CN109748971A - A kind of ELISA antibody assay kit of duck tembusu virus and its application - Google Patents
A kind of ELISA antibody assay kit of duck tembusu virus and its application Download PDFInfo
- Publication number
- CN109748971A CN109748971A CN201910069667.XA CN201910069667A CN109748971A CN 109748971 A CN109748971 A CN 109748971A CN 201910069667 A CN201910069667 A CN 201910069667A CN 109748971 A CN109748971 A CN 109748971A
- Authority
- CN
- China
- Prior art keywords
- duck
- specific antigen
- protein
- antigen epitope
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of ELISA antibody assay kit of duck tembusu virus and its applications.It include the smooth cloth virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen of duck in the kit, the recombination fusion specific antigen epitope albumen is obtained after the specific antigen epitope albumen of duck tembusu virus E protein as shown in SEQ ID NO.1 is connect with the specific antigen epitope albumen of duck tembusu virus E protein shown in SEQ ID NO.2 by flexible peptide.The present invention is connected into fused antigen using the epitope of duck tembusu virus E protein specificity, high specificity, only there is sensibility to DTMUV positive serum, to duck other type Disease Positive Serums such as (DHV-I, DEV, MDPV) and the positive serums such as DENV, JEV, WNV, ZIKV do not have sensibility.In addition, simple and easy and highly-safe using kit detection DTMUV of the invention, envelope antigen is epitope series connection peptide fragment, is easier to obtain relative to E protein, and higher relative to totivirus method for coating safety.
Description
Technical field
The present invention relates to a kind of ELISA antibody assay kit of duck Tan Busu disease and its applications, and the invention belongs to immune
Learn technical field.
Background technique
Duck tembusu virus disease is a kind of urgency caused by duck tembusu virus (Duck tembusu virus, DTMUV)
Sexually transmitted disease, the disease regional the first explosion in south China in 2010, subsequent disease, which is propagated rapidly, jeopardizes all parts of the country
Duck farm, causes huge economic losses.Two kinds are primarily present for the diagnostic method of duck tembusu virus disease at present, first
Kind is molecular biological testing, its basic principle is that the amplimer of specificity is designed according to nucleic acid sequence,
Target fragment of the cDNA of virus as template using round pcr amplification viral nucleic acid is obtained using reverse transcription, to detect virus
Method, second is serological diagnostic method, it is main wrap indirect immunofluorescence assay living (Immunonuorescence assay,
IFA), enzyme-linked immunosorbent assay (Enzyme-linked immunosorbent assay, ELISA), principle are to utilize antibody
After in conjunction with antigen part corresponding in virus, recycles the secondary antibody of specific markers to have an effect with bound antibody, pass through
Fluorescence microscope reads OD value and deduces the presence of antigen.But in place of the equal Shortcomings of both the above detection method:
(1) molecular biological testing is higher for the instrument requirements of experiment, and laboratory is suitble to carry out the detection of cause of disease and be not suitable for
Large-scale clinical detection；(2) in serological diagnostic method, indirect immunofluorescence experiment (IFA) is to experimental material and facility
Also require that higher, therefore generally without in clinical detection, and ELISA diagnostic method is usually common clinical diagnosis side
Method, this method is simple, efficiently, can detect large-scale sample simultaneously, but laboratory is established at present ELISA diagnostic method and
The kit of commercialization mostly selects the duck tembusu virus of purifying inactivation or duck tembusu virus E protein to carry out as antigen
Coating, these method high sensitivities, sensibility are preferable, but there are problems that maximum one is exactly cross reactivity, due to the smooth cloth of duck
Soviet Union's virus belongs to flaviviridae Flavivirus, and the homology between each virus E protein of Flavivirus is higher, therefore either sharp
The ELISA diagnostic method established with totivirus or E protein all other viruses can generate cross reaction phenomenon with Flavivirus.
It is to cause immune answer that epitope (Epitope), which is also known as antigenic determinant (Antigenic determinant, AD),
The material base answered, can and serum in antibody occur specificity combination, therefore using virus protein specificity antigen
The serology ELISA diagnostic method that epitope is established, the advantages of having its own and particularity, that is, reduce the shadow of unrelated interruptions sequence
It rings, and enhances its specificity.The smooth cloth virus E protein Epitope-ELISA diagnostic method of duck is a species specific detection method,
Only there is sensibility to DTMUV positive serum, and to other type Disease Positive Serums of duck (duck hepatitis, duck plague, kind duck are tiny)
And the positive serums such as DENV, JEV, WNV, ZIKV do not have sensibility.
Summary of the invention
The technical problem to be solved by the present invention is to provide the ELISA diagnostic kits of detection duck tembusu virus antibody.
It is an object of the invention to anti-according to there is intersection in existing duck tembusu virus disease ELISA antibody detection method
The problems such as Ying Xing, specificity be not strong and testing result lacks accuracy provides a kind of anti-using the smooth cloth virus E protein specificity of duck
Former epitope as detection antigen duck tembusu virus ELISA antibody diagnosing reagent kit, the kit have species specificity by force and
The strong feature of immunogenicity.
In order to achieve the above object, present invention employs following technological means:
Firstly, the monoclonal antibody 1A5 of the two plants of anti-duck tembusu virus E proteins prepared early period using the present inventor with
The identification of 4E9 progress epitope.For monoclonal antibody 1A5 and 4E9, we purify it using affinity column,
And its epitope YAEYI and SGKG are identified using display technique of bacteriophage.Dot-Blotting epitope as the result is shown
YAEYI and SGKG is duck tembusu virus E protein specific antigen epitope, and cross reaction is not present between other flavivirus serum
Property, and cross reactivity is also not present in other virosis positive serums with duck, high specificity, therefore two specific antigen tables
Position can be used for the foundation of specific ELISA antibody diagnosis method.
The nucleotide sequence of following artificial antigen epitope, and a Gly-Ser (sweet ammonia is added between two epitopes
Acid-serine) flexible peptide is attached, the nucleotide sequence of synthesis is connected on pGEX-6P-1 plasmid vector, with large intestine bar
The high copy recon of bacterium DH5 α screening, by recombinant plasmid transformed e. coli bl21 (DE3), to construct recombination bacillus coli
Recombination bacillus coli BL21 (DE3) engineering bacteria is carried out protein expression under IPTG induction, passed through by BL21 (DE3) engineering bacteria
Column purification is cut glue and is purified and (since the epitope that is screened is linear epitope, do not deposit conformation relationship, therefore cut glue
Purifying does not influence its antigenicity), obtain the specific antigen epitope albumen of amalgamation and expression.
Finally, the recombination fused antigen neoepitope Western coated elisa plate of purifying is established indirect ELISA detection method.Weight
The determination of group antigen most suitable peridium concentration and serum optimal dilution: recombinant antigen carbonate buffer solution is diluted into different gradients
Every 100 μ L of hole is coated in 96 orifice plates afterwards, and 4 DEG C overnight, and duck tembusu virus standard positive and negative serum carries out doubling dilution composition side
Battle array, result judgement P/N value (standard positive serum OD450Nm/ standard female serum OD450It nm is most suitable antigen-antibody work when) maximum
Make concentration.Best confining liquid selection: bright with 5%w/w polyvinyl alcohol, 5%w/w skimmed milk, 1%w/w BSA, 1%w/w respectively
Glue, 2%w/w ovalbumin solution close elisa plate as confining liquid, detect to blood serum sample, and P/N value is maximum
The best confining liquid of Shi Zewei.The determination of serum and secondary antibody most suitable working time: 96 holes are coated with the recombinant antigen of optimal dilution
The standard positive serum of optimal dilution is added in ELISA Plate, will be respectively set as action time 37 DEG C of 30min, 45min,
60min, 90min are serum and antibody most suitable action time when P/N value maximum.The determination of indirect ELISA yin and yang attribute critical value:
According to the ELISA optimum reaction condition of test establishment, 25 parts of duck DTMUV negative serum samples are detected, are calculated according to result
The OD of negative sample450The average and standard deviation of nm determines the critical value of yin and yang attribute standard, yin and yang attribute critical value=feminine gender sample
Product average value ± 3 × standard deviation.
On the basis of the studies above, firstly, the invention proposes a kind of smooth cloth virus E protein recombination fusion specificity of duck
Epitope protein, the recombination fusion specific antigen epitope albumen is the disease of the duck Tan Busu as shown in SEQ ID NO.1
The specific antigen table of duck tembusu virus E protein shown in the specific antigen epitope albumen and SEQ ID NO.2 of malicious E protein
Position albumen obtains after passing through flexible peptide connection.
Wherein, the specific antigen epitope albumen of duck tembusu virus E protein shown in preferred SEQ ID NO.1 with
The specific antigen epitope albumen of duck tembusu virus E protein shown in SEQ ID NO.2 is connected by Gly-Ser flexibility peptide
It connects, the amino acid sequence of the recombination fusion specific antigen epitope albumen is as shown in SEQ ID NO.3.
Further, the invention also provides recombination fusion specific antigen epitope albumen in the smooth cloth disease of preparation duck
Purposes in malicious antibody test reagent.
Further, the invention also provides a kind of ELISA detection kit of duck tembusu virus, the kits
In include the duck smooth cloth virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen, the recombination fusion is anti-
Former neoepitope Western is the specific antigen epitope albumen Yu SEQ ID of the duck tembusu virus E protein as shown in SEQ ID NO.1
The specific antigen epitope albumen of duck tembusu virus E protein shown in NO.2 obtains after passing through flexible peptide connection.
In the ELISA antibody assay kit, it is preferred that the smooth cloth virus E protein recombination fusion specificity of duck is anti-
The peridium concentration of former neoepitope Western is 6.4 μ g/mL, and confining liquid is 1%w/w BSA solution.
It further include washing buffer, sample diluting liquid, ELIAS secondary antibody, bottom in the ELISA antibody assay kit
Object developing solution and terminate liquid.
In the ELISA antibody assay kit, the washing buffer is the 10mM containing 0.5%Tween-20
PBST, pH 7.4；The sample diluting liquid is the 10mmol/L PBST containing 0.05%Tween-20, pH value 7.4；The enzyme
Mark secondary antibody is the goat-anti duck IgG of horseradish peroxidase (HRP) label；The substrate developing solution is the 3,3' of 0.01%w/w, 5,
5'- tetramethyl biphenyl amine aqueous solution；The terminate liquid is 2M sulfuric acid solution.
When being used for the antibody test of duck tembusu virus using the ELISA antibody assay kit, according to the following steps
It carries out:
(1) by the smooth cloth virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen of duck in kit and
Various solution are placed under room temperature and rise again；
(2) be loaded: 100 μ l, the conduct pair of standard positive and negative serum is added in every hole after diluting serum to be checked with sample diluting liquid
According to ELISA Plate is placed in 37 DEG C of effect 1h, is then dried, every hole adds 300 μ L washing buffers to wash 3~5 times；
(3) add ELIAS secondary antibody: the goat-anti duck IgG100 μ L that every hole addition is marked with the HRP that sample diluting liquid has diluted, it will
ELISA Plate is placed in room temperature or 37 DEG C of effect 1h, then dries, every hole adds 300 μ L elution buffers to wash 3~5 times；
(4) add developing solution: 100 μ l of TMB developing solution is added in every hole, and ELISA Plate room temperature is protected from light colour developing；
(5) add terminate liquid: 100 μ l of sulfuric acid terminate liquid is added in every hole；
(6) it surveys OD value: ELISA Plate being put into enzyme detector and measures each hole OD450nm value；
(7) result judgement.
Wherein, it is preferred that the maximum dilution multiple of serum to be checked is 1:80 in step (2)；HRP is marked in step (3)
The dilution of goat-anti duck IgG is 1:1500；Developing time described in step (4) is 10~30min, and preferably developing time is
10min；Testing result, judgment method are judged according to absorbance value in step (7) are as follows: if absorbance value is greater than or equal to
0.189, then it is the DTMUV positive, it is negative for DTMUV if absorbance value is less than 0.189.
Compared with prior art, the invention has the following advantages:
(1) high specificity: duck tembusu virus is flavivirus, and there are cross reactivities between flavivirus positive serum, originally
The detection method established is invented due to the epitope using duck tembusu virus E protein specificity, high specificity is only right
DTMUV positive serum has sensibility, and to other type Disease Positive Serums of duck such as (DHV-I, DEV, MDPV) and DENV,
The positive serums such as JEV, WNV, ZIKV do not have sensibility.
(2) method is simple and highly-safe: coated antigen is epitope series connection peptide fragment, opposite to be easier to E protein
It obtains, and higher relative to the coated method security of totivirus.
Detailed description of the invention
Fig. 1 is monoclonal antibody epitope homology analysis result；
Wherein: A: monoclonal antibody 1A5 epitope homology analysis result；B: monoclonal antibody 4E9 epitope homology
Analyze result；
Fig. 2 is that epitope and flavivirus positive serum cross reactivity analyze result；
Fig. 3 is DTMUV specific antigen epitope and duck negative serum ELISA reaction result；
Fig. 4 is specific test result.
Specific embodiment
It elaborates with reference to the accompanying drawing to specific embodiment provided by the invention.Those skilled in the art
It is contemplated that a variety of modifications and adaptations carried out, without changing the spirit or scope of the present invention.This modifications and adaptations include
Within the scope of the invention.Following embodiments are not limit the invention in any way.
The preparation of 1 recombination epitope envelope antigen of embodiment
1. the identification of epitope
The monoclonal antibody 1A5 and 4E9 of the two plants of anti-duck tembusu virus E proteins prepared early period using the present inventor are carried out
The identification of epitope.1A5 and 4E9 antibody is purified using affinity column Protein G, utilizes phage display skill
Art, using the monoclonal antibody 1A5 and 4E9 of purifying as solid-phase screening molecule, screening positive plaque clone.It is bitten by analyzing the positive
12 peptide sequences of thallus clone's surface display obtain mimic epitope sequence.According to the mimic epitope sequence that phage selection goes out, close
At the oligonucleotide sequence 1A5F:5'aattctacgctgaatacatac3', 1A5R:5' of the epitope of 1A5 and 4E9
tcgagtatgtattcagcgtag 3'；4E9F:5'aattctccggaaagggac3' and 4E9R:5'
tcgagtccctttccggag3'.Xhol I restriction enzyme site is introduced at the end positive-sense strand 5', the end antisense strand 5' introduces EcoR I digestion
Site.Two complementary oligonucleotide chains, can form the DNA of double-strand after annealing, can directly handle with EcoR I and Xho I digestion
PGEX-6P-1 carrier connection.Correct recombinant plasmid will be sequenced and carry out induced epitope, the sample after expression is through SDS-PAGE electricity
After swimming, on electrotransfer to plain (NC) film of fiber nitric acid, verified through Western-Blot, as a result successful identification monoclonal antibody 1A5
The linear epitope YAEYI (SEQ ID NO.1 shown in) and SGKG targeted with 4E9 (shown in SEQ ID NO.2).
Representative flavivirus strain is chosen from GenBank, utilizes DNASTAR Lasergene
Program (DNASTAR Inc, Madison, WI, USA) carries out sequence alignment to the E protein of DTMUV and flavivirus,
With Analysis and Screening to DTMUV E protein homology of the linear epitope in flavivirus, the antigen table as a result screened
Position YAEYI and SGKG in duck tembusu virus with height conservative, no amino acid sites difference, and Flavivirus its
Do not have homology (Fig. 1) in his virus.
2. the cross reactivity of epitope is analyzed
The linear epitope of the DTMUV E protein arrived with Dot-Blotting Analysis and Screening is between flavivirus positive serum
Cross reactivity.Method: the epitope protein YAEYI and SGKG that amalgamation and expression is obtained take 5 μ L points on NC film, room
The dry 30min of temperature；With 5% skimmed milk (PBS), 37 DEG C of closing 1h, PBS is washed three times, every all over 5min；By DTMUV (duck source), JEV
(rabbit source), DENV (source of people), 1:10 times of positive serum of WNV (rabbit source) dilute, and 4 DEG C of overnight incubations, PBS is washed three times, every all over 5min；
The goat anti-human igg, goat-anti duck IgG, goat anti-rabbit igg secondary antibody of horseradish peroxidase (HRP) label are carried out 1:250 times to dilute,
37 DEG C of incubation 1h, PBS is washed three times, every all over 5min；DAB colour developing, as a result epitope protein YAEYI and SGKG is only positive with DTMUV
Property serum, which reacts, does not react (Fig. 2) with other flavivirus positive serums.
3. the inducing expression of recombinant expression plasmid and the acquisition of fusion protein
The nucleotide sequence of following artificial synthesized fused antigen neoepitope Western, 5 ' aattctacgctgaatac of positive-sense strand
Ataggaagctccggaaagggac3 ', antisense strand 5 ' tcgagtccctttccggagcttcctatgtattcagcgtag3 ', two
The flexible peptide of Gly-Ser (glycine-serine) is added between a epitope to be attached, at the same introduce restriction enzyme site EcoRI with
The nucleotide sequence of synthesis is connected on pGEX-6P-1 plasmid vector by Xho I, screens high copy recombination with bacillus coli DH 5 alpha
Son to construct recombination bacillus coli BL21 (DE3) engineering bacteria, will be weighed in recombinant plasmid transformed e. coli bl21 (DE3)
Group e. coli bl21 (DE3) engineering bacteria carries out protein expression under IPTG induction, passes through column purification or cut glue being purified
(since the epitope screened is linear epitope, not depositing conformation relationship, therefore cut glue purification not to influence its antigenicity),
The specific antigen epitope albumen of amalgamation and expression is obtained, amino acid sequence is as shown in SEQ ID NO.3.
Embodiment 2 carries out indirect enzyme-linked immunosorbent assay with recombination epitope albumen
1, the determination of antigen and primary antibody best effort concentration
It is dense with best peridium concentration and DTMUV positive serum optimum response of the matrix titration to antigen epitope fusion protein
Degree is determined.The DTMUV epitope fusion protein that embodiment 1 obtains is started to carry out with carbonate buffer solution according to 1:10
10 times of gradient dilutions are coated on elisa plate, and every hole adds the coating buffer of 100 μ L, and 4 DEG C of overnight incubations (are contained with washing buffer
The 10mM PBST, pH 7.4 of 0.5%v/v Tween-20) it washes three times.By 1% ox blood of 100 μ L of coated elisa plate
Albumin (BSA) closes 1h, reuses washing buffer and thoroughly cleans three times.Obtain the ELISA Plate of pre-coated antigen.Use sample
Product dilution (the 10mmol/L PBST containing 0.05%v/vTween-20, pH value 7.4) by DTMUV is positive and negative serum with
1:20 starts to carry out 2 times of gradient dilutions, and 100 μ L are added in every hole, and 37 DEG C incubate 1h.It is diluted with 1:1500 times using sample diluting liquid
The goat-anti duck IgG of HRP label carries out the incubation of secondary antibody, every hole 100 μ L, 37 DEG C of incubation 1h.Other steps according to ELISA program into
Row.Last tmb substrate developing solution, every hole add 50 μ L, in the 37 DEG C of incubations being protected from light colour developing 10min, with 2M H2SO4Terminate liquid stops
Colour developing, microplate reader 450nm read OD value.Criterion: positive serum (P)/negative serum value (N) > 2.1 is chosen, and positive
OD450It is albumen and serum that nm value, which is close to 1.0 or so epitope protein peridium concentration and the maximum dilution multiple of serum,
Best effort concentration.As a result: 6.4 μ g/mL are the best peridium concentration of neoepitope Western, and 1:80 is serum optimum diluting multiple (table 1).
The determination of table 1 antigen protein and serum optimum dilution degree
2. best confining liquid selection
Respectively with 5%w/w polyvinyl alcohol, 5%w/w skimmed milk, 1%w/wBSA, 1%w/w gelatin, 2%w/w ovalbumin
Elisa plate is closed as confining liquid, blood serum sample is detected, as a result such as table 2, as the result is shown when confining liquid is 1%
When w/wBSA, P/N value is 7.8 maximum, therefore best confining liquid is 1%w/ in the Epitope-ELISA detection method established
WBSA (table 2).
The determination of the best confining liquid of table 2
3. serum optimum reacting time determines
In the best effort concentration for determining epitope protein and serum, after best confining liquid, by serum incubation time point
Be not set to 37 DEG C of 45min, 37 DEG C of 60min, 37 DEG C of 75min, 37 DEG C of 90min, the results are shown in Table 3, when reacted between be 1h when, P/N
Value is maximum, is 7.53.Accordingly, determine that serum optimum reacting time is 1h (table 3).
3 serum optimum reacting time of table determines
The determination of secondary antibody 4. (the goat-anti duck IgG of HRP label) optimum reacting time
According to the above reaction condition, after the goat-anti duck IgG of HRP label is added, incubation time is respectively 37 DEG C of 45min, 37
DEG C 60min, 37 DEG C of 75min, 37 DEG C of 90min, when secondary antibody action time is 1h, P/N value is 7.643, is higher than other two anti-reflective
Testing result between seasonable determines therefrom that secondary antibody the best use time is 1h (table 4).
The determination of 4 ELIAS secondary antibody optimum reacting time of table
5. yin and yang attribute critical value determines
According to the ELISA optimum reaction condition of test establishment, 25 parts of duck DTMUV negative serum samples are detected, root
The OD of negative sample is calculated according to result450The average and standard deviation of nm, determines the critical value of yin and yang attribute standard, and yin and yang attribute is critical
Value=negative sample average value ± 3 × standard deviation.As a result according to result yin and yang attribute critical value=0.125 ± 3 × 0.0213.Finally
Show that yin and yang attribute critical value is 0.189.Testing result >=0.189 is the positive, and testing result < 0.189 is feminine gender, sees figure
3。
6. specific test result
With the specific antigen epitope ELISA detection method having built up to DHV-I, DEV, MDPV positive serum and
The detection of DENV, JEV, WNV flavivirus positive serum.DTMUV positive serum testing result is the positive, the inspection of other virus-positive serum
Surveying result is feminine gender, and OD value is less than 0.189.Illustrate the ELISA detection method and other virus-positive serum that this research is established
There is no cross reaction, specificity is relatively good, sees Fig. 4.
The composition and application method of 3 duck tembusu virus ELISA antibody assay kit of embodiment
The kit includes:
1, the smooth cloth virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen of duck: according to embodiment 1
Method preparation；
2, washing buffer: the 10mM PBST, pH 7.4 of the Tween-20 containing 0.5%v/v；
3, sample diluting liquid: the 10mM PBST, pH 7.4 of the Tween-20 containing 0.05%v/v；
4, ELIAS secondary antibody: the goat-anti duck IgG of HRP label；
5, substrate developing solution: the 3,3' of 0.01%w/w, 5,5'- tetramethyl biphenyl amine aqueous solution (TMB developing solution)；
6, terminate liquid: 2M sulfuric acid solution.
The application method of duck tembusu virus ELISA antibody assay kit:
1. by the smooth cloth virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen of duck in kit and
Various solution are placed under room temperature and rise again；
2. sample-adding: 100 μ l, standard positive and negative are added in every hole after diluting serum to be checked by 1:80 multiple with sample diluting liquid
ELISA Plate is placed in 37 DEG C of effect 1h, then dried, every hole adds 300 μ L washing buffers to wash 3~5 times by serum as control.
3. adding ELIAS secondary antibody: the goat-anti duck that every hole addition is marked with sample diluting liquid according to the 1:1500 times of HRP diluted
ELISA Plate is placed in room temperature or 37 DEG C of effect 1h, then dried, every hole adds 300 μ L elution buffers to wash 3~5 times by IgG100 μ L.
4. adding developing solution: 100 μ l of TMB developing solution is added in every hole, and ELISA Plate room temperature is protected from light 10min.
5. adding terminate liquid: 100 μ l of sulfuric acid terminate liquid is added in every hole.
6. surveying OD value: ELISA Plate being put into enzyme detector and measures each hole OD450nm value.
7, result judgement: OD45Testing result >=0.189 0nm is DTMUV positive, and testing result < 0.189 is
DTMUV is negative.
Sequence table
<110>Harbin Veterinary Medicine Inst., China Academy of Agriculture (China Animal Health and Epidemiology Center Harbin point
Center)
Harbin Weike Biologic Technology Ltd.
<120>a kind of ELISA antibody assay kit of duck tembusu virus and its application
<130> KLPI190030
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 5
<212> PRT
<213> Duck tembusu virus
<400> 1
Tyr Ala Glu Tyr Ile
<210> 2
<211> 4
<212> PRT
<213> Duck tembusu virus
<400> 2
Ser Gly Lys Gly
<210> 3
<211> 11
<212> PRT
<213> artificial sequence
<400> 3
Tyr Ala Glu Tyr Ile Gly Ser Ser Gly Lys Gly
Claims (10)
1. a kind of viral (Duck tembusu virus, DTMUV) E protein recombination fusion specific antigen epitope egg of the smooth cloth of duck
It is white, which is characterized in that the recombination fusion specific antigen epitope albumen is the disease of the duck Tan Busu as shown in SEQ ID NO.1
The specific antigen table of duck tembusu virus E protein shown in the specific antigen epitope albumen and SEQ ID NO.2 of malicious E protein
Position albumen obtains after passing through flexible peptide connection.
2. specific antigen epitope albumen is merged in recombination according to claim 1, which is characterized in that SEQ ID NO.1 institute
Duck tembusu virus E protein shown in the specific antigen epitope albumen and SEQ ID NO.2 of the duck tembusu virus E protein shown
Specific antigen epitope albumen be attached by Gly-Ser flexibility peptide, the described fusion specific antigen epitope albumen
Amino acid sequence is as shown in SEQ ID NO.3.
3. recombination fusion specific antigen epitope albumen of any of claims 1 or 2 is in the smooth cloth antiviral antibody detection examination of preparation duck
Purposes in agent.
4. a kind of ELISA antibody assay kit of duck tembusu virus, which is characterized in that include the smooth cloth of duck in the kit
Specific antigen epitope is merged in the virus E protein recombination fusion coated elisa plate of specific antigen epitope albumen, the recombination
Albumen is the specific antigen epitope albumen of duck tembusu virus E protein as shown in SEQ ID NO.1 and SEQ ID NO.2 institute
The specific antigen epitope albumen for the duck tembusu virus E protein shown obtains after passing through flexible peptide connection.
5. ELISA antibody assay kit according to claim 4, which is characterized in that duck shown in SEQ ID NO.1 is smooth
The specificity of duck tembusu virus E protein shown in the specific antigen epitope albumen and SEQ ID NO.2 of cloth Soviet Union virus E protein
Epitope protein is attached by Gly-Ser flexibility peptide, the amino of the recombination fusion specific antigen epitope albumen
Acid sequence is as shown in SEQ ID NO.3.
6. ELISA antibody assay kit according to claim 4, which is characterized in that the smooth cloth virus E protein recombination of duck is melted
The peridium concentration for closing specific antigen epitope albumen is 6.4 μ g/mL, and confining liquid is 1%w/w BSA solution.
7. according to the described in any item ELISA antibody assay kits of claim 4-6, which is characterized in that the kit
In further include washing buffer, sample diluting liquid, ELIAS secondary antibody, substrate developing solution and terminate liquid.
8. ELISA antibody assay kit according to claim 7, it is characterised in that the washing buffer is to contain
The 10mM PBST, pH 7.4 of 0.5%Tween-20；The sample diluting liquid is the 10mmol/L containing 0.05%Tween-20
PBST, pH value 7.4；The ELIAS secondary antibody is the goat-anti duck IgG of horseradish peroxidase (HRP) label；The substrate developing solution
It is the 3,3' of 0.01%w/w, 5,5'- tetramethyl biphenyl amine aqueous solution；The terminate liquid is 2M sulfuric acid solution.
9. according to the described in any item ELISA antibody assay kits of claim 4-8, which is characterized in that be used for duck Tan Busu
When viral diagnosis, follow the steps below:
(1) by the coated elisa plate of the smooth cloth virus E protein recombination fusion specific antigen epitope albumen of duck in kit and various
Solution is placed under room temperature and rises again；
(2) be loaded: 100 μ l are added in every hole after diluting serum to be checked with sample diluting liquid, and standard positive and negative serum is used as control,
ELISA Plate is placed in 37 DEG C of effect 1h, is then dried, every hole adds 300 μ L washing buffers to wash 3~5 times；
(3) add ELIAS secondary antibody: the goat-anti duck IgG100 μ L that every hole addition is marked with the HRP that sample diluting liquid has diluted, by enzyme mark
Plate is placed in room temperature or 37 DEG C of effect 1h, then dries, every hole adds 300 μ L elution buffers to wash 3~5 times；
(4) add developing solution: 100 μ l of TMB developing solution is added in every hole, and ELISA Plate room temperature is protected from light colour developing；
(5) add terminate liquid: 100 μ l of sulfuric acid terminate liquid is added in every hole；
(6) it surveys OD value: ELISA Plate being put into enzyme detector and measures each hole OD450nm value；
(7) result judgement.
10. ELISA antibody assay kit according to claim 9, which is characterized in that serum to be checked in step (2)
Maximum dilution multiple is 1:80；The dilution for the goat-anti duck IgG that HRP is marked in step (3) is 1:1500；Described in step (4)
Developing time be 10~30min, preferably developing time be 10min；Testing result is judged according to absorbance value in step (7),
Judgment method are as follows: if absorbance value be greater than or equal to 0.189, for DTMUV the positive, if absorbance value less than 0.189, for
DTMUV is negative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910069667.XA CN109748971B (en) | 2019-01-24 | 2019-01-24 | ELISA antibody detection kit for duck tembusu virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910069667.XA CN109748971B (en) | 2019-01-24 | 2019-01-24 | ELISA antibody detection kit for duck tembusu virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109748971A true CN109748971A (en) | 2019-05-14 |
| CN109748971B CN109748971B (en) | 2023-01-06 |
Family
ID=66406077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910069667.XA Active CN109748971B (en) | 2019-01-24 | 2019-01-24 | ELISA antibody detection kit for duck tembusu virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109748971B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110327460A (en) * | 2019-06-05 | 2019-10-15 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Streptococcus suis-Haemophilus parasuis bigeminy subunit vaccine and preparation method |
| CN112834739A (en) * | 2020-12-30 | 2021-05-25 | 宁波海壹生物科技有限公司 | Kit for determining amino-terminal brain natriuretic peptide precursor in human blood by magnetic particle chemiluminescence method |
| CN115353564A (en) * | 2022-08-08 | 2022-11-18 | 华中农业大学 | Duck tembusu virus monoclonal antibody EDIII-Mab and detection kit and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104280551A (en) * | 2013-07-11 | 2015-01-14 | 中国农业科学院哈尔滨兽医研究所 | Duck tembusu virus E-ELISA (E-enzyme-linked immuno sorbent assay) detection kit and preparation method thereof |
-
2019
- 2019-01-24 CN CN201910069667.XA patent/CN109748971B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104280551A (en) * | 2013-07-11 | 2015-01-14 | 中国农业科学院哈尔滨兽医研究所 | Duck tembusu virus E-ELISA (E-enzyme-linked immuno sorbent assay) detection kit and preparation method thereof |
| CN108627645A (en) * | 2013-07-11 | 2018-10-09 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Duck tembusu virus disease E-ELISA detection kits and preparation method thereof |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110327460A (en) * | 2019-06-05 | 2019-10-15 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Streptococcus suis-Haemophilus parasuis bigeminy subunit vaccine and preparation method |
| CN112834739A (en) * | 2020-12-30 | 2021-05-25 | 宁波海壹生物科技有限公司 | Kit for determining amino-terminal brain natriuretic peptide precursor in human blood by magnetic particle chemiluminescence method |
| CN115353564A (en) * | 2022-08-08 | 2022-11-18 | 华中农业大学 | Duck tembusu virus monoclonal antibody EDIII-Mab and detection kit and application thereof |
| CN115353564B (en) * | 2022-08-08 | 2024-03-26 | 华中农业大学 | Duck tembusu virus monoclonal antibody EDIII-Mab, detection kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109748971B (en) | 2023-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105906714B (en) | A kind of preparation and application of brucellosis specific fusion protein antigen | |
| CN110642925B (en) | African swine fever virus synthetic peptide ELISA antibody detection kit | |
| CN109748971A (en) | A kind of ELISA antibody assay kit of duck tembusu virus and its application | |
| CN101184997B (en) | Peptide for detecting antibody to porcine reproductive respiratory syndrome virus | |
| NO166466B (en) | PROCEDURE FOR DETECTING OR DETERMINING A PEPTIDE CONTAINING AN ANTIGENIC ACTIVE SEQUENCE OF AMINO ACIDS. | |
| CN110618279A (en) | African swine fever virus epitope antigen polypeptide and application thereof | |
| CN106885903B (en) | A kind of zika virus E antigen and its application in the anti-zika virus antibody of detection | |
| CN108085330A (en) | treponema pallidum triplet antigen | |
| CN106279378B (en) | Varicellazoster virus gE antigens and its purposes in varicella zoster virus antibody is detected | |
| CN106596966A (en) | Chemiluminescent detection kit for bovine foot-and-mouth disease 3ABC antibody | |
| CN105242043B (en) | A kind of several species general ELISA kit of antidiastole mouth disease virus infection | |
| CN110178031A (en) | The determination of serology of zika virus infection | |
| CA2270163C (en) | Helicobacter pylori diagnostics | |
| CN111848750A (en) | Method and kit for rapidly enriching and detecting 2019-nCoV | |
| CN105037555B (en) | Conjugate and its preparation method and application | |
| CN109085354A (en) | The detection kit and its detection method of varicella virus neutralizing antibody | |
| CN108802368A (en) | A kind of kit of enzyme linked immunosorbent detection ox miscarriage Chlamydia | |
| CN110095607A (en) | For detecting universal indirect ELISA reagent kit and its application of 1 type and 3 type duck hepatitis A virus serum antibodies | |
| CN110376388A (en) | A kind of haemophilus parasuis antibody detection method and its kit | |
| CN107664694B (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN107003309A (en) | Antigen compositions for detecting chagas disease | |
| CN105572375B (en) | Mink Parvovirus Enteritis pathogen antigen colloidal gold colloidal gold detection test paper strip and preparation method thereof | |
| CN107422117A (en) | A kind of kit for detecting Latex agglutination test antibody | |
| CN110498844B (en) | Peste des petits ruminants diagnostic kit | |
| CN110498845B (en) | Peste des petits ruminants diagnostic kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |