is low to equipment and environmental requirement, conducive to promotion and application, screening and preventive inspection suitable for deaf correlated crowd.It can be in the application in the SNP site of detection mitochondrial DNA.

Description

A kind of construction method in deaf-related gene library and application

Technical field

The invention belongs to life sciences and field of biotechnology, are related to a kind of construction method in deaf-related gene library, And the application of the SNP site using this method complete detection mitochondrial DNA.

Background technique

Deafness is to lead to the common disease of verbal communication obstacle, seriously affects the physical and mental health and quality of life of people. The Second China National Sample Survey on Disability is shown within 2006, the existing hearing speech disabilities population about 27,800,000 in China, wherein 7 years old or less deaf Mute children just have 1 deaf youngster up to 800,000 people in every 700-1000 newborn.Deafness can be divided into non-syndromic cleft lip and palate and comprehensive Simulator sickness type is deaf, wherein about 70% patient is non-syndromic cleft lip and palate, that is, is showed only as the clinical symptoms of single dysaudia； And syndromic deafness is in addition to dysaudia, often with other abnormal clinical symptoms.Environmental factor and inherent cause can draw Play deafness.Wherein, the deafness patient of 20-30% has the medication history of aminoglycosides antibiotics, such as gentamicin, streptomysin, card That mycin and neomycin etc.；Deafness patient more than 50% has hereditary basis or inheritance susceptible constitution, shows as autosome Dominant inheritance, autosomal recessive inheritance, X linkage inheritance and matrilinear inheritance.With the development of high throughput sequencing technologies and mature, People's genome sequencing has become the important tool of deaf related genes mutation research and diagnosis.It is surveyed by full-length genome Ordered pair tested sample carries out genome-wide screening, it can be achieved that omitting gene mutation zero, to become deaf related genes The effective tool of mutation research and diagnosis.

Since the size of human genome is about 3Gb, carry out that genome sequencing is a total of about to need 90Gb sequencing data to it. Huge data volume sequencing cost high caused by requiring causes genome sequencing to be applied to deaf gene diagnosis and is limited System.Genome sequencing and the sequencing of full exon need to generate a large amount of sequencing data amount, and sequencing cost is high, therefore depth is sequenced It can not be too deep.For checking gene mutation, it is desirable to realize zero omission that mutation checks, genome sequencing is difficult to really Take on this.Especially for all mutation occurred on the hundreds of genes of one-time detection, high depth sequencing is just able to achieve to prominent Become the accuracy of detection.

Therefore, a cheap, the high gene mutation inspection product of accuracy, especially for deaf gene is developed The diagnostic products of mutation with significant importance.

Summary of the invention

The purpose of the present invention is disadvantages present in the method for the deaf relevant target gene of detection at present, provide one The construction method in kind of deaf-related gene library, be it is a kind of have the characteristics that quickly, high throughput, be preferably conducive to it is efficient, quick, The construction method in the deaf relevant destination region DNA total order library of convenient, economic progress.The method of the present invention, which can become, to be carried out A kind of kit construction method of high-flux sequence.

The present invention relates to a kind of methods for preparing the deaf relevant DNA probe library of gene, are mainly beaten by complete genome DNA It is reacted after reaction system, probe hybrid system, PCR before system have no progeny plus A tail, connector interfaces system, purification system, PCR 6 components such as system are constituted, and are realized by following steps:

(1) it is directed to the coded sequence of the gene, from 5 ' toward 3 ' directions, according to the principle of sequence reverse complemental, from first A base starts the probe sequence that design length is 90bp, and there is overlapping between every two adjacent probe sequence, described Overlapping is the 1/2 or 2/3 of the probe length between every two adjacent probe sequence, amounts to 246 genes；

(2) at 5 ' ends of each probe sequence and 3 ' ends, the sequence as shown in SEQ:NO.1 and SEQ:NO.2, shape are added respectively Joint sequence is had at both ends；

(3) oligonucleotides situ synthesis techniques are used, the above-mentioned probe of synthesis on a large scale of oligonucleotides is carried out on chip Sequence, the oligonucleotides elution on chip is following, form oligonucleotide mixture；

(4) method connected by multiplex PCR connector has the forward primer of biotin labeling using 5 ' ends TTAGATAGGTGTGTAGGCGC (SEQ:NO.3) and reverse primer TAAGGTGCGTACTAGCTGAC (SEQ:NO.4), to few core Thuja acid mixture is expanded, and the gene DNA Probe Library with biotin labeling is formed.

The present invention is to the connector probe for having specimen discerning sequence, using oligonucleotides situ synthesis techniques, on chip The above-mentioned probe sequence of synthesis on a large scale for carrying out oligonucleotides, the oligonucleotides on chip is eluted, and forms oligonucleotides Mixture.

Gene of the present invention is selected from shown in table 1 deafness related genes 246, such as all bases in table 1 Cause.

The length of probe sequence of the present invention is 90bp, and the probe exists between every two adjacent probe sequence The overlapping of 60bp or 80bp amounts to 246 genes.

Gene of the present invention is selected from the related targeted capture Disease-causing gene of deafness shown in table 3, such as all in table 3 Gene.

It is a further object to provide core of the constructed library approach in complete detection deafness associated nuclear genes Application in nucleotide polymorphism site, is realized by following steps:

1) refer to genome HG19 according to the mankind, in conjunction with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand database obtains all coded sequences of deaf related genes in 2 table 1 of embodiment；

2) genomic DNA for extracting the subject, is interrupted to the range of 200-300bp；

3) it is directed to each coded sequence, is opened according to the principle of sequence reverse complemental from first base from 5 ' toward 3 ' directions Beginning design length is the probe sequence of 90bp, and there are the weights of 60bp or 80bp between every two adjacent probe sequence It is folded；

4) at 5 ' ends of each probe sequence and 3 ' ends, sequence and sequencing identification sequence acceptor are added respectively, forms both ends No. 5-100 of 96 articles of sequence tables of probe sequence with same sequence,

5) oligonucleotides situ synthesis techniques are used, the above-mentioned probe sequence of synthesis on a large scale of oligonucleotides is carried out on chip Sequence in column list；

6) by the method for PCR, the forward primer TTAGATAGGTGTGTAGGCGC of biotin labeling is had using 5 ' ends With 5 ' ends with the reverse primer TAAGGTGCGTACTAGCTGAC equally marked, oligonucleotide mixture is expanded, shape At the deaf related genes DNA probe library with biotin labeling.

Reaction system is as follows:

Reaction condition is as follows:

7) amplified production obtained to step 4) carries out upper machine sequencing, obtains the sequencing data of the gene；

8) sequencing data of step 5) is compared with the mankind with reference to genome, to obtain different from reference to genome Single nucleotide polymorphism, insertion or missing, i.e., detected gene mutation.

Method of the invention has the advantages that relative to genome sequencing, required sequencing is greatly saved in (1) Data volume；(2) disposably all mutation of detection disease related genes, realize zero omission diagnosed to disease gene, are The treatment and intervention of disease provide safeguard；(3) sequencing of high depth is realized and is detected to the high accuracy of gene mutation；(4) cost All mutation that are low, occurring on the hundreds of genes of one-time detection；MtDNA mutation inspection is carried out using kit provided by the invention It surveys, cost is lower compared with other detection methods；Testing process is easy, quick, and as a result interpretation is intuitive；(5) it is suitble in general hospital, divides Sub- biology laboratory is carried out, relevant convenient for being especially low developed area implementation hereditary optic neuropathy in China The extensive screening and preventive inspection of mtDNA mutation.(6) accuracy to abrupt climatic change is realized in high depth sequencing.

Detailed description of the invention

Fig. 1 is deaf gene targeted capture DNA library building schematic diagram of the invention.

Specific embodiment

The present invention will be further explained below with reference to the attached drawings and specific examples, so that those skilled in the art can be with It better understands the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.

A kind of construction method in the deaf-related gene library of embodiment 1

The present invention mainly interrupted by complete genome DNA after plus A tail system, connector interfaces system, purification system, PCR 6 components such as reaction system are constituted after preceding reaction system, probe hybrid system, PCR:

1) it is directed to the coded sequence of the gene, from 5 ' toward 3 ' directions, according to the principle of sequence reverse complemental, from first Base starts the probe sequence that design length is 90bp, and there is overlapping between every two adjacent probe sequence, amounts to 246 A gene；

2) each probe sequence 5 ' end and 3 ' end, respectively add CAAGCAGAAGACGGCATACGAGAT and GTGACTGGAGTTCAGACGTG sequence and specific specimen discerning sequence, form both ends and have joint sequence；

3) oligonucleotides situ synthesis techniques are used, the above-mentioned probe sequence of synthesis on a large scale of oligonucleotides is carried out on chip Column, the oligonucleotides elution on chip is following, form oligonucleotide mixture.

4) by the method for PCR, the forward primer of biotin labeling is had using 5 ' ends TTAGATAGGTGTGTAGGCGC and reverse primer TAAGGTGCGTACTAGCTGAC, expands oligonucleotide mixture, Form the gene DNA Probe Library with biotin labeling.

Embodiment 2

1. the kit preparation of deaf related genes

Genome HG19 is referred to according to the mankind, in conjunction with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand Database obtains all coded sequences of deaf related genes in following table 1；According to schematic diagram system shown in FIG. 1 Standby deaf related genes DNA probe library:

The first step, genomic DNA interrupt

(1) genomic DNA is transferred in the micro- sample centrifuge tube of 0.6ml according to the above system, is mixed well, after of short duration centrifugation It is placed in stand-by on ice；

(2) ultrasound being opened in advance and interrupting instrument, after SAPMAC method instrument temperature is down to 4 DEG C, setting parameter opens 30s, and closing 30s is 1 A circulation, every 10cycles are a wheel, carry out 3 wheels altogether, sample are placed on oscillator after every wheel and are mixed well, it is of short duration from Next round is carried out after the heart interrupts (mixing is more abundant, interrupts sample fragment size and more concentrates)；

(3) it takes 1 μ l sample to carry out segment detection using Nucleic acid quality control instrument, normally interrupts rear sample detection main peak about In 150bp-200bp；

Second step, end are repaired, 3 ' ends add " A "

(1) sample after interrupting is transferred in PCR pipe completely, (this operation need to be enterprising in ice chest for configuration reaction system Row): 35 μ l, 10 × ERA buffer of DNA sample, 5 μ l, 5 × ERA- tail enzyme, 10 μ l amounts to 50 μ l；

(2) it mixes using pipettor piping and druming and (avoids acutely shaking and mix), PCR pipe is put back to spare on ice chest；Run PCR Program, setting PCR instrument parameter are as follows: 85 DEG C of hot lid, 4 DEG C of 1min, 20 DEG C of 30min, 65 DEG C of 30min, 4 DEG C of preservations；

Third step, connector connection, purifying

(1) it in the PCR pipe of above-mentioned step2 reaction, configures reaction system (this operation need to carry out on ice chest): coming from The 50 μ l of sample that step2 reaction terminates, 5 μ l of connector, deionized water 15 μ l, 5 × connection 20 μ l of buffer, 10 μ l of ligase, always Count 100 μ l；

(2) it gently inhales and plays mixing 6 times, avoid generating bubble, then of short duration centrifugation；

(3) PCR instrument program (it is required that covering without heat) is run, setting PCR instrument parameter is as follows: not needing hot lid, 20 DEG C of for 15min, 4 DEG C of preservations；

(4) magnetic bead is taken to room temperature, concussion mixes spare；

(5) it in the complete PCR pipe of upper step intermediate range sort run, is tested according to the purifying magnetic bead of 0.8 × volume, by following Table configures reaction system, and: 100 μ l of sample, the 80 μ l of magnetic bead terminated from the reaction of upper step amounts to 180 μ l

(6) it gently inhales and plays mixing 6 times, be stored at room temperature and be incubated for 5-15 points, PCR pipe, which is placed in 3min on magnetic frame, keeps solution clear Clearly；

(7) supernatant is removed, PCR pipe continues to be placed on magnetic frame, 200 μ l, 80% ethanol solution is added into PCR pipe, Stand 30s；

(8) supernatant is removed, then 200 μ l, 80% ethanol solution is added into PCR pipe, thoroughly removes supernatant after standing 30s (it is recommended that removing bottom residual ethanol solution using 10 μ l pipettors)；

(9) it is stored at room temperature 3-5min, residual ethanol is made thoroughly to volatilize；

(10) deionized water of 22 μ l is added, PCR pipe is removed from magnetic frame, gently inhales and beats resuspension magnetic bead, avoid generating Bubble is stored at room temperature 2min；

(11) PCR pipe is placed in 2min on magnetic frame clarifies solution；

(12) 20 μ l supernatants are drawn with pipettor, is transferred in new PCR pipe and (is placed on ice chest), in reaction tube subscript Remember sample number, prepares to react in next step；

4th step, the reaction of first time PCR, purifying

(1) PCR mixture, primer TPE1.0 and TPE2.0 reagent are taken out in the kit saved in advance from 20 DEG C of ﹣, be placed in It is dissolved on ice chest, mixing is placed on stand-by on ice；

(2) 20 μ l, PCR mixture of sample, the 25 2.5 μ l of μ l, TPE1.0 (10 μM) terminated from previous step reaction is fetched, 2.5 μ l of TPE2.0 connector (10 μM) amounts to 50 μ l；

(3) mixing is gently blown and beaten using pipettor, then of short duration centrifugation；Sample is placed in PCR instrument, PCR program is started, As follows: 105 DEG C of hot lid, 98 DEG C of 2min, 98 DEG C of 20s, 60 DEG C of 30s 16 are recycled, 72 DEG C of for30s, 72 DEG C of for 1min, and 4 DEG C save

(4) 50 μ l magnetic beads are added into the PCR pipe after reaction, is blown and beaten and is mixed with pipettor, avoid generating bubble；

(5) it is incubated at room temperature 5-15min, PCR pipe, which is placed in 3min on magnetic frame, clarifies solution；

(6) supernatant is removed, PCR pipe continues to be placed on magnetic frame, 200 μ l, 80% ethanol solution is added into PCR pipe, Stand 30s；

(7) supernatant is removed, then 200 μ l, 80% ethanol solution is added into PCR pipe, thoroughly removes supernatant after standing 30s (it is recommended that removing bottom residual ethanol solution using 10 μ l pipettors)；

(8) it is stored at room temperature 5min, residual ethanol is made thoroughly to volatilize；

(9) deionized water of 30 μ l is added, centrifuge tube is removed from magnetic frame, using pipettor, gently inhales and beats resuspension magnetic Pearl；

(10) it is stored at room temperature 2min, 200 μ l PCR pipes, which are placed in 2min on magnetic frame, clarifies solution；

(11) supernatant is transferred in 200 new μ l PCR pipes with pipettor and (is placed on ice chest), in reaction tube subscript Ji Hao catalogue number(Cat.No.) prepares to react in next step；

(12) it takes 1 μ l sample to carry out library concentration measurement using nucleic acids instrument, records library concentration, as downstream carries out liquid It mutually captures, then needs library concentration > 25ng/ μ l；

(13) 1 μ l sample is taken to carry out fragment length measurement using Nucleic acid quality controller, library length is about in 270bp- Between 320bp；

5th step, sample, probe hybridization

(1) in the capture kit saved in advance from 20 DEG C of ﹣, hybridizing reagent shown in following table is taken out, is placed in molten on ice chest Solution, dissolution mixing is placed on ice or 4 DEG C stand-by；

(2) carry out according to following system configurations reaction system and test, sample library and each hybridization solution are mixed, be labeled as B Pipe, is prepared according to following corresponding system: sample library (sample terminated from step 6 reaction) 750ng, hybridization solution 1 μ l of 5 μ l, hybridization solution-A0 hybridizes 5 μ l of connector；

(3) hybridization buffer is placed in room temperature to melt, precipitating is had after melting and is occurred, it is mixed that mixing is placed on 65 DEG C of constant temperature Preheating in even instrument, (no precipitating and muddy object) takes 20 μ l hybridization buffers to be placed in 200 new μ l PCR pipes after being completely dissolved, and covers Good pipe lid is placed in 65 DEG C of constant temperature blending instruments and is incubated for for use, manages labeled as A；

(4) it takes 5 μ l RNase Block and 2 μ l probes to be placed in 200 μ l PCR pipes, gently inhales and play mixing, of short duration centrifugation It is placed on ice or 4 DEG C stand-by, managed labeled as C.

(5) B pipe is put into vacuum concentration centrifuge, opens PCR pipe lid, start centrifuge, open vacuum pump switch, started Concentration；

(6) B pipe is concentrated into volume less than 10 μ l, complements to 10 μ l with deionized water later, gently inhaled and play mixing, it is of short duration Centrifugation is placed on stand-by on ice；

(7) setting PCR instrument parameter is as follows: 105 DEG C of hot lid, 95 DEG C of 5min, 65 DEG C of preservations

(8) when PCR instrument temperature is down to 65 DEG C, A pipe is placed in PCR instrument and is incubated for, cover PCR instrument heat lid；

(9) after 5min, C pipe is placed on PCR and is incubated for, covered PCR instrument heat lid and (note: keeping A pipe and B pipe in PCR instrument It is motionless)；

(10) after 2min, pipettor is adjusted to 13 μ l, is moved in C pipe from 13 μ l hybridization solutions are drawn in A pipe, whole B is drawn Sample moves in C pipe in pipe, gently inhales and makes a call to 10 times, mixes well, and avoids generating a large amount of bubbles, seal pipe lid covers PCR instrument heat Lid, 65 DEG C of overnight incubations (16-24h)；

6th step, capture magnetic bead balance

(1) capture magnetic bead takes out from 4 DEG C, and the concussion that is vortexed is resuspended；

(2) 50 μ l magnetic beads are taken to be placed in new PCR pipe, being placed in 1min on magnetic frame clarifies solution, removes supernatant；

(3) PCR pipe is removed from magnetic frame, 200 μ l combination buffers of addition gently inhale to beat to be mixed for several times, and magnetic bead is resuspended；

(4) 1min on magnetic frame is set, supernatant is removed；

(5) it repeats step 3-4 twice, cleans magnetic bead 3 times altogether；

(6) it removes PCR pipe from magnetic frame, 200 μ l combination buffers is added and gently inhale that make a call to 6 resuspension magnetic beads stand-by.

7th step, capture target area DNA library

(1) keep hybrid product in PCR instrument, the 200 μ l capture magnetic bead after step 6 in step 8 is resuspended is added to miscellaneous It hands in product, plays 6 mixings with pipettor suction, be placed in room temperature combination 30min on rotation blending instrument；

(2) PCR pipe is placed in 2min on magnetic frame clarifies solution, removes supernatant；

(3) eluent 1 of 200 μ l is added into hybrid product, gently inhales and plays 6 mixings, is placed in rotation blending instrument supernatant 15min is washed, then of short duration centrifugation, PCR pipe is put in 2min on magnetic frame, clarifies solution, removes supernatant；

(4) eluent 2 of 65 DEG C of preheatings of 200 μ l is added, gently inhales and plays 6 mixings, be placed on constant temperature oscillation blending instrument 65 DEG C of incubation 10min, 800 turns/min are cleaned；

(5) PCR pipe is put in 2min on magnetic frame, removes supernatant by of short duration centrifugation.It is cleaned 2 times using eluent 2, amounts to 3 It is secondary.Last time thoroughly removes eluent 2 (can be removed and be remained with 10 μ l pipettors)；

(6) it keeps sample on magnetic frame, 200 μ l, 80% ethyl alcohol is added into PCR pipe, thoroughly remove second after standing 30s Alcoholic solution (can be removed with 10 μ l pipettors and be remained), and room temperature is dried；

(7) 30 μ l deionized waters are added to PCR pipe, PCR pipe is removed from magnetic frame, gently suction is made a call to 6 resuspension magnetic beads and waited for With.

8th step, second PCR reaction, purifying

(1) PCR buffer, PCR primer (25 μM, for ILM) reagent are taken out in the kit saved in advance from -20 DEG C, Placement is dissolved on ice, and dissolution, which mixes, to be placed on ice for use.It is used immediately after taking out PCR enzyme brief centrifugation.

(2) it needs to be enriched with DNA library after capturing, reaction system is prepared according to following table: from the reaction knot of step 9 30 μ l, PCR buffer of sample 18 μ l, Post PCR primer (25 μM, for ILM) 1 μ l, Post PCR enzyme, the 1 μ l of beam amounts to 50 μl；

(3) pipettor is adjusted to 40 μ l, gently inhales and play mixing 6 times, is placed in PCR instrument immediately after.

(4) PCR instrument program: 105 DEG C of hot lid, 95 DEG C of 4min, 98 DEG C of 20s are run, 60 DEG C of 30s 14 are recycled, and 72 DEG C 30s, 72 DEG C of 5min, 4 DEG C of preservations；

(5) 55 μ l magnetic beads are added to sample after PCR terminates, is gently inhaled with pipettor and plays 6 mixings；

(6) it is incubated at room temperature 5min, PCR pipe, which is placed in 3min on magnetic frame, clarifies solution；

(7) supernatant is removed, PCR pipe continues to be placed on magnetic frame, and 200 μ l, 80% dehydrated alcohol is added, and stands 30s；

(8) supernatant is removed, then 200 μ l, 80% dehydrated alcohol is added into PCR pipe, thoroughly removes supernatant after standing 30s (bottom can be removed with 10 μ l pipettors and remain alcohol)；

(9) it is placed at room temperature for 5min, so that residual ethanol is thoroughly volatilized；

(10) 25 μ l deionized waters are added, PCR pipe is taken down from magnetic frame, gently piping and druming, which mixes, is resuspended magnetic bead, and room temperature is put Set 2min；PCR pipe is placed in 2min on magnetic frame；

(11) 23 μ l supernatants are inhaled with pipettor and be transferred to 1.5ml centrifuge tube, mark sample message；

(12) it takes 1 library μ l to be quantified using nucleic acids instrument, records library concentration, library concentration is about in 1-10ng/ μ l；

(13) 1 μ l sample is taken to carry out fragment length measurement using Nucleic acid quality controller, library length is about in 270bp- Between 320bp；

(14) it is sequenced using high-flux sequence platform.

The deaf related 246 target gene lists (Gene Name comes from http://www.genenames.org/) of table 1:

2. the kit screening mutation of deaf related genes

1) the 1 μ g of genomic DNA of people experimenter is taken to interrupt using Ultrasonic Cell Disruptor to the range of 200-300bp；

2) method for using solution hybridization, carries out the preparation in DNA small fragment library；

3) DNA small fragment library and the deaf related genes DNA probe library of above-mentioned preparation are subjected to solution hybridization, Carry out the capture of deaf related genes；

4) PCR is used, the product after capture is expanded, sequencing library is obtained；

Reaction system is as follows:

Reagent name	Volume
		Capture product	10μl
PE PCR primer 1.0(25μM)	2.5μl
		PE PCR primer 2.0(25μM)	2.5μl
Phusion High-Fidelity 2×PCR Master Mix	25μl
		Ultrapure water	10ul

Reaction condition is as follows:

5) Illumina high-flux sequence instrument is used, upper machine sequencing is carried out to sequencing library, obtains deaf associated morbidity base The sequencing data of cause；

6) BWA MEM software is utilized, sequencing data is compared with to the mankind with reference to genome HG19, parameter used Are as follows: bwa mem-M-k 40-t 8-R "@RG tID:Hiseq tPL:Illumina tSM:sample ", to obtain and refer to The different single nucleotide polymorphism of genome, insertion or missing, i.e. detected gene mutation.

3. target area capture effect is assessed

1) using the size of the samtools stats tool statistical data in samtools-1.2 software, comparison rate, again Multiple rate, mass value, then again with the samtools depth tool in software, the sequencing for calculating each position in target area is deep Degree；

2) with the data volume to target area is compared divided by total amount of data, capture rate is obtained；

3) according to the sequencing depth of each position in target area, respectively statistics sequencing depth >=1, >=4, >=10 and >=20 Base quantity, then by the base quantity divided by the total bases amount of target area, thus obtain 1 × coverage rate, 4 × coverage rate, The parameter of 10 × coverage rate and 20 × coverage rate.

4. genome sequencing and the assessment of target area capture effect

Genome sequencing is carried out to sample respectively using identical laboratory facilities, technical conditions and target area capture is surveyed Sequence, to original data volume (Mb, reads), clean data volume (Mb, reads), comparison rate, target area size, target area institute The base quantity that measures, target area coverage, valid data amount (Mb), compare the valid data amount (Mb) to target area, Capture rate data user rate, target area mean depth, depth 4 × target area ratio, depth 10 × target area Ratio, depth 20 × target area ratio, repetitive rate interpretation of result, such as the following table 2 is compared.

Table 2: the kit screening of deaf related genes and genome sequencing acquired results compare

From the above table 2 as can be seen that genome sequencing is compared with the kit screening of deaf related genes, 1) it is complete Most data (99.98%) of gene order-checking be it is otiose, data user rate is only 0.02%；2) target area has Data volume is imitated compared to also smaller, the mean depth of target area is caused there was only 34.46 layers, in contrast, deaf associated morbidity The mean depth of the kit screening of gene is up to 368.04 layers；3) genome sequencing depth be 20 × target area ratio Example is also smaller, and only 88.73%, and the kit screening of deaf related genes is 99.60%.

Due to the gene in table 1, from the perspective of its DNA sequence dna base composition, base composition is not passed through any Selection and screening, be applicable in gene is not specially required with kit with the inventive method.From inventor to table 1 In from the point of view of each gene for listing investigates respectively, it is all obvious excellent using the detection of method and kit of the invention to gene mutation In the method for full genome sequencing.

It is not intended, however, that rigidly adhering in any theory, inventor is further in a similar manner for each test cdna point The comparison result in table 2 is analysed, the method and kit in embodiment (select the probe length for 114, the every two phase The case where overlapping is the 2/3 of the probe length between adjacent probe sequence) to the abrupt climatic change of the gene in such as the following table 3 and Speech is detected relative to full-length genome, has the more excellent detection effect (kit of deaf related genes than remaining gene Screening depth be 20 × target area ratio be 99.93%).This may be 114bp with the length of the probe sequence selected, Overlapping of the probe between every two adjacent probe sequence there are 76bp is related, is 110- by the length of probe sequence Between 130bp, overlapping of the probe between every two adjacent probe sequence be adjusted, the gene mutation for each gene Detection can find the existing overlapping between every two adjacent probe sequence of the more preferably length of probe sequence and probe.

Although having been combined preferred embodiment, invention has been described, it is to be understood that protection scope of the present invention is simultaneously It is not limited to embodiment as described herein.In conjunction with the explanation and practice of the invention disclosed here, other implementations of the invention Example all will be readily apparent and understand for those skilled in the art.Illustrate and embodiment is regarded only as being exemplary, this hair Bright true scope and purport is defined in the claims.

Sequence table

<110>Zhejiang University

<120>a kind of construction method in deaf-related gene library and application

<160> 100

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213>people (homo sapiens)

<400> 1

caagcagaag acggcatacg agat 24

<210> 2

<211> 20

<212> DNA

<213>people (homo sapiens)

<400> 2

gtgactggag ttcagacgtg 20

<210> 3

<211> 20

<212> DNA

<213>people (homo sapiens)

<400> 3

ttagataggt gtgtaggcgc 20

<210> 4

<211> 20

<212> DNA

<213>people (homo sapiens)

<400> 4

taaggtgcgt actagctgac 20

<210> 5

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 5

gtcatgca 8

<210> 6

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 6

cgatagca 8

<210> 7

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 7

tgcttgtg 8

<210> 8

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 8

atcagcga 8

<210> 9

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 9

acaaagcg 8

<210> 10

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 10

ttcatcgg 8

<210> 11

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 11

tgtggtca 8

<210> 12

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 12

atggcttc 8

<210> 13

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 13

caccagaa 8

<210> 14

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 14

gttttcgg 8

<210> 15

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 15

ccttttcg 8

<210> 16

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 16

agctggtt 8

<210> 17

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 17

aaatcggc 8

<210> 18

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 18

gttaaggg 8

<210> 19

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 19

taggtagg 8

<210> 20

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 20

gctgaaac 8

<210> 21

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 21

gcacaaac 8

<210> 22

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 22

ctcttgca 8

<210> 23

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 23

gcttacag 8

<210> 24

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 24

gaataggg 8

<210> 25

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 25

ttcggtca 8

<210> 26

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 26

gaaaaccg 8

<210> 27

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 27

acgagtga 8

<210> 28

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 28

gcgctttt 8

<210> 29

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 29

cacaacgt 8

<210> 30

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 30

ggacacta 8

<210> 31

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 31

gcggtaat 8

<210> 32

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 32

tgcctcaa 8

<210> 33

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 33

gtctacgt 8

<210> 34

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 34

aggtcttg 8

<210> 35

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 35

ctcgttct 8

<210> 36

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 36

ttgtccag 8

<210> 37

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 37

aacgcaga 8

<210> 38

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 38

gtgcatga 8

<210> 39

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 39

cgtacaga 8

<210> 40

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 40

tggaggta 8

<210> 41

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 41

agcttgga 8

<210> 42

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 42

aatacggc 8

<210> 43

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 43

ttagaggg 8

<210> 44

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 44

tgccagat 8

<210> 45

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 45

cgcatact 8

<210> 46

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 46

acggatgt 8

<210> 47

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 47

ctgtacga 8

<210> 48

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 48

gcagtatc 8

<210> 49

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 49

actctacc 8

<210> 50

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 50

tcccatac 8

<210> 51

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 51

attgctgc 8

<210> 52

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 52

ggtatcct 8

<210> 53

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 53

ctccagtt 8

<210> 54

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 54

ggaacttc 8

<210> 55

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 55

ggtatagg 8

<210> 56

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 56

cgtagttc 8

<210> 57

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 57

tgtggagt 8

<210> 58

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 58

tagtggtg 8

<210> 59

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 59

aatcctgg 8

<210> 60

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 60

tgcttcag 8

<210> 61

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 61

atagtcgg 8

<210> 62

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 62

ttcagagg 8

<210> 63

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 63

gttgcagt 8

<210> 64

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 64

ctgaagag 8

<210> 65

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 65

aactggac 8

<210> 66

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 66

agacacgt 8

<210> 67

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 67

tcacctga 8

<210> 68

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 68

tcgcaatc 8

<210> 69

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 69

aaccagac 8

<210> 70

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 70

aactccga 8

<210> 71

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 71

ctggctaa 8

<210> 72

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 72

gatgctac 8

<210> 73

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 73

ctagtctc 8

<210> 74

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 74

ctagcttc 8

<210> 75

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 75

ctaaggac 8

<210> 76

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 76

tggcctaa 8

<210> 77

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 77

gatcgtca 8

<210> 78

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 78

tcgagact 8

<210> 79

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 79

tcatcctg 8

<210> 80

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 80

tttcgacc 8

<210> 81

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 81

tgcgtaga 8

<210> 82

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 82

ttctccac 8

<210> 83

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 83

tggaagtc 8

<210> 84

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 84

atagcacc 8

<210> 85

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 85

gtagatgc 8

<210> 86

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 86

gcttccta 8

<210> 87

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 87

ccaaactc 8

<210> 88

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 88

atcgaagg 8

<210> 89

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 89

ccgtttgt 8

<210> 90

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 90

tacgagtc 8

<210> 91

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 91

tcaggtag 8

<210> 92

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 92

caacagag 8

<210> 93

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 93

gacaagtc 8

<210> 94

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 94

aaggacag 8

<210> 95

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 95

acttcctg 8

<210> 96

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 96

acagaacc 8

<210> 97

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 97

ccgtgtaa 8

<210> 98

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 98

agttcacc 8

<210> 99

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 99

cgtatctg 8

<210> 100

<211> 8

<212> DNA

<213>people (homo sapiens)

<400> 100

gatgtgca 8

Claims (8)

1. a kind of construction method in deaf-related gene library, which is characterized in that realized by following steps:

(1) it is directed to the coded sequence of the gene, from 5 ' toward 3 ' directions, according to the principle of sequence reverse complemental, from first alkali Base starts the probe sequence that design length is 90bp, and there is overlapping between every two adjacent probe sequence, and described every two Overlapping is the 1/2 or 2/3 of the probe length between a adjacent probe sequence, amounts to 246 genes；

(2) at 5 ' ends of each probe sequence and 3 ' ends, the sequence as shown in SEQ:NO.1 and SEQ:NO.2 is added respectively, forms two End has joint sequence；

(3) oligonucleotides situ synthesis techniques are used, the above-mentioned probe sequence of synthesis on a large scale of oligonucleotides is carried out on chip, Oligonucleotides on chip is eluted, oligonucleotide mixture is formed；

(4) method connected by multiplex PCR connector has the forward primer of biotin labeling using 5 ' ends TTAGATAGGTGTGTAGGCGC and reverse primer TAAGGTGCGTACTAGCTGAC, expands oligonucleotide mixture, Form the gene DNA Probe Library with biotin labeling.

2. a kind of construction method in deaf-related gene library according to claim 1, which is characterized in that in step (1) The length of the probe sequence is 90bp, and there are the weights of 60bp or 80bp between every two adjacent probe sequence for the probe It is folded.

3. a kind of construction method in deaf-related gene library according to claim 1, which is characterized in that in step (3) Use oligonucleotides situ synthesis techniques, on chip carry out oligonucleotides the above-mentioned probe sequence of synthesis on a large scale, utilize Ammonium hydroxide cuts down oligonucleotides from chip, and oligonucleotides is to be connected in a manner of covalent linkage on a semiconductor die, And ammonium hydroxide is cut down oligonucleotides by way of destroying chemical bond as weak base, and will not be too strong and broken because of alkalinity Bad oligonucleotides, to form oligonucleotide mixture.

4. a kind of construction method in deaf-related gene library according to claim 1, which is characterized in that in step (4) The label be water-soluble (vitamin) B biotin labeling.

5. a kind of construction method in deaf-related gene library according to claim 1 to 4, the gene is selected from power Benefit requires deaf-related gene shown in 246 target gene in 1 step (1).

6. the construction method in deaf-related gene library according to claim 1 to 4 is in complete detection mitochondrial DNA SNP site in application.

7. application according to claim 6, which is characterized in that realized by following steps:

1) genomic DNA for extracting the subject, is interrupted to the range of 200-300bp；

2) preparation in DNA small fragment library is carried out to the above-mentioned genomic DNA smashed；

3) the gene DNA Probe Library or kit of DNA small fragment library and claim 7 are hybridized, carries out gene Capture；

4) PCR is used, the product captured in step 3) is expanded, the product expanded；

5) amplified production obtained to step 4) carries out upper machine sequencing, obtains the sequencing data of the gene；

6) sequencing data of step 5) is compared with the mankind with reference to genome, to obtain the list different from genome is referred to Nucleotide polymorphisms, insertion or missing, i.e. detected gene mutation.

8. application according to claim 7, which is characterized in that the mankind described in step 6) are HG19 with reference to genome.