CN109762900A - Colorectal cancer marker and its application - Google Patents

Abstract

The present invention relates to genetic test fields, and in particular to a kind of colorectal cancer marker and its application.The marker includes SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.Primer pair, nucleic acid probe, chip and kit and its application are additionally provided simultaneously.The quick detection of colorectal cancer may be implemented in the marker provided through the invention.

Description

Colorectal cancer marker and its application

Technical field

The present invention relates to genetic test fields, and in particular to a kind of colorectal cancer marker and its application more particularly to one Kind colorectal cancer marker, primer pair, nucleic acid probe, chip, kit and its application.

Background technique

Colorectal cancer is one of most common malignant tumour of alimentary canal, in global range new cases be about 1,000,000/ Year, death toll about 500,000.Disease incidence is number three colorectal cancer (colorectal cancer, CRC) in all kinds of cancers, Lethality is number four, and nearly 55% morbidity case occurs in more developed country.In people of the age less than 40 years old incidence compared with It is low, but incidence also gradually increases with age.It has been generally acknowledged that the westernization of eating habit will increase CRC disease incidence, but The U.S. and other high-income countries' disease incidence but keep stablizing and even decline at present, thus it is speculated that with sigmoidoscopy and Sigmoidoscope Under polypectomy increase it is related.Colorectal cancer is also one of current most preventible tumour, medical field think and if Early discovery, intestinal cancer is the cancer most easily cured.

The diagnostic method of colorectal cancer mainly includes X-ray examination, enteroscopy and carcinomebryonic antigen inspection.Wherein, cancer embryo Antigen is little to the diagnostic value of early-stage cases, traumatic larger although enteroscopy accuracy is high.With human genome The completion of plan and the development of high throughput sequencing technologies, gene screening technology have become a kind of new diagnosis of colorectal carcinoma side Method has significant advantage in the early diagnosis of colorectal cancer.Therefore, it for the early diagnosis of colorectal cancer and screening, provides A kind of colorectal cancer marker, assists the early diagnosis of colorectal cancer, is of great significance.

Summary of the invention

The present invention is directed to solve at least some of the technical problems in related technologies.For this purpose, of the invention One purpose is to propose a kind of colorectal cancer tumor markers, primer pair, nucleic acid probe, chip, kit and its application.This The colorectal cancer tumor markers that invention provides can be used in early screening and the diagnosis of Patients with Colorectal Cancer.

The present invention is that the discovery as follows based on inventor is obtained:

Human body intestinal canal microorganism group contains the microorganism of enormous amount, they participate in food drug metabolism, human immunity It adjusts, plays an important role in keeping human health.There are lot of documents report Bacillus, Clostridium symbiosum and tool core shuttle Bacillus has very strong correlation with colorectal cancer, and the change of microorganism group ingredient can be used as one in the different phase of study of disease The new means tested for cancer diagnosis and outcome of kind: therefore this research is want through Bacillus, symbiosis in measurement enteron aisle The specific gene of clostridium and Fusobacterium nucleatum carries out early detection and intervenes in time to control come the generation to colorectal cancer with development It treats.

Bacillus, Clostridium symbiosum and the specific gene of Fusobacterium nucleatum are carried out in the crowd for having case-control Real-time fluorescence quantitative PCR (qPCR) detection, determines the amount of gene, analyzes and verify the probability of these predictive genes colorectal cancers. To develop the enteric microorganism gene detecting kit of colorectal cancer patients, it is early that fast and convenient colon cancer is provided for many people The effective measures of phase screening, diagnosis.To realize that early warning, diagnosis and the intervention of colorectal cancer provide foundation.

Specifically, the present invention provides the following technical scheme that

The first aspect of the present invention, the present invention provides a kind of colorectal cancer marker, the colorectal cancer marker packet The case where including SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, can reflect colorectal cancer by these markers.

The second aspect of the present invention, the present invention provides one group of primer pair, the primer pair being capable of specific amplification this hair Colorectal cancer marker described in bright first aspect.

In a preferred embodiment, the primer pair is SEQ ID NO:4~SEQ ID NO:9, wherein SEQ ID NO:4 The nucleic acid sequence of the adjacent number of every two is a pair in~SEQ ID NO:9.It, being capable of specific amplification by these primer pairs SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, so as to be used as the early diagnosis and detection of colorectal cancer.

In one embodiment of the invention, the primer pair SE SEQ ID NO:4 and SEQ ID NO:5 can be expanded Biomarker SEQ ID NO:1, the primer pair SE SEQ ID NO:6 and SEQ ID NO:7 can expand biomarker SEQ ID NO:2, the primer pair SE SEQ ID NO:8 and SEQ ID NO:9 can expand biomarker SEQ ID NO: 3.

The third aspect of the present invention, the present invention provides a kind of nucleic acid probe, the nucleic acid probe can specificity capture packet Include colorectal cancer marker described in first aspect present invention.Design colorectal cancer mark used in the nucleic acid capture probe present invention Will object can be realized the quick detection of colorectal cancer.

The fourth aspect of the present invention, the present invention provides a kind of chip, the chip includes described in third aspect present invention Nucleic acid probe, can be used for capturing colorectal cancer marker described in first aspect present invention, to detect colorectal cancer.

The fifth aspect of the present invention, the present invention provides a kind of kit, the kit includes for detecting the present invention The reagent of colorectal cancer marker described in first aspect.

In some embodiments of the invention, the kit includes at least one of: described in second aspect of the present invention Primer pair；Nucleic acid probe described in third aspect present invention；And/or chip described in fourth aspect present invention.

In a preferred embodiment of the invention, kit further includes internal control primer pair.

In a preferred embodiment, internal control primer is SEQ ID NO:10 and SEQ ID NO:11 to sequence.The reagent Box can be used for detecting colorectal cancer.

It is understood by one of ordinary skill in the art to be, purposes or method of the present invention related data obtained or result Research data can be provided for scientific research, and then be applied to scientific research.

Detailed description of the invention

Fig. 1 is heating power abundance figure of 30 candidate markers genes in Chongqing, Hong Kong, French crowd's queue.

Fig. 2 be Chongqing verifying crowd, Hong Kong crowd, French crowd's queue ROC curve figure.

Fig. 3 is Chongqing detection crowd, Hong Kong crowd, microorganism dendrogram in French crowd's queue.

Fig. 4 is amplification curve diagram of the T1P9 primer in 60 samples.

Fig. 5 is amplification curve diagram of the seq6:0-320 primer in 60 samples.

Fig. 6 is amplification curve diagram of the T1P26 primer in 60 samples.

Fig. 7 is schemed by the relative expression levels of primer amplification gene in 60 samples of T1P9.

Fig. 8 is schemed by the relative expression levels of primer amplification gene in 60 samples of seq6:0-320.

Fig. 9 is schemed by the relative expression levels of primer amplification gene in 60 samples of T1P26.

Figure 10 is 3 kinds of genes relative abundance disparity map in colorectal cancer sample and check sample.

Figure 11 comes from the ROC figure of Coprobacillus gene.

Figure 12 comes from the ROC figure of Coprobacillus and Clostridium symbiosum gene.

Specific embodiment

The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings, wherein from beginning to end Same or similar label indicates same or similar element or element with the same or similar functions.Below with reference to attached The embodiment of figure description is exemplary, it is intended to is used to explain the present invention, and is not considered as limiting the invention.

The technical problem to be solved by the present invention is to then utilize these knots by one group of new colorectal cancer marker of screening Rectum carcinoma marker is detected by the fecal microorganism flora DNA to Patients with Colorectal Cancer, to realize noninvasive low cost Early screening or diagnostic techniques.Such as it can be by high throughput sequencing technologies in the fecal microorganism flora DNA of person under test Nucleic acid be sequenced, to obtain the content information in relation to these colorectal cancer markers, to characterize the illness feelings of person under test Condition.It again for example can be by means of fluorescent quantitative PCR technique by carrying out table to the nucleic acid in person under test's fecal microorganism flora DNA Sign, to obtain the content information about these colorectal cancer markers, and is detected by means of fluorescent quantitative PCR technique, It can be convenient and be quickly obtained testing result, be conducive to the popularization and industrialization detected for colorectal cancer.

For this purpose, the marker includes SEQ ID NO:1, SEQ ID the present invention provides a kind of colorectal cancer marker NO:2 and SEQ ID NO:3, the case where can reflect early stage colorectal cancer by these markers.The present invention passes through macro genome Detection discovery colorectal cancer sufferer and healthy population intestinal flora difference, evaluation and screening go out 30 it is relevant to colorectal cancer micro- Biological gene segment is screened 3 genetic fragments and is made by calculating genetic fragment to the percentage contribution of screening colorectal cancer accuracy rate For the marker gene segment for screening colorectal cancer.

According to the three of screening kinds of colorectal cancer markers, the primer for capableing of three kinds of biomarkers of specific amplification is devised It is right, i.e. SEQ ID NO:4~SEQ ID NO:9, the wherein adjacent number of every two in SEQ ID NO:4~SEQ ID NO:9 Nucleic acid sequence is a pair.It, being capable of specific amplification SEQ ID NO:1, SEQ ID NO:2 and SEQ ID by these primer pairs NO:3, so as to be used as the early diagnosis and detection of colorectal cancer.

The present invention also provides a kind of nucleic acid probe, it includes 3 kinds of colorectal cancer marks that the nucleic acid probe, which specific can capture, Will object.Colorectal cancer marker used in the nucleic acid capture probe present invention by design, can be realized the fast of colorectal cancer Speed detection.The present invention provides a kind of chip, the chip includes nucleic acid probe described above, can be used for capturing colorectal cancer Marker, to detect colorectal cancer.The present invention provides a kind of kit, the kit includes for detecting the present invention the The reagent of colorectal cancer marker described in one side.

The solution of the present invention is explained below in conjunction with embodiment.It will be understood to those of skill in the art that following Embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Particular technique or item are not specified in embodiment Part, it described technology or conditions or is carried out according to the literature in the art according to product description.Agents useful for same or instrument Production firm person is not specified in device, and being can be with conventional products that are commercially available.

The screening and verifying of 1 biomarker of embodiment

Collect 193 parts of fecal samples for deriving from Chongqing in China southwest hospital, including 98 parts of colorectal cancer sufferer samples (68 Part male's sample, 30 parts of women samples) and 95 parts of normal healthy controls samples (49 parts of male's samples, 46 parts of women samples).We (there is close dietary structure, life from sufferer to wherein 52 parts of colon cancer sufferer samples and 55 parts of normal healthy controls samples The healthy home member of living habit, living environment) macro genome detection has been carried out, colorectal cancer sufferer and health are found with this The difference of Intestinal flora.During to above-mentioned pattern detection, we identify 30 it is relevant to colorectal cancer micro- Biological gene segment has 4 genetic fragments strong wherein there is 26 genetic fragments to increased in colorectal cancer patients sample It increased (Fig. 1) in health check sample.Fig. 2 Receiver Operating Characteristics (ROC) curve shows that 30 candidate gene segments are being tied Presented in patients with bowel cancer sample (52 parts) and normal healthy controls sample (55 parts) significant difference [AUC=0.991,95%CI: 0.976-1.000], when above-mentioned 30 candidate gene segments are applied in remaining 86 random samples (46, sufferer sample, Check sample 40) in when, equally control and experiment sample in present significant difference [AUC=0.932,95%CI: 0.881—0.983】。

In addition, also have collected delivered it is right from 75 colorectal cancer sufferer samples of Hong-Kong, 53 health It originally and from 53 colorectal cancer sufferer samples of France, the macro genomic data of 88 healthy samples is used to indicate base in the same old way Because segment is further screened and is verified.

For 30 microbial gene segments of test different crowd intestinal flora performance situation, we to from Hong Kong and The macro genomic data of sample of France is analyzed, and obtains similar with the sample from Chongqing region as a result, there is 26 bases Because segment increased in colorectal cancer patients sample, there are 4 genetic fragments to increased (figure in normal healthy controls sample 1) significant difference [HK, AUC=0.894,95%CI:0.847-0.941], is presented in control and experiment sample respectively, [French, AUC=0.824,95%CI:0.797-0.852] (see Fig. 2), but the accuracy assessed decreases.

In order to better understand in Hong Kong and French crowd, the assessment accuracy that 30 genetic fragments are presented is asked Topic, we analyze the composed structure of all detection sample microorganisms of 3 groups (Chongqing, Hong Kong and France).Nonmetric multidimensional Dimensional analysis and clustering (NMDS) show that the intestinal flora composed structure of identical regional sample is similar (see Fig. 3), and The intestinal flora composed structure of Hongkong sample compares French group, closer (see Fig. 3) from Chongqing region sample.

Degree difference is expanded in detection sample and healthy sample according to the 30 candidate gene segments screened for the first time Size sequence, calculate genetic fragment to the percentage contribution of screening colorectal cancer accuracy rate, we have selected 3 genetic fragments to make For the marker gene segment of final screening colorectal cancer:

(1) No.8122329, unknown function, gemma Pseudomonas (Coprobacillus):

Primer: T1P9

Distinguished sequence:

AGCTGCTCTGTCAAGAGGAAAGTTCAATTCTTGAAGTGGAACACAAACATCACAAAGCAGTTTCTGAG AATGCTCCTGTTTAGTTTTTCTGTGAAGATGAACCCGTTTCCAACGAAATCTTCACAGAGGTCCACATATCCACTT GCAGAATCCAAAGAAAGAGAGTTTCAAAACTGCTCCATCAGCAGGATTGTTCACCTCTGTGAGTTGAATGCAGTCA TCACAGGAAACATTCTGAGAATGCTTCTGTCTAGGTTTGATGTGAAGATATACCCGTTTCAAGGAAGGCCACAAAG TGGTCCAAATATCCACTTGCAGATTCTACAAAAAGAGTGTTTGAAAGCTGAACTATGA(SEQ ID NO:1 343bp)

(2) No.3742340, nitrilase gene, Clostridium symbiosum category (C.symbiosum):

Primer: seq6:0-320；

Distinguished sequence:

ATGAAGAAATTTACCGTGGGAGTAATCCAAATGGATTCCCAGGACAATGTGGAAAAAAATCTGCAGAC AGCCGTCGAATTTATCGGGGAGGCAGCCGCCAGGGGGGCAAAGCTGATTGCAATGCCGGAAAGCATGAATTATGTG GGGACGGATAATGCGGGACACGCGGAAAATATACCGGACGGCCCGACCTTTTGCCTGATGGCAGAGCAGGCGAAAA AACACCATGTATGGCTGCACTGCGGGAGTATCTATGAGAAGAATGAAAAGGATCCCAGACCTTATAATGCAACCAT GGTTATCAGCCCGGAGGGAGAATTGGCGGCCAAATACCATAAAATACCCCCCTTCGACGTGATAATTCCGGACGGG CCGGTGAACAAAGAATCAGACCGTATCTGTCCGGGGAGTGAGATTGTTACGGTGGATACAGGGGAAGTCGGATGCC TGGGATTGTCGATCTGCTATGATATCCGTTTTGCGGAGATGTACCGGATCATGGCTCTGGAAGGCGCCCAGCTTCT GCTGACACCGGCAGATTTCACGATGCCGACCGGCAAAGATCACTGGGAGACCATTCTGCGCACCCGTGCAATAGAA AACGGATGCTACGTCATAGCTCCGGCCCAGTATGGCGTGAAACCGAATTTCCAGGCATATGCCAATTCTGTTGTCA TCGATCCCTGGGGGAATGTAATTGCCCGCGCCTCCAACCGGCCGCAGGTTATTACCGCGGAAATTGATCTGGACTA TCTTGCCCAGGTCCGCAGGCAGATTTTCACTTTGGAGAACCGCCGACCCGATGTATACAGCCTGGCAAGAAAGGTT TAG(SEQ ID NO:2 831bp)

(3) No.5053929, peptide methionine sulfoxide reductase are encoded, fusobacterium by MSRA gene (Fusobacterium):

Primer: T1P26.

Distinguished sequence:

ATGAAAGGGCTAAAAAAATTGTTTTTAGGAATTATGATGTTATTAATGGGAGCAGTAGCTTTTGGGGC AGAGATGGATTTGTCAAAGGTTACTTTAAAAGATGTGAATGGAATGAGTTATTCTTTTGGAAAAGATGGAAAACCA ACTTATGTTAAGTTTTGGGCTTCTTGGTGTCCAATTTGTCTTTCTGGATTAGAAGATATAGATAATCTTAGCAAAG AAAAGAAAGATTTTGAAGTTGTTACTGTTGTTTCTCCTGGGTTAGTTGGAGAAAAGAAAACAGAAGATTTTAAAAA ATGGTATAAATCTTTGGAATATAAGAATATAAAAGTTTTATTAGATGAGAAAGGTGAATTATCAAAGATATTAAAT GTTCGTGTTTATCCAACTTCTGTTGTTGTAAATAAAGCTGGGAAAGCTGAAAAAGTTCTTCCAGGTCATTTAGAAA AAGCAGAAATAAAAAAATTATTTTCTTCTAAAATGATGATGAATGATAAAGGAATGAAAGACACTATGATGAAAGA TAATCATATGATGAACGATGGAAAGATGAAAGATAACATGATGAAAGATGACAAAATGATGAATGATAAACATATG ATGAAAGATGATAAAATGAGTATGGAAAAAAAACATCAATGTAAAACATGTTAA(SEQ ID NO:3654bp)

2 primer screening of embodiment

For the biomarker specific sequence that the screening of embodiment 1 obtains, specific primer is designed, it is special for every kind Property sequence designed by specific primer carry out primer test: i.e. by regular-PCR amplification, agarose gel electrophoresis detects it Band illustrates that primer specificity is good if purpose band size and expected consistent and band are single.It finds after testing, shown in table 2 Primer can be used for expanding embodiment 1 and screen obtained specific sequence, and purpose band size and expected consistent and band are single, The specificity of amplification is good.

2 specific primer sequence of table

The detection application of 3 colorectal cancer of embodiment

The present embodiment is based primarily upon Real-Time Fluorescent Quantitative PCR Technique to colorectal cancer patients and normal person fecal microorganism bacterium Group DNA tested, it is shown the result is that according to embodiment 2 provide best primer provided by result.

1, sample collection

It acquires 30 Patients with Colorectal Cancer and 30 normal human faecal mass central parts respectively using sampling swab, is stored in and contains There is the excrement collecting tube of buffer, after screwing pipe lid, overturn 5,6 times above and below, liquid will be saved and excrement is uniformly mixed.

The preservation and transport of sample: room temperature or 4 DEG C it is stored refrigerated.The long-distance transport of sample can be transported at room temperature before refrigerating, cold The long-distance transport of sample need to use dry ice behind hiding.

2, nucleic acid extraction

Using excrement gene extracts kit QIAamp DNA Stool Mini Kit, it is micro- that excrement is extracted to specifications Biological flora DNA finally collects 50 μ L DNA solutions, is directly detected or be stored in -20 DEG C.

3, PCR reaction solution is prepared

PCR reaction solution 1:PCR reaction buffer, T1P9 specific primer (SEQ ID NO:4, SEQ ID NO:5), 16S The internal control primer (SEQ ID NO:10, SEQ ID NO:11) of rDNA；

PCR reaction solution 2:PCR reaction buffer, seq6:0-320 specific primer (SEQ ID NO:6, SEQ ID NO: 7), the internal control primer (SEQ ID NO:10, SEQ ID NO:11) of 16S rDNA；

PCR reaction solution 3:PCR reaction buffer, T1P26 specific primer (SEQ ID NO:8, SEQ ID NO:9), 16S The internal control primer (SEQ ID NO:10, SEQ ID NO:11) of rDNA；

Wherein, the ingredient of PCR reaction buffer: SYBR^TMPremix Dimer Eraser (2 ×), ddH₂O；

Primer concentration is equal in PCR reaction solution are as follows: 10pmol/ μ L.

4, real-time fluorescence quantitative PCR detects

Experiment specific steps are as follows:

(1) 3 kinds of different PCR reaction solutions are taken, are distributed into PCR reaction tube by 18 μ L/ pipes, it is spare.

(2) the 2 μ L of detection sample/health sample DNA solution after extracting is added into PCR reaction tube, and covers tightly pipe lid, It is put into togerther 7300 fluorescence quantitative PCR instrument sample cell of ABI Prism.

(3) ABI Prism 7300SDS software is double-clicked, selects Assay in New Document Wizard window, if Next is pressed after the completion of fixed, selects Detector to press Add and Detector addition plate Document is pressed into Next, select In Plate Document after the Wells of setting-out product, the Use frame in Detector column is clicked, is selected from the column Task Standard selects Well Inspector input sample title from View column, this PlateDocument is saved, by archives Type saves as SDS Document (* .sds) format.It checks PCR condition, sample disc is put into machine, and prepare to collect Data hits Instrumennt on Plate Document, sets window into PCR, setting temperature and time: 95 DEG C, 3min, 1 circulation；95 DEG C, 5s；60 DEG C, 30min, 40 circulations；95 DEG C, 15s；60 DEG C, 30s；95 DEG C, 15s, 1 circulations, Add Dissociation is clicked, Amplification Plot is clicked at Results and collects signal, clicks and saves, press Start starts to carry out PCR and signal is collected.

5, real-time fluorescence quantitative PCR result and analysis

Real-time fluorescence quantitative PCR data are collected, are exported as a result, T1P9 primer (SEQ ID NO:4, SEQ ID NO:5) exists Amplification curve diagram in 60 samples (30 check sample+30 detection samples) is shown in Fig. 4, seq6:0-320 primer (SEQ ID NO:6, SEQ ID NO:7) amplification curve diagram in 60 samples (30 check sample+30 detection samples) is shown in Fig. 5, Expansion of the T1P26 primer (SEQ ID NO:8, SEQ ID NO:9) in 60 samples (30 check sample+30 detection samples) Increase curve graph and sees Fig. 6.3 pairs of primers amplification in 60 samples by analysis carries out calculating sample with 2- Δ Δ Ct method Relative quantification value when amplification, the results are shown in Table 1:

1,3 pair of primer of table amplification in 60 samples

Carrying out Wilcoxon rank sum test 3 pairs of primers of analysis with R version 3.3.1 software, (30 strong in 60 samples Health sample and 30 detection samples) in amplification significance difference analysis obtain, T1P9 primer amplification gene in 60 samples The relative expression levels of No.8122329 (SEQ ID NO:1) see Fig. 7, the difference of relative expression's abundance in control and experiment sample It is horizontal (see Figure 10) that different conspicuousness reaches P < 0.05；Seq6:0-320 primer amplification gene No.3742340 in 60 samples The relative expression levels of (SEQ ID NO:2) see Fig. 8, and the significance of difference of relative expression's abundance reaches in control and experiment sample It is horizontal (see Figure 10) to P < 0.05；T1P26 primer amplification gene No.5053929 (SEQ ID NO:3) in 60 samples Relative expression levels see Fig. 9, the significance of difference of control and experiment sample relative expression abundance reach P > 0.05 it is horizontal (see Figure 10).Meanwhile density curve equally shows No.8122329 (SEQ ID NO:1) and No.3742340 (SEQ ID NO:2) base In control and experiment sample there is the significance difference opposite sex to be distributed because of segment relative expression's abundance, and No.5053929 (SEQ ID NO:3) genetic fragment do not show significant difference then.

In addition, using T1P9 primer amplification genetic fragment as marker gene segment No.8122329 (SEQ ID NO: 1) AUC=0.930,95%CI:0.904-0.955 when identifying 30 experiment samples (see Figure 11).In conjunction with T1P9 primer with The genetic fragment No.8122329 (SEQ ID NO:1) and No.3742340 (SEQ ID NO:2) of seq6:0-320 primer amplification AUC=0.935,95%CI:0.833-0.987 when as 30 experiment samples of marker gene segment identification (see Figure 12).AUC Value: the fine or not degree of evaluation building model is better closer to 1；CI value: confidence interval falls and just sets up within this range, falls in Outside is then invalid.

Based on the conspicuousness differential expression that same gene segment is presented in control and experiment sample, illustrate T1P9 (SEQ ID NO:4、SEQ ID NO:5)、seq6:0-320(SEQ ID NO:6、SEQ ID NO:7)、T1P26(SEQ ID NO:8、SEQ ID NO:9) marker gene segment SEQ ID NO:1, SEQ ID NO:2, the SEQ ID NO:3 of intestinal flora of primer amplification can For carrying out the judgement of colorectal cancer illness.

In this specification description, term " first ", " second " are used for description purposes only, and should not be understood as instruction or dark Show relative importance or implicitly indicates the quantity of indicated technical characteristic.The feature of " first ", " second " is defined as a result, It can explicitly or implicitly include at least one of the features.In the description of the present invention, the meaning of " plurality " is at least two, Such as two, three etc., unless otherwise specifically defined.

In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show The description of example " or " some examples " etc. means specific features, structure, material or spy described in conjunction with this embodiment or example Point is included at least one embodiment or example of the invention.In the present specification, schematic expression of the above terms are not It must be directed to identical embodiment or example.Moreover, particular features, structures, materials, or characteristics described can be any It can be combined in any suitable manner in a or multiple embodiment or examples.In addition, without conflicting with each other, the technology of this field The feature of different embodiments or examples described in this specification and different embodiments or examples can be combined by personnel And combination.

Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example Property, it is not considered as limiting the invention, those skilled in the art within the scope of the invention can be to above-mentioned Embodiment is changed, modifies, replacement and variant.

SEQUENCE LISTING

<110>micro- healthy Gene Tech. Company Limited in Shenzhen

<120>colorectal cancer marker and its application

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 354

<212> DNA

<213> Coprobacillus

<400> 1

agctgctctg tcaagaggaa agttcaattc ttgaagtgga acacaaacat cacaaagcag 60

tttctgagaa tgctcctgtt tagtttttct gtgaagatga acccgtttcc aacgaaatct 120

tcacagaggt ccacatatcc acttgcagaa tccaaagaaa gagagtttca aaactgctcc 180

atcagcagga ttgttcacct ctgtgagttg aatgcagtca tcacaggaaa cattctgaga 240

atgcttctgt ctaggtttga tgtgaagata tacccgtttc aaggaaggcc acaaagtggt 300

ccaaatatcc acttgcagat tctacaaaaa gagtgtttga aagctgaact atga 354

<210> 2

<211> 831

<212> DNA

<213> C. symbiosum

<400> 2

atgaagaaat ttaccgtggg agtaatccaa atggattccc aggacaatgt ggaaaaaaat 60

ctgcagacag ccgtcgaatt tatcggggag gcagccgcca ggggggcaaa gctgattgca 120

atgccggaaa gcatgaatta tgtggggacg gataatgcgg gacacgcgga aaatataccg 180

gacggcccga ccttttgcct gatggcagag caggcgaaaa aacaccatgt atggctgcac 240

tgcgggagta tctatgagaa gaatgaaaag gatcccagac cttataatgc aaccatggtt 300

atcagcccgg agggagaatt ggcggccaaa taccataaaa tacccccctt cgacgtgata 360

attccggacg ggccggtgaa caaagaatca gaccgtatct gtccggggag tgagattgtt 420

acggtggata caggggaagt cggatgcctg ggattgtcga tctgctatga tatccgtttt 480

gcggagatgt accggatcat ggctctggaa ggcgcccagc ttctgctgac accggcagat 540

ttcacgatgc cgaccggcaa agatcactgg gagaccattc tgcgcacccg tgcaatagaa 600

aacggatgct acgtcatagc tccggcccag tatggcgtga aaccgaattt ccaggcatat 660

gccaattctg ttgtcatcga tccctggggg aatgtaattg cccgcgcctc caaccggccg 720

caggttatta ccgcggaaat tgatctggac tatcttgccc aggtccgcag gcagattttc 780

actttggaga accgccgacc cgatgtatac agcctggcaa gaaaggttta g 831

<210> 3

<211> 654

<212> DNA

<213> Fusobacterium

<400> 3

atgaaagggc taaaaaaatt gtttttagga attatgatgt tattaatggg agcagtagct 60

tttggggcag agatggattt gtcaaaggtt actttaaaag atgtgaatgg aatgagttat 120

tcttttggaa aagatggaaa accaacttat gttaagtttt gggcttcttg gtgtccaatt 180

tgtctttctg gattagaaga tatagataat cttagcaaag aaaagaaaga ttttgaagtt 240

gttactgttg tttctcctgg gttagttgga gaaaagaaaa cagaagattt taaaaaatgg 300

tataaatctt tggaatataa gaatataaaa gttttattag atgagaaagg tgaattatca 360

aagatattaa atgttcgtgt ttatccaact tctgttgttg taaataaagc tgggaaagct 420

gaaaaagttc ttccaggtca tttagaaaaa gcagaaataa aaaaattatt ttcttctaaa 480

atgatgatga atgataaagg aatgaaagac actatgatga aagataatca tatgatgaac 540

gatggaaaga tgaaagataa catgatgaaa gatgacaaaa tgatgaatga taaacatatg 600

atgaaagatg ataaaatgag tatggaaaaa aaacatcaat gtaaaacatg ttaa 654

<210> 4

<211> 28

<212> DNA

<213>artificial sequence

<400> 4

ctctgtcaag aggaaagttc aattcttg 28

<210> 5

<211> 26

<212> DNA

<213>artificial sequence

<400> 5

ctctctttct ttggattctg caagtg 26

<210> 6

<211> 22

<212> DNA

<213>artificial sequence

<400> 6

ttatgtgggg acggataatg cg 22

<210> 7

<211> 24

<212> DNA

<213>artificial sequence

<400> 7

ggtattttat ggtatttggc cgcc 24

<210> 8

<211> 28

<212> DNA

<213>artificial sequence

<400> 8

tggaaaagat ggaaaaccaa cttatgtt 28

<210> 9

<211> 34

<212> DNA

<213>artificial sequence

<400> 9

cacgaacatt taatatcttt gataattcac cttt 34

<210> 10

<211> 20

<212> DNA

<213>artificial sequence

<400> 10

gttgtcgtca gctcgtgtcg 20

<210> 11

<211> 20

<212> DNA

<213>artificial sequence

<400> 11

gcagtctcgc tagagtgccc 20

Claims (11)

1. a kind of colorectal cancer marker, which is characterized in that the colorectal cancer marker includes: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

2. one group of primer pair, which is characterized in that the primer pair being capable of specific amplification colorectal cancer mark described in claim 1 Will object.

3. primer pair according to claim 2, it is characterised in that: the primer pair is SEQ ID NO:4~SEQ ID NO:9, wherein the nucleic acid sequence of the adjacent number of every two is a pair in SEQ ID NO:4~SEQ ID NO:9.

4. a kind of nucleic acid probe, which is characterized in that it includes that knot described in claim 1 is straight that the nucleic acid probe, which specific can capture, Intestinal cancer marker.

5. a kind of chip, which is characterized in that the chip includes nucleic acid probe as claimed in claim 4.

6. core described in primer pair described in colorectal cancer marker according to claim 1 or claim 2 or claim 4 Application of the acid probe in the cancer diagnosis drug of screening Human colorectal carcinoma.

7. core described in primer pair described in colorectal cancer marker according to claim 1 or claim 2 or claim 4 Application of the acid probe in preparation colorectal cancer detection kit.

8. a kind of kit, which is characterized in that the kit includes for detecting colorectal cancer mark described in claim 1 The reagent of object.

9. kit according to claim 8, which is characterized in that including at least one of:

Primer pair as claimed in claim 2；

Nucleic acid probe as claimed in claim 4.

10. kit according to claim 8 or claim 9, which is characterized in that the kit further includes internal control primer pair, Middle internal control primer is to for SEQ ID NO:10 and SEQ ID NO:11.

11. according to application of any kit of claim 7-10 in detection colorectal cancer.