CN109758471A - A kind of application of microRNA and its target gene in colorectal cancer - Google Patents
A kind of application of microRNA and its target gene in colorectal cancer Download PDFInfo
- Publication number
- CN109758471A CN109758471A CN201910142349.1A CN201910142349A CN109758471A CN 109758471 A CN109758471 A CN 109758471A CN 201910142349 A CN201910142349 A CN 201910142349A CN 109758471 A CN109758471 A CN 109758471A
- Authority
- CN
- China
- Prior art keywords
- colorectal cancer
- mir
- cell
- application
- stat3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to technical field of molecular biology, the application of specifically a kind of microRNA and its target gene in colorectal cancer.The present invention is substantially less than normal tissue and Colon and rectum epithelial cell by research discovery miR-149 expression in colorectal cancer patients and CRC cell, and miR-149 low expression implies the poor prognosis of colorectal cancer patients.MiR-149 promotes the transfer of colorectal cancer and the migration of colorectal cancer cell by acting on STAT3.The influence of miR-149 and its target gene to CRC cell is analyzed using cell in vitro method.As a result, it has been found that miR-149 inhibits proliferation, invasion and the migration of colorectal cancer cell by targeting STAT3, miR-149 can also be promoted the apoptosis of colorectal cancer cell by targeting STAT3, can be used as a target for the treatment of of colorectal cancer.
Description
Technical field
The present invention relates to technical field of molecular biology, specifically a kind of microRNA and its target gene are in colorectal cancer
Application.
Background technique
Colorectal cancer (Colorectal cancer:CRC) is the cancer of position of being number three in world wide, be it is a kind of come
Derived from the malignant tumour of galandular epithelium.Due to the continuous improvement of national economy level and levels of substance, the eating habit and drink of people
Biggish variation has occurred in food structure, while aging group goes from strength to strength, and China's colorectal cancer incidence rate is caused significantly to increase,
Residents ' health greatly is endangered, influences its quality of life.
MicroRNAs (miRNAs) belongs to a kind of non-coding RNA, is found in eukaryocyte, by 19-25 nucleotide
Composition.MiR-149 is to study a more miRNA recent years, participates in regulation liver cancer, mammary gland as tumor suppressor gene
The generation and development process of the kinds cancers such as cancer, gastric cancer, nerve-cell tumor, it is also possible to the life as kinds cancer screening
Object marks object and prognostic factor.However, miR-149 is also fewer for the research of colorectal cancer.
Therefore, how microRNA and its target gene to be preferably applied to field of medical biology, is that current tumour is raw
Object field needs a great problem solved.
Summary of the invention
In order to solve the above technical problems existing in the prior art, the present invention provides a kind of microRNA and its target gene
Application in colorectal cancer, particular content are as follows:
A kind of application of microRNA and its target gene in colorectal cancer, the microRNA is miR-149, the target
Gene is target gene STAT3.
Inventor uses luciferase assay, and discovery miR-149 complementary with 3 ' UTR of STAT3 can be combined, it was confirmed that STAT3
It is a target gene of miR-149, STAT3 expression quantity in CRC patient tumor tissues and CRC cell is significantly higher than normal group
It knits and cell.The influence of miR-149 and its target gene to CRC cell is analyzed using cell in vitro method.As a result, it has been found that miR-149
Inhibit proliferation, invasion and the migration of colorectal cancer cell by targeting STAT3.In addition, miR-149 is promoted by targeting STAT3
The apoptosis of colorectal cancer cell.Therefore, miR-149 and its target gene STAT3 is a target for the treatment of of colorectal cancer.
The application in colorectal cancer is product or drug in preparation prevention or treatment colorectal cancer related disease
In application.MiR-149 promotes the transfer of colorectal cancer and the migration of colorectal cancer cell by acting on STAT3, this is
The treatment of colorectal cancer provides a kind of new approaches.
The application in colorectal cancer is the application in terms of the proliferative capacity for reducing colorectal cancer cell.Invention
People is detected using cell Proliferation, it was demonstrated that miR-149 can inhibit the proliferation of colorectal cancer cell by targeting STAT3, can be used in
In terms of the proliferative capacity for reducing colorectal cancer cell.
The application in colorectal cancer is the application in terms of the invasive ability for reducing colorectal cancer cell.Invention
People is detected using cell invasion, it was demonstrated that miR-149 inhibits the invasion of colorectal cancer cell by targeting STAT3, and can be used in reduces
In terms of the invasive ability of colorectal cancer cell.
The application in colorectal cancer is the application in terms of the migration for inhibiting colorectal cancer cell.Inventor adopts
With cell scratch detection, it was demonstrated that miR-149 inhibits the migration of colorectal cancer cell by targeting STAT3, and it is straight can be used in reduction knot
In terms of the transfer ability of colon-cancer cell.
The application in colorectal cancer is the application in terms of the apoptosis for promoting colorectal cancer cell.Inventor adopts
It is detected with Apoptosis, it was demonstrated that miR-149 promotes the apoptosis of colorectal cancer cell by targeting STAT3, can be used in and promote knot straight
In terms of the apoptosis of colon-cancer cell.
The application in colorectal cancer is the application in prevention, the diagnosis of colorectal cancer cell.MiRNAs is in recent years
Carry out one of the hot spot of biological study, and oncology then find miRNAs gene multidigit in some fragile site areas, this
The generation of a little regions and tumour is closely related, thus it is important to prompt miRNAs that may play during tumor development
Make.Since the expression difference of miRNAs between different individual patients is smaller, the detection method of miRNAs is also simple and easy.Cause
This, miRNAs can be used as the ideal biological marker of tumour, have great importance for the detection and screening of tumour.Due to
STAT3 expression quantity in CRC patient tumor tissues and CRC cell is significantly higher than normal tissue and cell, therefore, miR-149,
And its target gene STAT3 can be used for the prevention of tumour, diagnosing and treating.
Compared with prior art, the technical effect of the invention is embodied in:
(1) inventor is the study found that miR-149 belongs to the more sensitive microRNA of methylation, in colorectal cancer, hair
Wave the effect of tumor suppressor gene.4 (the human of human epididymal albumen encoded such as miR-149 by lowering WFDC2 gene
Epididymis protein4, HE4) expression, regulation colorectal cancer patients are to the sensibility of different radioactive radiation treatments.
(2) inventor has found that miR-149 expression in colorectal cancer patients and CRC cell is substantially less than normal
Tissue and Colon and rectum epithelial cell, miR-149 low expression imply the poor prognosis of colorectal cancer patients.MiR-149 passes through effect
Promote the transfer of colorectal cancer and the migration of colorectal cancer cell in STAT3, this provides a kind of new for the treatment of colorectal cancer
Thinking.
(3) inventor confirms that STAT3 is a target gene of miR-149 using luciferase assay, and STAT3 is in CRC
Expression quantity is significantly higher than normal tissue and cell in specimens and CRC cell.It is analyzed using cell in vitro method
The influence of miR-149 and its target gene to CRC cell.As a result, it has been found that miR-149 inhibits colorectal cancer cell by targeting STAT3
Proliferation, invasion and migration.In addition, miR-149 promotes the apoptosis of colorectal cancer cell by targeting STAT3.Therefore, miR-
149 and its target gene STAT3 can be used as a target for the treatment of of colorectal cancer.
Detailed description of the invention
Fig. 1 is expression of the miR-149 in colorectal cancer cell.P < 0.01 *, compared with FHC group.
Fig. 2 is expression of the miR-149 in Colorectal Carcinoma.P < 0.01 *, compared with normal tissue.
Fig. 3 is regulating and controlling effect of the luciferase element Activity determination miR-149 to STAT3 target sequence.P < 0.01 *, with 3
' UTRcontrol group is compared.
Fig. 4 is the expression of miR-149 negative regulation STAT3.A: fluorescence real-time quantitative PCR detects STAT3mRNA and expresses water
It is flat；B-C:Westernblot detects STAT3 protein expression level.P < 0.01 *, compared with respective miR-NC group.
Fig. 5 is the proliferation of CCK-8 method detection colorectal cancer cell.
Fig. 6 is the invasion of Transwell method detection colorectal cancer cell.P < 0.01 *, compared with respective miR-NC group, ##
P < 0.01, compared with respective mimics+pEGFP/STAT3 group.
Fig. 7 is the migration of scarification detection colorectal cancer cell.P < 0.01 *, compared with respective miR-NC group, ##p <
0.01, compared with respective mimics+pEGFP/STAT3 group.
Fig. 8 is the apoptosis of flow cytometry detection colorectal cancer cell.P < 0.01 *, compared with miR-NC group, ##p <
0.01, compared with mimics+pEGFP/STAT3 group.
Specific embodiment
It is limited below with reference to specific embodiment technical solution of the present invention is further, but claimed
Range is not only limited to made description.
Embodiment
Experimental method
(1) tissue samples
Colorectal cancer patients tissue samples 100 are collected, in vitro tissue samples through liquid nitrogen flash freezer, are stored in -80 immediately
DEG C ultra low temperature freezer.Tissue samples are confirmed as Colorectal Carcinoma through Histopathological examination.
(2) cell culture
SW620, LS174T and normal people's colon epithelial cell FHC come from Shanghai Cell Bank of the Chinese Academy of Sciences.CRC cell
Culture is in containing 10% fetal calf serum RPMI, 1640 culture medium, constant temperature incubation.Constant temperature incubation condition is 5%CO2,37 DEG C.
(3) RNA extracting and fluorescence real-time quantitative PCR
Take tissue samples 500mg, 1mLTrizol is added, concussion is mixed at powdered and be transferred in EP pipe in liquid nitrogen grinding
It is even, 5min is stood on ice.4 DEG C of 12 000rpm is centrifuged 10min.Supernatant is transferred in new EP pipe, stands 15min on ice.Add
It is violent to enter 0.2ml chloroform, overturns 15s, then stands 5min on ice.4 DEG C of 12 000rpm is centrifuged 15min.Supernatant is transferred to separately
In one new EP pipe.It is added isometric isopropanol (0.5mL), -20 DEG C of standing 30min precipitate RNA.4 DEG C of 12 000rpm centrifugation
10min.It is added the processed ethyl alcohol of 1mL75%DEPC (pre-cooling), 4 DEG C of 7500rpm are centrifuged 5min.30 μ l RNAase are added
Free water dissolves RNA.Total serum IgE quality is identified using agarose gel electrophoresis, total rna concentration detection uses spectrophotometer
It is measured.The total serum IgE of extraction carries out reverse transcription reaction.Real-time fluorescence quantitative PCR reaction detection simultaneously combines 2- △ △ Ct method point
Analyse miR-149 expression quantity.
In step (3), RNA extraction agent is Trizol (Invitrogen company, the U.S.)；Reverse transcription reagent box and in real time
PCR kit for fluorescence quantitative is purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd；PCR primer is purchased from Suzhou Ji Ma gene stock
The synthesis of part Co., Ltd.Primer control sequence is U6；MiR-149-RT sequence is (5 ' --- 3 ')
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAGT；MiR-149-F sequence is
(5'---3')GGCTCTGGCTCCGTGTCTT；MiR-149-R sequence is (5 ' --- 3 ') CAGTGCAGGGTCCGAGGTATT；
U6-RT sequence is (5 ' --- 3 ')
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT；U6-F sequence be (5 ' ---
3')CAAATTCGTGAAGCGTTCCATA；U6-R sequence is (5 ' --- 3 ') AGTGCAGGGTCCGAGGTATTC.
(4) luciferase reporter gene detects
STAT3 gene complete 3 ' UTR is building up on pGL3 promotor carrier.Site-directed mutagenesis kit carries out 3
' the direct mutagenesis in the site UTR.By pGL3/STAT3wt, pGL3/STAT3mut report carrier built respectively with miR-149
Mimics, miR-149-NC cotransfection are into SW620 cell, lytic cell after 48h, and the detection of Dual-Luciferase detection kit is glimmering
Light element enzymatic activity.
In step (4), pGL3 promotor carrier comes from Pu Luomaige (Beijing) Bioisystech Co., Ltd.miR-149
Mimics sequence is (5 ' --- 3 ')
UCUGGCUCCGUGUCUUCACUCCC；MiR-149-NC sequence is (5 ' --- 3 ')
GGGAGUGAAGACACGGAGCCAGA, sequence are provided by Guangzhou Ribo Bio Co., Ltd..
(5) cell transfecting
Using PCR method amplification people STAT3 gene (NM_139276.2) open reading frame (Open Reading Frame,
ORF), PCR product is building up to after purification on expression vector pEGFP-C1, and recombinant plasmid is named as pEGFP/STAT3.Take logarithm raw
Long-term SW620, LS174T cell inoculation is cultured in 6 orifice plates for 24 hours, transfects miR- respectively using Lipofectamine 2000
149 mimics, plasmid pEGFP/STAT3 and respective control sequence or carrier are parallel to repeat three groups in cell.
SW620, LS174T cell concentration are 5 × 105A/hole.
(6) cell Proliferation detects
SW620, LS174T cell after transfection is suspended in CCK-8 solution, cultivates 4h in 37 DEG C of constant incubators,
Optical density OD value is detected at 450nm.CCK-8 solution concentration is 10%.
(7) cell invasion detects
SW620, LS174T cell after digestion transfection, is resuspended in serum free medium, is inoculated into covering
The small interior in the upper layer Transwell.Take out cell, the fixed cell 15min of the mixed liquor of formaldehyde and acetic acid afterwards for 24 hours, PBS cleaning is wiped
Remove not pass through the cell of cell film.Crystal violet is dyed, and is rinsed after dyeing using PBS.It randomly chooses under 3 field microscopes
Counting of taking pictures is carried out, the cell number averagely invaded under each visual field is calculated.The wherein final concentration of 1mg/mL of Matrigel.
(8) cell scratch
SW620, LS174T cell after transfection, is added to 6 orifice plates, is incubated overnight.With the pipette tips of 10 μ L in cell monolayer
Upper to draw horizontal line, PBS is washed 3 times, washes away the cell to fall off.The width of scratch is taken pictures and calculated under microscope, and culture further takes out afterwards for 24 hours
Take pictures and measure again the width of scratch.Wherein each group concentration of cell suspension to be measured is 1 × 106A/mL.
(9) Apoptosis detects
PBS washs each group cell to be measured, and group of cells is diluted to 1 × 10 using 1 × Binding buffer6A/mL
Cell suspension.AnnexinV-fluorescein isothiocyanate (FITC) is added into group of cells suspension, room temperature
Under mix gently, be incubated for 10min.It is added propidium iodide (propidium iodide, PI), continuation is incubated for 5min at room temperature.Benefit
It is detected with the cell that flow cytometer dyes each group.
(10) protein immunoblotting
CRC cell after PBS cleaning transfection, RIPA lysate lytic cell.Protein concentration is measured using BCA method.SDS-
Skim milk is added after transferring film and is closed for the albumen that PAGE electrophoresis detection is extracted.Primary antibody, 4 DEG C of overnight incubations is added, TBST delays
Fliud flushing washes film.Secondary antibody is added, is incubated at room temperature 1h, develops.Wherein, RIPA lysate composition are as follows: 50mM Tris-Cl,
150mM NaCl, 1%TritonX-100,0.1%SDS；Skimmed milk concn is 5%.
(11) data processing method
The statistical analysis of data is carried out using 16.0 statistical software of SPSS.Measurement data is indicated with x ± s.Data between group
Difference is examined using the Student's t of bilateral sample.P < 0.05 is that difference has statistical significance.
Experimental result:
Step (3) acquired results, miR-149 expression pattern in colorectal cancer cell, particular content are as follows:
MiR-149 expression in the real-time detection of q-PCR method colorectal cancer cell SW620, LS174T.As the result is shown
The expression of miR-149 is significantly lower than normal colon epithelial cell FHC, difference in colorectal cancer cell system SW620, LS174T
With conspicuousness (P < 0.01) (Fig. 1).
Step (4) acquired results, miR-149 targeting combine STAT3, and particular content is as follows:
By the wild type STAT3 3 ' UTR of building and saltant type STAT3 3 ' UTR fluorescence report carrier respectively with miR-149
After cotransfection to SW620 cell, uciferase activity is detected, as a result as shown in Fig. 2, open country can be lowered after being overexpressed miR-149
The life type STAT3 3 ' uciferase activity (P < 0.01) of UTR, and the uciferase activity for transfecting saltant type STAT3 3 ' UTR does not have
There is generation significant change.These experimental results imply that miR-149 complementary with 3 ' UTR of STAT3 can be combined.
Step (5) acquired results, miR-149 inhibit the expression of colorectal cancer cell STAT3, and particular content is as follows:
MiR-149 mimics transfects colorectal cancer cell, detects the expression of STAT3.Q-PCR and Western
Blot testing result shows to transfect STAT3 mRNA and albumen table in SW620 and the LS174T cell of miR-149 mimics
Significant decrease (P < 0.01) (Fig. 3) has occurred compared with miR-NC group up to level.
Step (6) acquired results, miR-149 inhibit the proliferation of colorectal cancer cell by targeting STAT3, and particular content is such as
Under:
MiR-149 mimics, mimics-NC and miR-149 mimics+pEGFP/STAT3 are transfected to SW620 cell
Afterwards, CCK-8 method analyzes cell Proliferation feature.As a result, it has been found that miR-149 mimic group cell Proliferation multiple is substantially less than miR-NC
(P<0.05)；Compared with miR-149 mimic group, miR-149 mimics+pEGFP/STAT3 group cell Proliferation multiple significantly increases
Add (P < 0.05) (Fig. 4).These results indicate that miR-149 inhibits the proliferation of colorectal cancer cell by targeting STAT3.
Step (7) acquired results, miR-149 inhibit the invasion of colorectal cancer cell by targeting STAT3, and particular content is such as
Under:
Transwell method has detected colorectal cancer cell invasion situation.As shown in figure 5, the invasion cell under each visual field
Number is substantially less than miR-NC group (P < 0.01) in miR-149 mimic group；Under each visual field of mimics+pEGFP/STAT3 group
Invasion cell number be higher than miR-149 mimic group (P < 0.01).Therefore, it is thin can to target STAT3 inhibition colorectal cancer by miR-149
The invasion of born of the same parents.
Step (8) acquired results, miR-149 inhibit the migration of colorectal cancer cell by targeting STAT3, and particular content is such as
Under:
Colorectal cancer cell carries out the analysis of cell scratch experiment, as Fig. 6 cell heals the results show that in colorectal cancer cell
In SW620 and LS174T cell, transfection miR-149 group cell migration is substantially less than miR-NC group cell (P < 0.01).On the contrary,
The migration of mimics+pEGFP/STAT3 group cell is significantly higher than miR-149 mimics group (P < 0.01).Therefore, miR-149 target
It can inhibit the migration of colorectal cancer cell to STAT3.
Step (9) acquired results, miR-149 promote the apoptosis of colorectal cancer cell by targeting STAT3, and particular content is such as
Under:
Flow cytometric analysis transfection miR-NC, mimics-NC, miR-149 mimics+pEGFP/STAT3 each group are thin
Born of the same parents' apoptosis situation.As a result as shown in fig. 7, the apoptosis rate of miR-149mimic group is significantly higher than miR-NC group (P < 0.01),
And mimics+pEGFP/STAT3 group Apoptosis is then substantially less than miR-149 mimics group (P < 0.01).It can be seen that
MiR-149 can promote the apoptosis of colorectal cancer cell by targeting STAT3.
The above result shows that STAT3 is a target gene of miR-149, STAT3 is in CRC patient tumor tissues and CRC
Expression quantity is significantly higher than normal tissue and cell in cell；MiR-149 inhibits the increasing of colorectal cancer cell by targeting STAT3
It grows, invade and migrates.In addition, miR-149 promotes the apoptosis of colorectal cancer cell by targeting STAT3.Therefore, miR-149 and
Its target gene STAT3 is a target for the treatment of of colorectal cancer.
Finally it is pointed out that above embodiments are only the more representational examples of the present invention.Obviously, technology of the invention
Scheme is not limited to above-described embodiment, and acceptable there are many deformations.Those skilled in the art can be from disclosed by the invention
All deformations that content is directly exported or associated, are considered as protection scope of the present invention.
Claims (8)
1. a kind of application of microRNA and its target gene in colorectal cancer, which is characterized in that the microRNA is miR-
149。
2. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Target gene is target gene STAT3.
3. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in the product or drug of preparation prevention or treatment colorectal cancer related disease.
4. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in terms of the proliferative capacity for reducing colorectal cancer cell.
5. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in terms of the invasive ability for reducing colorectal cancer cell.
6. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in terms of the migration for inhibiting colorectal cancer cell.
7. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in terms of the apoptosis for promoting colorectal cancer cell.
8. the application of microRNA according to claim 1 and its target gene in colorectal cancer, which is characterized in that described
Application in colorectal cancer is the application in prevention, the diagnosis of colorectal cancer cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910142349.1A CN109758471A (en) | 2019-02-26 | 2019-02-26 | A kind of application of microRNA and its target gene in colorectal cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910142349.1A CN109758471A (en) | 2019-02-26 | 2019-02-26 | A kind of application of microRNA and its target gene in colorectal cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109758471A true CN109758471A (en) | 2019-05-17 |
Family
ID=66456536
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910142349.1A Pending CN109758471A (en) | 2019-02-26 | 2019-02-26 | A kind of application of microRNA and its target gene in colorectal cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109758471A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005078139A2 (en) * | 2004-02-09 | 2005-08-25 | Thomas Jefferson University | DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES |
| CN100999765A (en) * | 2006-12-20 | 2007-07-18 | 南京大学 | Biological chip of identifying colon canceration degree using microchanging of RNA |
| WO2012048236A1 (en) * | 2010-10-08 | 2012-04-12 | Baylor Research Institute | Micrornas (mirna) as biomakers for the identification of familial and non-familial colorectal cancer |
| CN102933719A (en) * | 2009-12-24 | 2013-02-13 | 复旦大学 | Compositions and methods for microrna expession profiling in plasma of colorectal cancer |
| CN106661619A (en) * | 2014-06-13 | 2017-05-10 | 东丽株式会社 | Colorectal cancer detection kit or device, and detection method |
-
2019
- 2019-02-26 CN CN201910142349.1A patent/CN109758471A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005078139A2 (en) * | 2004-02-09 | 2005-08-25 | Thomas Jefferson University | DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES |
| CN100999765A (en) * | 2006-12-20 | 2007-07-18 | 南京大学 | Biological chip of identifying colon canceration degree using microchanging of RNA |
| CN102933719A (en) * | 2009-12-24 | 2013-02-13 | 复旦大学 | Compositions and methods for microrna expession profiling in plasma of colorectal cancer |
| WO2012048236A1 (en) * | 2010-10-08 | 2012-04-12 | Baylor Research Institute | Micrornas (mirna) as biomakers for the identification of familial and non-familial colorectal cancer |
| CN106661619A (en) * | 2014-06-13 | 2017-05-10 | 东丽株式会社 | Colorectal cancer detection kit or device, and detection method |
Non-Patent Citations (6)
| Title |
|---|
| OSTER, B ET AL: "Non-CpG island promoter hypomethylation and miR-149 regulate the expression of SRPX2 in colorectal cancer", 《INTERNATIONAL JOURNAL OF CANCER》 * |
| WANG, F ET AL.: "SP1 mediates the link between methylation of the tumour suppressor miR-149 and outcome in colorectal cancer", 《JOURNAL OF PATHOLOGY》 * |
| ZHOU, W ET AL.: "Novel long noncoding RNAGACAT3 promotes colorectal cancer cell proliferation, invasion, and migration through miR-149", 《ONCOTARGETS AND THERAPY》 * |
| 刘晓柱 等: "miR-149抑制结直肠癌细胞迁移的分子机制研究", 《天津医药》 * |
| 吴冬冬 等: "Has-miR-149基因多态性与消化道肿瘤易感性的研究", 《重庆医学》 * |
| 张孟 等: "SRPX2 的功能及其在肿瘤发生发展中的作用", 《中国生物化学与分子生物学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Loss of exosomal miR-320a from cancer-associated fibroblasts contributes to HCC proliferation and metastasis | |
| Liu et al. | MicroRNA-21 acts as an oncomir through multiple targets in human hepatocellular carcinoma | |
| Zhang et al. | microRNA-21 promotes tumor proliferation and invasion in gastric cancer by targeting PTEN | |
| Behrend et al. | Manganese superoxide dismutase induces p53-dependent senescence in colorectal cancer cells | |
| Sheng et al. | SP1-induced upregulation of lncRNA PANDAR predicts adverse phenotypes in retinoblastoma and regulates cell growth and apoptosis in vitro and in vivo | |
| Tian et al. | SNHG1 promotes cell proliferation by acting as a sponge of miR-145 in colorectal cancer | |
| Li et al. | Long noncoding RNA NR2F1-AS1 enhances the malignant properties of osteosarcoma by increasing forkhead box A1 expression via sponging of microRNA-483-3p | |
| Zhang et al. | MiR-767 promoted cell proliferation in human melanoma by suppressing CYLD expression | |
| Wu et al. | Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition | |
| Yu et al. | MicroRNA-129-5p suppresses nasopharyngeal carcinoma lymphangiogenesis and lymph node metastasis by targeting ZIC2 | |
| Ma et al. | LncRNA FER1L4 suppressed cancer cell growth and invasion in esophageal squamous cell carcinoma. | |
| Cao et al. | Regulation and functional role of eEF1A2 in pancreatic carcinoma | |
| Jiang et al. | MiRNA-15a-3p inhibits the metastasis of hepatocellular carcinoma by interacting with HMOX1 | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| Zhang et al. | MiR-212-3p suppresses high-grade serous ovarian cancer progression by directly targeting MAP3K3 | |
| Zhou et al. | Long non-coding RNA CASP5 promotes the malignant phenotypes of human glioblastoma multiforme | |
| Zhou et al. | RETRACTED ARTICLE: miR-506 contributes to malignancy of cutaneous squamous cell carcinoma via targeting of P65 and LAMC1 | |
| Yu et al. | The octamer-binding transcription factor 4 (OCT4) pseudogene, POU domain class 5 transcription factor 1B (POU5F1B), is upregulated in cervical cancer and down-regulation inhibits cell proliferation and migration and induces apoptosis in cervical cancer cell lines | |
| Gao et al. | Circular RNA MYLK promotes hepatocellular carcinoma progression through the miR29a/KMT5C signaling pathway | |
| Li et al. | CircSOS2 promotes cervical squamous cell carcinoma by regulation of proliferation, cell cycle, apoptosis, migration, invasion, and glycolysis by targeting miR-543/FNDC3B axis | |
| Kong et al. | Long noncoding RNA WDFY3‐AS2 represses the progression of esophageal cancer through miR‐18a/PTEN axis | |
| Che et al. | RETRACTED: MicroRNA-27 Inhibits Autophagy and Promotes Proliferation of Multiple Myeloma Cells by Targeting the NEDD4/Notch1 Axis | |
| CN110317872A (en) | It is used to prepare the molecular marked compound and kit of detection, prognosis and Diagnosis of Breast cancer product | |
| Chen et al. | Long noncoding RNA LAMTOR5-AS1 interference affects microRNA-506-3p/E2F6-mediated behavior of non-small cell lung cancer cells | |
| CN109758471A (en) | A kind of application of microRNA and its target gene in colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190517 |