CN109762897B - Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof - Google Patents
Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof Download PDFInfo
- Publication number
- CN109762897B CN109762897B CN201811601247.3A CN201811601247A CN109762897B CN 109762897 B CN109762897 B CN 109762897B CN 201811601247 A CN201811601247 A CN 201811601247A CN 109762897 B CN109762897 B CN 109762897B
- Authority
- CN
- China
- Prior art keywords
- circ
- osteosarcoma
- circular rna
- detecting
- expression level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides an osteosarcoma biomarker cyclic RNA-circ _0006633 and application thereof, wherein the cyclic RNA-circ _0006633 can be used as the osteosarcoma biomarker and applied to preparation of osteosarcoma diagnosis tools or osteosarcoma prognosis evaluation tools, has high specificity and short period, is easy to popularize clinically, and has important clinical significance for diagnosis and treatment and prognosis evaluation of clinical osteosarcoma.
Description
Technical Field
The invention belongs to the field of biomedicine, and relates to an osteosarcoma biomarker cyclic RNA-circ _0006633 and application thereof.
Background
Osteosarcoma is one of the most common primary malignant bone tumors, accounts for about 35% of the primary malignant bone tumors, and is better developed in adolescents. Osteosarcoma is extremely malignant, and metastasis can occur early, and about 15-20% of patients have metastasis when the first visit occurs, and metastasis often means poor prognosis. Before the 80 s of the last century, the 5-year survival rate of osteosarcoma patients is only about 20%, and after the 80 s, with the progress of surgical techniques and the emergence of various auxiliary treatment means such as chemotherapy, the 5-year survival rate of osteosarcoma patients is improved to 60-70%. Nevertheless, the prognosis of patients with osteosarcoma of the middle-aged and elderly age is still not optimistic, and it has been reported that the survival rates of patients with osteosarcoma of different ages are different, and the 5-year survival rate of patients with osteosarcoma of less than 30 years old is about 60%, the 5-year survival rate of patients of 30-49 years old is about 50%, and the 5-year survival rate of patients of more than 50 years old is about 30%. More significantly, although the survival of osteosarcoma patients was prolonged in the 80 s of the last century with the application of osteosarcoma combination therapy, in the last 20 years, the 5-year survival rate of osteosarcoma patients did not significantly increase, and new preventive and therapeutic strategies are still needed to further improve the prognosis and reduce the risk of death and social risks of osteosarcoma patients. Therefore, the method improves the treatment means of the osteosarcoma, simultaneously explores the generation, recurrence and transfer mechanism of the osteosarcoma from the molecular level, lays a foundation for the early diagnosis, treatment and prognosis evaluation of the osteosarcoma, and has important scientific and social significance.
Circular RNA (circular RNA) is a research hotspot in the field of non-coding RNA recently, and is a stable circular RNA molecule. It was reported as early as 1993 that human cells harbored a number of circular RNA molecules formed by exons, which were at the time considered to be transcriptionally misformed molecules. In recent years, with the development of high-throughput RNA sequencing and bioinformatics technologies, the field of circular RNA research has progressed faster, and a large number of circular RNA molecules have been identified in many species. Circular RNA is mostly localized in the cytoplasm and is formed mainly by reverse splicing of exons into loops. High throughput sequencing results three types of circular RNA were found: circular RNA formed by exon, circular RNA formed by intron and circular RNA formed by both exon and intron. The exon forms the largest proportion of the ring, and the reported more classical ring formation is the formation of lasso structure and intron pairing. Although the abundance of the circular RNA as a whole is not high, studies have shown that the circular RNA is associated with cardiovascular diseases, tumors, and the like, and is also stable in exosomes. At present, the specific action mechanism of circular RNA is not clear, and the related reports including RNA-circ _0006633(chr1:59805629-59844509) in osteosarcoma are few, and the identification, function and molecular mechanism of the circular RNA in osteosarcoma stem cells are to be studied deeply.
Disclosure of Invention
The invention aims to provide an osteosarcoma biomarker cyclic RNA-circ _0006633 and application thereof, wherein the cyclic RNA-circ _0006633 is applied to diagnosis and treatment and prognosis of osteosarcoma diseases, has high specificity and short period, and is easy to popularize clinically.
The invention discovers that the circular RNA-circ _0006633 has an important regulation and control effect on the biological behavior of osteosarcoma for the first time, and further, the circ _0006633 is applied to the diagnosis and treatment and prognosis of osteosarcoma, and has important clinical significance on the diagnosis and treatment and prognosis evaluation of clinical osteosarcoma.
In order to achieve the purpose, the invention provides the following technical scheme:
the invention provides application of circular RNA-circ _0006633 as a osteosarcoma biomarker.
The invention also provides application of the circular RNA-circ _0006633 in preparing a tool for diagnosing or prognosing osteosarcoma, namely application of a product for detecting the expression level (content or expression quantity) of circ _0006633 in sample tissues in preparing the tool for diagnosing or prognosing the osteosarcoma.
Preferably, the product for detecting the expression level of circ _0006633 in the sample tissue comprises RT-PCR and real-time fluorescent quantitative PCR.
Further, the product for detecting the expression level of the circular RNA-circ _0006633 by using RT-PCR at least comprises a pair of primers for specifically amplifying circ _ 0006633; the product for detecting the expression level of the circular RNA-circ _0006633 by using real-time quantitative PCR at least comprises a pair of primers for specifically amplifying circ _ 0006633.
Preferably, the product for detecting the expression level of circular RNA-circ _0006633 by real-time quantitative PCR comprises at least one pair of primers for specifically amplifying circ _0006633, wherein the primers comprise: f: AAATGCAGGCCCCGAAACTT; r: CGTGGCATCAAACCCAAGTC are provided.
The osteosarcoma prognosis evaluation tool provided by the invention is used for diagnosing or prognostically evaluating osteosarcoma patients by detecting the expression quantity of circ _0006633 in samples.
Preferably, the osteosarcoma diagnosis tool or osteosarcoma prognosis evaluation tool comprises a kit and reagents.
Preferably, the kit comprises reagents for detecting the expression level of circular RNA-circ _0006633, including reagents for detecting the expression level of circular RNA-circ _ 0006633.
Preferably, the reagent for detecting the expression level of circ _0006633 comprises a pair of primers for detecting the expression level of circ _0006633, wherein the primers comprise: f: AAATGCAGGCCCCGAAACTT; r: CGTGGCATCAAACCCAAGTC is added.
In the present invention, the osteosarcoma diagnosis tool or osteosarcoma prognosis evaluation tool contains, in addition to the primers of circ _0006633, all reagents for extracting RNA from osteosarcoma tissue and performing reverse transcription and fluorescence quantitative PCR, specifically including:
(1) extracting total RNA from osteosarcoma tissue with reagent comprising RNA stabilizing solution, Trizol reagent, chloroform, isopropanol, and enzyme-free water;
(2) a reagent for reverse transcription of circ _0006633 into cDNA by taking total RNA as a template, which comprises a reverse transcription buffer solution, base triphosphate deoxynucleotide, an RNase inhibitor, MMLV reverse transcriptase and a random primer used for circ _ 0006633;
(3) the reagents used for the real-time quantitative PCR of the cDNA comprise a circ _0006633 real-time fluorescent quantitative PCR specific primer, a GAPDH reference specific PCR primer, a real-time fluorescent quantitative SYBR dye and enzyme-free water.
The invention provides a new biomarker-cyclic RNA-circ _0006633 for diagnosis, treatment and prognosis of osteosarcoma diseases, wherein circ _0006633 is mainly located in cytoplasm and has high intracellular stability, and the cyclic RNA-circ _0006633 gene provided by the invention is obviously reduced in osteosarcoma tissues and is obviously low in expression in metastatic osteosarcoma tissues, so that different expression levels of circ _0006633 are closely related to prognosis conditions of osteosarcoma invasiveness, recurrence, metastasis and the like, and can be used for predicting recurrence and metastasis of osteosarcoma.
In addition, experiments prove that after the expression of the circ _0006633 is reduced in osteosarcoma tissues, the proliferation capacity, migration capacity and invasion capacity of osteosarcoma spheroid cells are obviously increased, so that the circ _0006633 plays a significant role in the proliferation, migration and invasion of osteosarcoma stem cells, the recurrence and metastasis of osteosarcoma stem cells are closely related, and the invention proves that after the expression of the circ _0006633 is reduced in osteosarcoma tissues, the protein levels of related transcription factors (OCT4, SOX2 and NANOG) in the osteosarcoma stem cells are obviously increased. Therefore, the circ _0006633 can be used for detecting prognostic molecules of osteosarcoma recurrence and metastasis, and has profound clinical significance and popularization.
Drawings
FIG. 1 is a photograph of the spherical body of the osteosarcoma MNNG/HOS cell cultured in example 1 of the present invention.
FIG. 2 shows the results of high throughput RNA sequencing analysis of the differentially expressed circular RNAs of osteosarcoma spheroid cells and adherent cells in example 1 of the present invention.
FIG. 3 is a graph showing the comparison of the expression results of circ _0006633 in spheroid and adherent cells of MNNG/HOS, MG-63 in example 1 of the present invention.
FIG. 4 is a graph showing the comparison of the results of Real time PCR detection of circ _0006633 in osteosarcoma tissue and its corresponding paracarcinoma tissue in example 1 of the present invention.
Fig. 5 is a graph comparing the results of detecting circ _0006633 in osteosarcoma tissues from non-metastatic (n-38) and metastatic (n-22) tissues in example 1 of the present invention.
FIG. 6 is a schematic diagram showing chromosome location and loop position of circ _0006633 in example 2 of the present invention.
FIG. 7 is a comparison of the expression levels of circ-0006633 and the corresponding FGGY mRNA host gene after RNase R treatment on osteosarcoma spheroids cells formed from MNNG/HOS in example 2 of the present invention.
FIG. 8 shows the expression level of circ _0006633 in spheroid cells formed from actinomycin D-treated MNNG/HOS/MG-63 cells in example 2 of the present invention.
FIG. 9 shows the expression level of circ _0006633 in the cytoplasm and nucleus of spheroid cells formed by MNNG/HOS/MG-63 cells in example 2 of the present invention.
FIG. 10 is a graph showing the change in proliferation potency of osteosarcoma spheroid cells MNNG/HOS/MG-63 after down-regulating the expression of circ _0006633 in MNNG/HOS/MG-63 cells with shRNA in example 3 of the present invention.
FIG. 11 shows the change of MNNG/HOS spheroid cell MNNG/HOS migration and invasion capacities after the expression of circ _0006633 is down-regulated by shRNA in example 3 of the present invention; a is a picture of migration and invasion crystal violet staining of cells with circ _0006633 expression down-regulated and cells of a control group, and B is a picture of statistical analysis result, which indicates that the circ _0006633 knock-down group has stronger migration and invasion capacity than the control group.
FIG. 12 shows the changes in OCT4, SOX2 and NANOG protein levels after circ _0006633 downregulation as measured by Western blotting in example 3 of the present invention.
FIG. 13 shows high throughput RNA sequencing and analysis of differentially expressed mRNA after downregulation of circ _0006633 with shRNA in osteosarcoma spheroid cells, according to example 4 of the present invention.
FIG. 14 shows the KRAS signal path of GSEA analysis in example 4 of the present invention.
Fig. 15 shows the NOTCH signaling pathway of GSEA analysis in example 4 of the present invention.
Figure 16 is the Wnt signaling pathway analyzed by GSEA in example 4 of the invention.
Detailed Description
The invention will now be further described with reference to examples and figures, but the practice of the invention is not limited thereto.
Example 1 identification of osteosarcoma stem cell-associated circular RNA and correlation between circ _0006633 expression level and osteosarcoma diagnosis and metastasis prognosis
Spheres (shown in figure 1) were cultured in MNNG/HOS cells (ATCC, USA) at the previous stage, and then high-throughput RNA sequencing was performed on the spheres and corresponding adherent cells, bioinformatics analysis was performed, differentially expressed circular RNAs were identified, and the results of identification are shown in figure 2, and please refer to specific identification steps and explain figure 2. Through analysis, a total of 2128 circular RNAs with differential expression are found, wherein 624 circular RNAs are up-regulated, 1504 circular RNAs are down-regulated, and the proportion of circular RNAs which are down-regulated is larger. Candidate circrnas differentially expressed top-ranked were selected from the analysis and further validation studies were performed with circ _0006633 low expressed in osteosarcoma spheroid cells as entry points.
The sequencing results were verified with MNNG/HOS and MG-63 cells (ATCC, USA), and the expression of circ _0006633 was detected in spheroid and adherent cells of MNNG/HOS and MG-63 using RT-PCR, as shown in FIG. 3. As can be seen from FIG. 3, circ _0006633 is clearly under-expressed in osteosarcoma spheroid cells. The expression of circ _0006633 in osteosarcoma tissue and its corresponding paracarcinoma tissue, and circ _0006633 in non-metastatic (n-38) and metastatic (n-22) osteosarcoma tissue were then further tested by PCR, and the results are shown in fig. 4 and fig. 5, respectively. As shown in FIG. 4, circ _0006633 is highly expressed in the para-carcinoma tissues and is significantly down-regulated in the osteosarcoma tissues (p <0.0001), so that circ _0006633 can be used as a negative molecular marker for osteosarcoma diagnosis. As can be seen from FIG. 5, circ _0006633 is highly expressed in osteosarcoma with no metastasis, but is significantly low expressed in metastatic osteosarcoma tissues (p <0.0094), suggesting that the expression of circ _0006633 has a significant correlation with the prognosis of osteosarcoma metastasis.
Example 2 biological characteristics of circular RNA circ _0006633
The linear FGGY molecule is a protein-encoding gene located at 1p32.1 with circularization of exons 3,4 and 5 to form circ _0006633(chr1:59805629-59844509) 353nt in length, amplified with specific primers and identified correctly by T-vector clone sequencing, and the chromosomal location and circularization position of circ _0006633 are shown in FIG. 6.
The RNA of osteosarcoma spheroid cells formed by MNNG/HOS is treated by exonuclease RNase R, real time PCR is used for detecting the change of circ-0006633 and the expression condition of linear FGGY mRNA thereof, and the experimental result is shown in figure 7, and shows that the expression quantity of circ-0006633 is not obviously changed, and the expression quantity of the linear FGGY mRNA is obviously reduced, which indicates that circ-0006633 is very stable and has resistance to RNase R.
Actinomycin D treatment is carried out in MNNG/HOS and MG-63 cells of osteosarcoma spheroid cells to inhibit RNA transcription, cellular RNA is collected at different time points, real time PCR is adopted to detect the expression quantity of circ-0006633 and linear FGGY mRNA after reverse transcription, the experimental result is shown in figure 8, and the experimental result shows that the expression quantity of circ-0006633 has no obvious change within 24 hours, and the expression quantity of the linear FGGY mRNA has obvious reduction within 24 hours, and also shows that the stability of circ-0006633 in cells is high. Meanwhile, a nucleoplasmic separation experiment is carried out on spheroid cells formed by the osteosarcoma spheroid cells MNNG/HOS and MG-63 cells, cytoplasm and nucleus of the cells are separated, real time PCR is carried out after RNA extraction to detect the expression condition of circ _0006633 in the cytoplasm and the nucleus, and the experiment result is shown in figure 9, and the result shows that circ _0006633 is mainly located in the cytoplasm.
Example 3 Effect of circ _0006633 on the sternness characteristics of osteosarcoma Stem cells
The real time PCR technique, sh-RNA technique, CCK8 technique, Transwell assay technique and Western blotting assay technique used in this example are the most common and most classical assay methods in molecular biology. For concrete steps and principles, please refer to "refined molecular biology Experimental Manual (fifth edition),", (American) FM Oberb et al
Designing shRNA at the position where circ _0006633 is handed over upstream and downstream, constructing shRNA plasmid, infecting osteosarcoma spheroid cells after slow virus packaging, determining infection efficiency by real time PCR, and then carrying out later experiments.
CCK8 experiment results show that after the expression of circ _0006633 is reduced by shRNA, the proliferation capacity of osteosarcoma spheroid cells is obviously increased.
The results of Transwell experiments showed (see fig. 11) that the migration and invasion capacity of osteosarcoma spheroid cells was significantly increased after the expression of circ _0006633 was down-regulated.
Changes of protein levels of stem cell-associated transcription factors (OCT4, SOX2 and NANOG) after circ _0006633 is down-regulated are detected by Western blotting, and the protein levels of the three genes are found to be obviously up-regulated, and the experimental result is shown in FIG. 12.
Example 4 preliminary study of the mechanism of the molecule functioning as the circ _0006633 molecule
To further study the mechanism of action of circ _0006633, the present invention used shRNA to interfere with the down-regulation of circ _0006633 expression in osteosarcoma spheroid cells, followed by high throughput RNA sequencing to analyze the altered mRNA (see figure 13 for results) and associated signaling pathways. GSEA signaling pathway analysis found that the expression of circ _0006633 correlated with KRAS, NOTCH and Wnt signaling pathways (fig. 14-16).
There are reports in the literature that circular RNA can function as sponge to bind miRNA. According to the invention, RIP experiments are carried out by using AGO2 protein, and it is found that circ _0006633 can be enriched by AGO2, which indicates that circ _0006633 can be combined with miRNA, but whether circ _0006633 is combined with miRNA to play the role of sponge or is degraded by miRNA is not clear, and the later experiments are needed for verification.
Claims (7)
1. The application of the product for detecting the expression level of the circular RNA-circ _0006633 in sample tissues in preparing an osteosarcoma diagnosis tool or an osteosarcoma prognosis evaluation tool.
2. The use according to claim 1, wherein the product for detecting the expression level of circular RNA-circ _0006633 in the sample tissue comprises RT-PCR, real-time fluorescent quantitative PCR.
3. The use according to claim 2, wherein the product for detecting the expression level of circular RNA-circ _0006633 by RT-PCR comprises at least one pair of primers for specifically amplifying circ _ 0006633; the product for detecting the expression level of the circular RNA-circ _0006633 by using real-time quantitative PCR at least comprises a pair of primers for specifically amplifying circ _ 0006633.
4. The use according to claim 3, wherein the product for detecting the expression level of circular RNA-circ _0006633 by real-time quantitative PCR comprises at least one pair of primers for specifically amplifying circ _0006633, wherein the primers comprise: f: AAATGCAGGCCCCGAAACTT, respectively; r: CGTGGCATCAAACCCAAGTC are provided.
5. The use of claim 1, wherein the osteosarcoma diagnostic tool or osteosarcoma prognostic assessment tool comprises a kit or reagents.
6. The use according to claim 5, wherein the kit comprises reagents for detecting the expression level of circular RNA-circ _0006633, and the reagents comprise reagents for detecting the expression level of circular RNA-circ _ 0006633.
7. The use of claim 6, wherein the reagent for detecting the expression level of circ _0006633 comprises a pair of primers for detecting the expression level of circular RNA-circ _0006633, and the primers comprise: f: AAATGCAGGCCCCGAAACTT; r: CGTGGCATCAAACCCAAGTC are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811601247.3A CN109762897B (en) | 2018-12-26 | 2018-12-26 | Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811601247.3A CN109762897B (en) | 2018-12-26 | 2018-12-26 | Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109762897A CN109762897A (en) | 2019-05-17 |
| CN109762897B true CN109762897B (en) | 2022-08-19 |
Family
ID=66450990
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811601247.3A Active CN109762897B (en) | 2018-12-26 | 2018-12-26 | Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109762897B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105821131A (en) * | 2016-04-28 | 2016-08-03 | 中南大学湘雅医院 | Osteosarcoma miRNA marker |
| CN107177669A (en) * | 2017-05-27 | 2017-09-19 | 叶国良 | A kind of stomach cancer molecular marker hsa_circ_0006633 and its application |
-
2018
- 2018-12-26 CN CN201811601247.3A patent/CN109762897B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105821131A (en) * | 2016-04-28 | 2016-08-03 | 中南大学湘雅医院 | Osteosarcoma miRNA marker |
| CN107177669A (en) * | 2017-05-27 | 2017-09-19 | 叶国良 | A kind of stomach cancer molecular marker hsa_circ_0006633 and its application |
Non-Patent Citations (1)
| Title |
|---|
| 环状RNA-circ_0006633调控骨肉瘤肿瘤干细胞特性的分子机制的研究;国家自然科学基金委员会;《https://isisn.nsfc.gov.cn/egrantindex/funcindex/prjsearch-list》;20171231;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109762897A (en) | 2019-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2017213457B2 (en) | Micro-RNA biomarkers and methods of using same | |
| JP6216470B2 (en) | MiRNA expression signatures in the classification of thyroid tumors | |
| AU2008262252A1 (en) | Methods for determining hepatocellular carcinoma subtype and detecting hepatic cancer stem cells | |
| CN109468382B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| CN106755344A (en) | Molecular marked compound and its application for the diagnosis of cancer of pancreas clinical prognosis | |
| CN107519193B (en) | Molecular diagnostic marker for early stage esophageal squamous carcinoma and application thereof | |
| CN107674916B (en) | Application of circular RNA in colorectal cancer biomarker | |
| CN106967719B (en) | Application of long-chain non-coding RNA as prostate cancer molecular marker | |
| CN111187840A (en) | Biomarker for early breast cancer diagnosis | |
| CN102839179B (en) | MicroRNA marker for identifying subtypes of lung cancer and application of microRNA marker | |
| CN109055564B (en) | CircRNA marker for diagnosis and prognosis evaluation of chronic lymphocytic leukemia | |
| CN106755343A (en) | Cancer of pancreas Prognosis molecular marked compound | |
| CN110964831A (en) | Long non-coding RNA for detecting melanoma and application thereof | |
| CN109762897B (en) | Osteosarcoma biomarker circular RNA-circ _0006633 and application thereof | |
| CN106148511B (en) | Predictive marker and kit for recurrence risk of liver cancer patient after resection | |
| KR101381894B1 (en) | Serum miRNA as a marker for the diagnosis of lymph node metastasis of gastric cancer | |
| CN111808966B (en) | Application of miRNA in diagnosis of breast cancer disease risk | |
| US20220135979A1 (en) | Diagnosis and treatment of medulloblastoma | |
| CN110042164B (en) | Lung cancer diagnosis and treatment lncRNA marker | |
| CN109161596B (en) | The application of miR-129 and its target gene in detection adenocarcinoma of lung | |
| CN113293210A (en) | Application of ELFN1-AS1 in colorectal cancer diagnosis biomarkers and therapeutic targets | |
| US20150344961A1 (en) | Sera Based miRNAs as Non-Invasive Biomarkers in Melanoma | |
| CN111808946A (en) | Myelodysplastic syndrome marker and kit thereof | |
| CN116121245B (en) | Small molecule RNA and application thereof in early diagnosis of endometriosis | |
| CN114480656B (en) | Application of SLC12A3 and/or SLC12A9 as grape membrane melanoma treatment and prognosis detection index |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhou Zhenhua Inventor after: Xiao Jianru Inventor after: Zhang Weiwei Inventor after: Gong Dejun Inventor after: Kuang Muyu Inventor after: Wang Xudong Inventor after: Jia Qi Inventor after: Cao Jiashi Inventor after: Li Yan Inventor before: Zhou Zhenhua Inventor before: Xiao Jianru Inventor before: Zhang Weiwei Inventor before: Gong Dejun Inventor before: Kuang Muyu Inventor before: Wang Xudong Inventor before: Jia Qi Inventor before: Cao Jiashi Inventor before: Li Yan |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |