CN109735545B - Long-chain non-coding RNA and application thereof as renal cell carcinoma diagnosis and prognosis marker - Google Patents

Abstract

The invention provides a long-chain non-coding RNA, the cDNA sequence of which is shown as SEQ ID NO. 5. The invention also provides the application of the long-chain non-coding RNA as a kidney cell cancer diagnosis or prognosis marker. The invention also provides a kit for diagnosing renal cell carcinoma, which is used for detecting the upstream primer sequence of the long-chain non-coding RNA as shown in SEQ ID NO.1 and detecting the downstream primer sequence of the long-chain non-coding RNA as shown in SEQ ID NO. 2; the internal reference used for detection is beta-actin, the upstream primer sequence for detecting beta-actin is shown as SEQ ID NO.3, and the downstream primer sequence for detecting beta-actin is shown as SEQ ID NO. 4. The invention can know the long-term prognosis of a patient by detecting the expression level of the long-chain non-coding RNA in the kidney cancer tissue of the patient.

Description

Long-chain non-coding RNA and application thereof as renal cell carcinoma diagnosis and prognosis marker

Technical Field

The invention belongs to the field of bioengineering, and relates to a biomarker, in particular to long-chain non-coding RNA and application thereof as a renal cell carcinoma diagnosis and prognosis marker.

Background information

Renal cell carcinoma (renal cell carcinoma, RCC) is derived from tubular epithelial cells, and is one of the most common malignant tumors of the urinary system, accounting for 2-3% of new malignant tumors every year. In recent years, the morbidity and mortality of RCC have tended to rise year by year, and statistics of Global Cancer Statistics 2018:GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36Cancers in 185Countries in 2018 find that global new morbidity in 2018 is estimated to be about 403262 cases, and the number of mortality is estimated to be 175098 cases. By 2011, kidney cancer is ill in 5 years in China, the survival number is as high as 19.19 thousands, and the health and safety of the national people are seriously threatened. Renal clear cell carcinoma (clear cell renal cell carcinoma, ccRCC) is the most common pathological type, accounting for about 80% of all renal cell carcinomas. ccRCC has a high propensity for malignancy, and is insensitive to radiation and chemotherapy, except for surgery, so local infiltration and distant metastasis occur earlier. Prognosis for patients with metastatic renal clear cell carcinoma is very poor, with survival rates of only 10% in 5 years; whereas the 5-year survival rate of patients with non-metastatic renal cancer is about 55%.

Long non-coding RNAs (lncRNAs) are a class of RNA molecules with transcripts exceeding 200nt in length, which do not encode proteins, but regulate the expression level of genes in the form of RNAs at various levels (epigenetic, transcriptional, and post-transcriptional regulation, etc.). The regulation of LncRNA mainly comprises the following steps: 1) Transcription of an upstream promoter region of a gene encoding a protein, interfering with expression of a downstream gene; 2) Inhibiting RNA polymerase II or mediating chromatin remodeling and histone modification, affecting expression of downstream genes; 3) Forming complementary double strand with the transcript of the encoded protein gene, interfering with the cleavage of mRNA, forming different cleavage forms; 4) Forms complementary double strand with the transcript of the encoding protein gene, and generates endogenous siRNA under the action of Dicer enzyme; 5) Binding to a specific protein, the lncRNA transcript can modulate the activity of the corresponding protein; 6) Forming a nucleic acid-protein complex with a protein as a structural component; 7) Binding to a specific protein, altering the cellular localization of the protein; 8) As precursor molecules for small RNA (e.g., miRNA, piRNA); 9) As a competitive endogenous RNA (competing endogenous RNA, ceRNA) interacts with miRNA, involved in expression regulation of target genes. Aberrant expression of long non-coding RNAs (lncRNAs) has become a hotspot molecule for human cancer research.

Disclosure of Invention

The invention aims to provide long-chain non-coding RNA and application thereof as a kidney cell cancer diagnosis and prognosis marker, and aims to solve the technical problem of poor effect of diagnosing kidney cell cancer and prognosis in the prior art.

The invention provides a long-chain non-coding RNA, the cDNA sequence of which is shown as SEQ ID NO. 5.

The invention also provides the application of the long-chain non-coding RNA as a kidney cell cancer diagnosis or prognosis marker.

The invention also provides a kit for diagnosing renal cell carcinoma, which is used for detecting the upstream primer sequence of the long-chain non-coding RNA as shown in SEQ ID NO.1 and detecting the downstream primer sequence of the long-chain non-coding RNA as shown in SEQ ID NO. 2; the internal reference used for detection is beta-actin, the upstream primer sequence for detecting beta-actin is shown as SEQ ID NO.3, and the downstream primer sequence for detecting beta-actin is shown as SEQ ID NO. 4.

The invention discovers a new lncRNA-URRCC (BX 649059) and finds that the lncRNA-URRCC can be used as a kidney cell cancer marker for diagnosis and prognosis evaluation.

Compared with the prior art, the invention has the technical effects of being positive and obvious. The invention can be used for knowing the long-term prognosis of a patient by detecting the expression level of URRCC in the kidney cancer tissue of the patient.

Drawings

FIG. 1 shows that URRCC is a newly discovered lncRNA that is highly expressed in kidney tumor tissue. Wherein A: qRT-PCR detects 20 differences in expression of BX649059 in ccRCC tissue and adjacent normal kidney tissue. B: the TCGA database detects the expression differences of BX649059 in ccRCC tissue and normal kidney tissue. C: qRT-PCR detects the difference in expression of BX649059 in 96 ccRCC tissues and 25 normal kidney tissues. D: qRT-PCR detects differences in the expression of URRCC in various kidney cancer cell lines (OSRC-2, 769-P, ACHN, caki-1, 786-O and A498) and human normal tubular epithelial cell line HK-2. E: FISH experiments examined the localization of URRCC in ccRCC and adjacent normal kidney tissue, green for URRCC and blue for DAPI nuclear stain. F: qRT-PCR detects the expression of URRCC, U6 and beta-actin in RNA extracted from cytoplasm and nucleus. G: qRT-PCR detected the relative mRNA levels of URRCC in 116 ccRCC patients, with intermediate expression levels used as thresholds. H: kaplan-Meier analyzed the correlation between URRCC expression levels and overall survival in 116 ccRCC patients.

In fig. 2, a: a flow chart of lncRNA analysis was performed by selecting two RCC datasets (GSE 46699 and GSE 53757) from the GEO public database. B and C: cluster map of lncRNAs differentially expressed in GSE53757 (B) and GSE46699 (C) dataset. D: the expression of AK026225 and AK055783 in kidney cancer tissue and adjacent normal kidney tissue was detected 20 by qRT-PCR. E: chromosomal localization of URRCC in the Ensemble database. F: positioning of URRCC predicted by lncLocator site (http:// www.csbio.sjtu.edu.cn/bioinf/lncLocator /).

Figure 3 shows the ability of URRCC to promote ccRCC cell proliferation and invasion. Wherein, A and D: qRT-PCR measures mRNA levels of URRCC in different treatment groups A498 and OSRC-2 cells. B and E: MTT experiments after transfection of sh-URRCC and sh-NC (A498) or oe-URRCC and mock (OSRC-2) with A498 and OSRC-2 cells, respectively. C and F: a498 and OSRC-2 cells were transfected with sh-URRCC and sh-NC (A498) or oe-URRCC and mock (OSRC-2), respectively, followed by transwell invasion experiments.

In FIG. 4, A and B qRT-PCR analysis of URRCC mRNA levels of 786-O and OSRC-2 cells after transfection of sh-control, sh-URRCC-1 and sh-URRCC-2.

Fig. 5 shows that URRCC promotes ccRCC progression in vivo. A: performing nude mice subcutaneous tumor experiments by using stable transformation of sh-URRCC and sh-control A498 cells, and evaluating the effect of URRCC in nude mice in 8 groups; the weight of subcutaneous grafts is shown in the right panel. B: the use of stable transformation mock and oe-URRCC OSRC-2 cells for nude mice subcutaneous tumor experiments, 8 in each group, evaluation of URRCC in nude mice in vivo effect; the weight of subcutaneous grafts is shown in the right panel. C: representative images of each group of the tail of the nude mice after 4 weeks of intravenous injection (A498 cells: sh-control and sh-URRCC groups; OSRC-2 cells: mock and oe-URRCC groups), n=8/group. D and E: representative images of lung metastasis for each group 8 weeks after intravenous injection of the tail of the nude. F and G: representative images of lung metastasis lesions HE staining after 8 weeks of intravenous injection into each group of rat tail (left). Red arrows indicate lung metastases (100 x magnification). The number of metastases on each group of lungs (n=8) was compared (right). H and I: representative Ki67 immunohistochemical results for sh-control, sh-URRCC, mock and oe-URRCC (200 x and 400 x magnification) lung metastases.

FIG. 6 shows that URRCC increases EGFL7 expression levels by mediating the acetylation of EGFL7 promoter histone H3. And A, drawing a URRCC sub-regulation network according to the result of the URRCC chip. Blue genes are genes whose expression is down-regulated after cell transfection of sh-URRCC. The red gene is a gene whose expression is up-regulated after transfection of sh-URRCC into cells. The size of the gene circles represents a multiple of the change. B: mRNA and protein levels of EGFL7 were measured after transfection of sh-URRCC or sh-URRCC with A498 and OSRC-2 cells, respectively, using qRT-PCR and WB assays. C: mRNA and protein levels of EGFL7 after mock or oe-URRCC transfection of A498 and OSRC-2 cells were detected using qRT-PCR and WB assays, respectively. TCGA-KIRC data set shows the expression difference of EGFL7 in tumor tissue and paired normal kidney tissue of ccRCC patient. E: immunohistochemistry of ccRCC tissue with paired normal kidney tissue EGFL 7. F and G: representative EGFL7 immunohistochemistry of sh-control, sh-URRCC, mock and oe-URRCC xenograft tumors (200×,400×). A498 and OSRC-2 cells were treated with DMSO or TSA (50 nM or 100 nM) for 72 hours (n=3), qRT-PCR and WB to detect EGFL7mRNA and protein levels. I: chIP experiments analysis of enrichment levels of EGFL7 promoter region acetylated histones H3 and H4 following transfection of a498 cells with sh-control or sh-URRCC. J: chIP experiments analyzed the enrichment level of GAPDH promoter regions acetylated histones H3 and H4 after transfection of a498 cells with sh-control or sh-URRCC. K: chIP experiments analysis of enrichment levels of the EGFL7 promoter region acetylated histones H3 and H4 following mock or oe-URRCC transfection of a498 cells. L. WB detects the expression of H3K27ac protein in DMSO or TSA treated A498 and OSRC-2 cells, beta-actin as an internal control.

In fig. 7, a: a498 cells were transfected with sh-control and sh-URRCC, and PCR chips were used to detect mRNAs differentially expressed between the sh-control and sh-URRCC groups and to map clusters. B, mRNA levels of JMY in ccRCC tissue and normal kidney tissue in TCGA-KIRC dataset. Kaplan-Meier analysis of the correlation between URRCC expression and total survival for ccRCC patients in TCGA-KIRC dataset. D: correlation of tubular epithelial cells with URRCC and EGFL7 at mRNA levels in kidney cancer cell lines. E: mRNA levels of EGFL7 in DMSO, sh-URRCC and sh-URRCC+TSA (100 nM) groups of A498 cells. F and G: chIP experiments analyzed enrichment levels of EGFL7 promoter region acetylated histone H3 following transfection of a498 cells or OSRC-2 cells with sh-control, sh-URRCC or with sh-URRCC and TSA addition.

FIG. 8 shows that URRCC is associated with the EGFL7/P-AKT/FOXO3 signal path. A and B: protein expression of T-AKT, P-AKT and FOXO3 was examined by WB after silencing or overexpression of URRCC (sh-URRCC) in A498 and OSRC-2 cells, and beta-actin served as an internal reference. C498 cells were transfected with mock+si-NC, oe-URRCC+si-NC, mock+si-EGFL7, oe-URRCC+si-EGFL7 and then subjected to CCK8 experiments. D: a498 cells were transfected with mock+si-NC, oe-URRCC+si-NC, mock+si-EGFL7, oe-URRCC+si-EGFL7 followed by transwell chamber invasion assay E. A498 cells were transfected with mock+si-NC, oe-URRCC+si-NC, mock+si-EGFL7, oe-URRCC+si-EGFL7 followed by WB assay to examine protein expression of EGFL7, T-AKT, P-AKT and FOXO 3. Beta. -actin served as an internal reference.

FIG. 9 shows that FOXO3 inhibits URRCC expression by binding to the URRCC promoter region. A: chIP experiments showed that FOXO3 was able to bind to a potential binding site on the URRCC promoter. B: schematic of the mutation of FOXO3 binding element on the URRCC promoter was constructed. C: after over-expression of FOXO3 in Renilla luciferase plasmid transfected a498 cells, the wild-type and mutant URRCC promoter sequence plasmids were re-transfected, respectively, and relative luciferase activity was detected. D: ccRCC tissue is immunohistochemical with FOXO3 paired with normal kidney tissue. E Kaplan-Meier analysis of the correlation between ccRCC patient FOXO3 expression and total survival in the TCGA-KIRC dataset. P values were calculated using a log rank test.

FIG. 10 shows the correlation of URRCC and FOXO3 at mRNA levels in kidney cancer cell lines.

FIG. 11 shows schematic diagrams of ccRCC cell proliferation and invasion signal pathways based on lncRNA-URRCC.

Detailed Description

Example 1 URRCC is a newly discovered lncRNA involved in renal tumor progression.

To find potential lncRNAs involved in ccRCC progression, we selected the published renal cancer related datasets (GSE 46699 and GSE 53757) in the two GEO databases, and the system analyzed the differential expression of lncRNAs between ccRCC tissue and paired normal kidney tissue. As shown in fig. 2A, we calculated the intersection between the results of these two data sets by thermographic analysis, focusing on 3 potential lncRNA (AK 026225, BX649059 and AK 055783) that were ranked top three in 50 ccRCC tissues up-regulated lncRNA compared to paired normal kidney tissues (fig. 2B and 2C).

Next, we further validated expression of lncrrnabx 649059 in ccRCC tissue and normal kidney tissue using qRT-PCR techniques, first extracting total RNA from frozen tissue specimens with Trizol reagent, then reverse transcribing the RNA into cDNA using reverse transcription kit, finally performing qRT-PCR on 7900HT Fast Real-Time PCR instrument, reference using β -actin. Finally use 2 ^-ΔΔCt Algorithms analyze the differences between the two groups of URRCCs. The primer sequences used were as follows:

URRCC：

forward:5 'gcatcttcactttgcttcat 3'; as shown in SEQ ID NO. 1.

reverse:5 'tctgggctggaaataacttg3'; as shown in SEQ ID NO. 2.

β-actin：

forward:5 'gggacctgacctgacctc 3'; as shown in SEQ ID NO. 3.

reverse:5 'tcaatactccttgcttgctgat3'; as shown in SEQ ID NO. 4.

qRT-PCR results showed that only BX649059 expression was significantly increased in 20 ccRCC tissues compared to paired normal kidney tissues (fig. 1A), consistent with the analysis of the KIRC dataset in the TCGA database (fig. 1B). While the other two lncRNAs (AK 026225 and AK 055783) were expressed without differences between ccRCC tissue and paired normal kidney tissue (fig. 2D). Furthermore, the expression level of BX649059 was higher than 25 unpaired normal kidney tissues in 96 ccRCC tissues (fig. 1C). Therefore, we named BX649059 as lncRNA URRCC (up-regulation in ccRCC)in clear cell renal cell carcinoma). In addition, qRT-PCR analysis showed that URRCC expression was significantly higher in a range of human kidney cancer cell lines than in normal human tubular epithelial cell line HK2 cells (FIG. 1D). In contrast, no significant differences were observed in expression of the other two lncrnas (AK 026225 and AK 055783) (data not shown). Using the Ensemble software, we confirmed that URRCC was from DKFZp779p0730, located on chromosome 12: 100623715-100628286 (fig. 2E). The complete sequence of URRCC is shown in SEQ ID No.5, with a transcription length of 3967bp. As shown in FIGS. 1E and 1F, RNA Fluorescence In Situ Hybridization (FISH) and subcellular fraction analysis of ccRCC tissues found that URRCC was mainly located in cytoplasm, consistent with the on-line software lncLocator (http:// www.csbio.sjtu.edu.cn/bioinf/lncLocator /) (FIG. 2F).

Example 2 URRCC correlates with a poor prognosis for ccRCC.

To further investigate the relationship between URRCC expression and the clinical pathology of ccRCC patients, we analyzed the expression of URRCC in 116 ccRCC tissues. We ranked according to URRCC mRNA levels and selected the median of the whole set of data (4.215) as the demarcation point for the high URRCC and low URRCC sets (fig. 1G). Clinical pathology analysis showed that high expression levels of URRCC expression in ccRCC correlated with tumor size, T-staging and metastasis (table S1). In univariate analysis, URRCC high expression (risk ratio, hr=2.59; 95% confidence interval, ci=1.46-4.33; p=0.001), tumor size (hr=1.59; 95% ci=1.44-2.74; p=0.035), T-staging (hr=1.42; 95% ci=1.25-2.68; p=0.038) and metastasis (hr=1.47; 95% ci=1.05-1.86; p=0.026) were significantly correlated with overall survival (table S2). Multivariate analysis showed that higher URRCC expression (hr=2.44; 95% ci=1.36-4.40; p=0.003) was significantly correlated with overall survival (table S2). Furthermore, kaplan-Meier survival analysis of 116 ccRCC patients showed that the survival time of high-expressing urrc patients was shorter than that of low-expressing urrc patients (fig. 1H).

Example 3 URRCC promotes proliferation and invasiveness of ccRCC cells.

The above results demonstrate that URRCC is highly expressed in ccRCC tissue and may be a diagnostic or prognostic marker. To determine whether URRCC can affect renal cancer progression, we screened the best interfering shRNA from the two interfering shRNA-1 and shRNA-2 (fig. 4A and 4B) and performed a knockdown experiment in a498 cells, as shown in fig. 3A and 3B, MTT detection found that knocking down URRCC (sh-URRCC) significantly reduced the growth rate of a498 cells. In addition, transwell invasion experiments demonstrated that sh-URRCC attenuated the invasiveness of a498 cells (fig. 3C). In addition, we induced tumor phenotype by over-expression of URRCC (oe-URRCC) in OSRC-2 cells (FIG. 3D). As expected, MTT assay found that oe-URRCC significantly enhanced the proliferative capacity of OSRC-2 cells (FIG. 3E). Likewise, transwell invasion experiments found that oe-URRCC enhanced the invasive capacity of OSRC-2 cells (fig. 3F). The results of FIG. 3 demonstrate that URRCC can promote proliferation and invasion of ccRCC cells.

Example 4 URRCC promotes proliferation and invasive capacity in ccRCC.

We further explored the proliferation and metastasis of URRCC in vivo. First, we constructed ccRCC proliferation and metastasis models of nude mice, respectively, as shown in fig. 5A, sh-URRCC was effective in inhibiting tumor proliferation. In contrast, oe-URRCC promoted tumor growth (fig. 5B). Next, we labeled both cells A498/sh-URRCC and OSRC-2/oe-URRCC with firefly luciferase, and then constructed the model by tail vein injection, respectively, and monitored the metastasis of tumor in nude mice by In Vivo Imaging System (IVIS) system. The results showed that the sh-URRCC nude mice had significantly lower pulmonary metastasis luciferase expression than the control group, with fewer numbers of pulmonary metastases and universities than the control group (fig. 5C, 5D and 5F). Whereas oe-URRCC enhanced luciferase expression, number and size of lung metastases (fig. 5C, 5E and 5G). Furthermore, immunohistochemistry showed reduced Ki67 expression in lung metastasis sections of the sh-URRCC group, while Ki67 expression in sections of the oe-URRCC group was increased, compared to sh-control (fig. 5H and 5I). The results in FIG. 5 show that in vivo levels of URRCC promote proliferation and metastasis of tumors.

Example 5 URRCC enhances EGFL7 levels by mediating histone H3 acetylation of the EGFL7 promoter.

To investigate the potential downstream genes associated with URRCC driving cell proliferation and transfer phenotype in ccRCC, we used the mRNA PCR Array from well-established company to investigate mRNA differentially expressed after interfering with URRCC in a498 cells (fig. 7A), six significantly down-expressed mRNA and four significantly up-expressed mRNA were found after analysis (fig. 6A and 7B). We focused on genes with the same trend of change as URRCC, with the most significant decrease in JMY and EGFL7 expression following sh-URRCC expression (fig. 6A). Because of the potential tumor suppression effect of JMY (fig. 7C and 7D) in ccRCC, we chose to conduct further studies on EGFL 7.

qRT-PCR and WB analysis showed a significant decrease in EGFL7mRNA and protein levels in A498 and OSRC-2 cells after sh-URRCC (FIG. 6B), while EGFL7mRNA and protein levels were expressed up after oe-URRCC (FIG. 6C). Furthermore, analysis of the KIRC dataset in the TCGA database and immunohistochemical experiments demonstrated that EGFL7mRNA levels and protein levels were much higher in ccRCC tissues than in non-cancerous tissues (fig. 6D and 6E). Meanwhile, immunohistochemical experiments were performed on the subcutaneous transplanted tumors of nude mice in the sh-URRCC group, and it was found that EGFL7 expression was reduced compared to the control group, whereas immunohistochemical of the subcutaneous transplanted tumors in the oe-URRCC group was found that EGFL7 expression was increased compared to the control group (fig. 6F and 6G).

To further investigate whether upregulation of EGFL7 expression in ccRCC was associated with increased expression of URRCC, we first reviewed the literature to find that histone acetylation is an important way to influence EGFL7 expression, and we therefore considered that EGFL7 may be regulated by histone deacetylase in ccRCC.

qRT-PCR and WB experiments showed that after addition of histone deacetylase inhibitor trichostatin a (TSA) to a498 and OSRC-2 cells, EGFL7 expression was elevated and correlated positively with drug concentration (fig. 6H). At the same time, chIP experiments demonstrated that the EGFL7 promoter region (2000 to +50bp relative to the transcription initiation site) significantly decreased histone H3 acetylation levels without significant changes in histone H4 acetylation levels following sh-URRCC in A498 cells (FIG. 6I); sh-URRCC did not affect the level of acetylation of histone H3 and H4 in GAPDH (negative control) promoter region (2000 to +50bp relative to the transcription initiation site) (fig. 6J); after oe-URRCC in OSRC-2 cells, histone H3 acetylation level of EGFL7 promoter region was significantly increased, and histone H4 acetylation level was not significantly changed (fig. 6K). We found through Western immunoblotting experiments that TSA increased the expression of H3K27ac protein in A498 and OSRC-2 cells, which may explain why sh-URRCC did not affect the level of H4 acetylation (FIG. 6L). In addition, chIP experiments demonstrated that TSA could reverse the decrease in EGFL7mRNA levels and the decrease in promoter region acetylation levels caused by sh-URRCC (fig. 7E-7G).

The above results demonstrate that URRCC is able to enhance EGFL7 expression by mediating histone H3 acetylation of the EGFL7 promoter region.

Example 6 URRCC relates to the EGFL7/P-AKT/FOXO3 signal path.

AKT signaling pathway plays an important role in ccRCC, we have been devoted to research on AKT signaling pathway. To investigate whether URRCC can modulate AKT signaling pathway in ccRCC we performed WB analysis, which indicated that sh-URRCC could inhibit P-AKT signaling pathway in a498 and OSRC-2 cell lines (fig. 8A). With reduced P-AKT protein expression we observed an increase in FOXO3 protein expression (fig. 8A), which was reported in previous studies, as downregulation of FOXO3 expression was due to increased activation of AKT. In contrast, oe-URRCC can enhance the P-AKT signaling pathway in both cell lines while reducing FOXO3 expression (fig. 8B). Through CCK8 and transwell experiments, we found that si-EGFL7 could reverse the changes in cell proliferation and invasiveness caused by oe-URRCC (FIGS. 8C and 8D). Similarly, si-EGFL7 could reverse the increase in EGFL7, the increase in P-AKT and the decrease in FOXO3 caused by oe-URRCC by WB analysis (FIG. 8E). Our data indicate that URRCC can enhance the proliferation and invasiveness of renal cancer cells through EGFL7/P-ERK/FOXO3 signaling pathway.

Example 7 FOXO3 inhibits the level of URRCC transcription by binding to a specific region of the URRCC promoter.

To investigate the potential mechanism of upregulation of URRCCs in ccRCC cells, bioinformatic analysis of the promoter region (-1572 to-1 bp) of URRCCs was performed by online software RegRNA 2.0 (http:// regnna2. Mbc. Nctu. Edu. Tw/detection. Html) to predict that a potential binding site (-176 to-163 bp) for FOXO3 was found.

FOXO3Forward 5 'gcaaaccgccccgtgtt3'; as shown in SEQ ID NO. 6.

FOXO3Reverse 5 'tcaaagtaaaaatccaaccatc 3'; as shown in SEQ ID NO. 7.

EGFL7Forward 5 'tcgtgcagcgtgtacag3'; as shown in SEQ ID NO. 8.

EGFL7Reverse 5'gcggtaggcggtcctatagatg3'; as shown in SEQ ID NO. 9.

Further ChIP experiments confirmed the enrichment of FOXO3 on specific regions of the URRCC promoter (fig. 9A). Double luciferase reporter experiments showed that reduced luciferase activity was observed in wild-type (Wt) URRCC promoter but no change in mutant (Mut) URRCC promoter luciferase activity was observed in FOXO3 overexpressed a498 cells (fig. 9B and 9C).

Immunohistochemistry also demonstrated lower expression of FOXO3 in ccRCC tissue than in normal kidney tissue (fig. 9D), which corresponds to Kaplan-Meier survival analysis of FOXO3 in KIRC dataset in TCGA database, i.e. survival time of ccRCC patients with high FOXO3 expression was longer (log rank test, p <0.001, fig. 9E). These data indicate that FOXO3 inhibits transcription of URRCC by binding to a specific site on the URRCC promoter in ccRCC. FIG. 10 shows the correlation of URRCC and FOXO3 at mRNA levels in tubular epithelial cells and kidney cancer cell lines.

Summarizing, URRCC promotes up-regulation of EGFL7 expression by mediating EGFL7 promoter region protein H3 acetylation, activates AKT signaling, thereby inducing cell growth and invasion, and inhibits FOXO3 gene expression, as shown in FIG. 11. The AKT signal pathway downstream gene FOXO3 forms a positive feedback pathway by directly binding to the URRCC promoter region to inhibit URRCC expression.

Sequence listing

<110> Shanghai transportation university medical college affiliated ren Ji hospital

<120> a long non-coding RNA and its use as a marker for diagnosis and prognosis of renal cell carcinoma

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcatcatctt cacttgcttc at 22

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tctgggctgg aataaccttg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gggacctgac tgactacctc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tcatactcct gcttgctgat 20

<210> 5

<211> 3967

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 5

gtacctgatt cgcctgccag aacacctcag cctcctgaaa tgaatccttt gtcagcagtt 60

aacatgtttc agaaacaaaa ttcaaaaccc agcgtgccag ttagtattcc aaaaagcaaa 120

gaaaaacagg gacgtccacc aggtgcattg gtgccagcat cttcactgaa aggaggtaat 180

ctgggctcta tgtcagtccg ttctaaattg ccaaattctc cagcagcatc ttctcatccc 240

aagctcaagt cttcaaaagg cataacgaag aaaccgcagg ctccttcaaa caatgcatca 300

tcttcacttg cttcattaaa tccagtaggt aaaaacactt cttcaccagc tttaccaaga 360

actgcacctt gtatatctga gtcaccgaga aaatgtattt catcccccaa tacccccaag 420

gccaaggtta ttccagccca gaattcagca gatctgcccg agtccacact tttgccaaat 480

aagtgttcag gaaaaactca acctaagtat ttgaaacata atcatatttc ttccagagat 540

aatgcagtat ctcacttagc tgcacattca aattcatcct caaaatgtcc caagctgcct 600

aaagcaaata tacctgtaag acctaaacct tctttccagt cctctgcaaa aatgacaaaa 660

accagttcca aaaccatagc cacgggtcta ggaacacagt ctcaaccatc cgatggagcc 720

ccacaagcaa agccagtccc agcacagaaa cttaaatcgg ccttgaattt aaatcagcca 780

gtttctgtgt cctcagtttc tcctgtaaaa gccacacaga aatcaaaaga taagaatata 840

gtttcagcta ccaaaaagca gcctcagaat aaaagtgcat ttcagaagac aggacccagc 900

tccttgaagt ctcctggccg taccccactg tccatcgtga gcctacccca gtcttctacc 960

aaaacacaaa ctgcaccgaa gtcagcacag actgtcgcta agagccagca ttcaactaaa 1020

gggcctccca gaagtggtaa aaccccagct tcaatcagga aaccaccctc atctgttaag 1080

gatgcagata gtggagataa aaaacctact gcaaagaaaa aggaagatga tgaccattat 1140

tttgtcatga ctggaagtaa gaaacctaga aaataaatac atactcatta taaaaaaaga 1200

gaaaaggaag aatgaatgtg ttagcttcac atcttaaaag tttctcctat ttgtgtctgt 1260

ctaaataggt gctgacacta aggatagtga ggatggaggc tgggatgagg aaagggttca 1320

tcagaattca catatctgaa ttcactggaa agagcccttc tgaagcaaac agttgtaaaa 1380

tcactgcaag gtttttatta ataatagaca tgtatatgat tttcagtcta tagcatcttt 1440

gttaacatct gccttttgca ggaaatgtaa aagttattta acactacaag aattttaaca 1500

atagttgctc tatttttgaa tatgtattaa atatggagtt catatacctg ctaacatcaa 1560

cggtggtgct cttactatta gttaattgca ttttggttaa aaaaaaaaaa gcaacagttt 1620

ggcacttgtc ctacaaaagg cacctaattt aattttctga tcaggattgc ctgatccaac 1680

agtgctaagt catggctgct gctgactagc ttggcattat tctgtgttag gtagaattct 1740

tattatttat ttttttaagc tttccaaatt ggaaggaact gattgtttca tgtggcttat 1800

atttacattg gtaatatttt gtcaccaata tttttggtta aaaaaaatcc aacaaattaa 1860

cttactgaaa tataaacaaa ttttgtaaac aattttttat attatctata aaaacgtaga 1920

caccttatgt ttcacatgtt gtgcaatgtg acaggggaag ctgatttagt agcttttagc 1980

atattaaaaa taatttttta taatgtaatt tcctgtgagt gcagacctga cattttacat 2040

taaaataatg tgaaacatca gaattatgtt ttaacaactt taaaattaag atgatgttaa 2100

aataatttta gagttatgct atgtaaaaat tctatcatga aattattttt ctctagatag 2160

cacaatacca attttaatta atttcttcca attaggttac ttttctttaa taaagttatg 2220

ctgccttcag ttttccaatg gcaagtagac aggatatgtt caaggttttc tgcactgtag 2280

gcacagtctc tcaagcatat cctgatcatg taatgactgc ataaactcca tcaacctaag 2340

gtgatacttg taaataattt atttttaagg gatggtgact ttaaaaatta ttaatgaact 2400

ttgagaagtt ttaagagtgc ttttaaaact tcacagtatt gccaattatc ttaggttatt 2460

cagtattcag gtttgtgttt ctctgtttta aactaaaatg tgttttctga agaaaaaaat 2520

aatagtttac acaaatgtac aatcatagaa taagcatttt aagctggcga ctagtgttct 2580

atagattaca aagcaagaaa actttctatg aagataaatg accttttgcc tgaagagtac 2640

agataaaatc aaagatgtgt gcaagctagt ttttggaaga agtgatgctt ctcttcttta 2700

aagagacagt caccaaatac ttggtttaac tcgactattg acttgggcat tgagagagat 2760

gatatataca tctttggaaa gtgaagtcaa tgttcaagag gtgatagaag ctttactttt 2820

tagtgatcag aaatatttag tgcatctttt cagacaggaa gaattttatc atcaagtatt 2880

cccttataaa accaagtaac gcttctttat cagtaacttt tagaacttaa aagaaagcaa 2940

aaagtaaatg gaattgtagg caatttatga atcctagtag attttacaat atgtaattta 3000

tgttgtttac agtatataaa cactaagttt tgtgttaaat gtgatcagga ataaaagtat 3060

cccacaggca tctgacacaa attccagaat tagccaaaga attgtttatt tgaggccagg 3120

caatcccagc attttgggaa gccaagttgg gctgatctcg aactcctgac ctcaggtgat 3180

ccacctgcct cagcctccca aagcgctggg attacaggca tgagccatca cacccagcga 3240

aaagttttgt ttgaataaac aatatccgaa agacaattag tttcttcaga tgtgttttga 3300

aattctccta aagagctagt gtttctattc attttcacaa tttaaaaaca gctcttaaca 3360

ttgctgaagt tgggagaact ttccatctct tcttaataac agtgcaagat tttgtaaatt 3420

cttttttgtg tttaatgttt aataaaacga gtattaagct taaattactg aagtacctgg 3480

gagaagtaat gatgtgtact ttcaaaaaaa tggaaaatgc ttttatttta ttttctataa 3540

tttgttaaca tgatatgtaa aattaaactt cggagcacaa tgaaatgccg attattttta 3600

ccttgtttgg gcttaaagta ggtatttaag gtttatgtgt tcaaaatgcc ttggtaaatt 3660

ggatgacctc taactttact gtccatatgg agtttgtcat tctttatgga taagagaact 3720

taaggaaaag ttactgtttt tcttcagtct ttttatatct atctgattta aaatctgtta 3780

ctttattaaa aggcttcaac aacaggttgt taggatgtag tcttacatcc aggttcacat 3840

aataacccca tttgaatcca aatttgtgta tattttctta tgccagcagt atttgtatcc 3900

aattttaact taggtttgtt ttcttgagta ttaaaattta aacatataaa aaaaaaaaaa 3960

aaaaaaa 3967

<210> 6

<211> 17

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gcaaacctgc ccgtcat 17

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tcaaagttaa aatccaaccc at 22

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tcgtgcagcg tgtgtaccag 20

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gcggtaggcg gtcctataga tg 22

Claims (2)

1. The cDNA sequence of the long-chain non-coding RNA is shown as SEQ ID NO.5, and compared with a normal person, the survival time of a patient with the renal clear cell carcinoma, which highly expresses the long-chain non-coding RNA, is shorter than that of a patient with the renal clear cell carcinoma, which expresses the long-chain non-coding RNA, by using the long-chain non-coding RNA as a diagnosis and prognosis marker of the renal clear cell carcinoma, and the kit is used for preparing a kit for diagnosing the renal clear cell carcinoma.

2. The use according to claim 1, characterized in that: the upstream primer sequence for detecting the long-chain non-coding RNA is shown as SEQ ID NO.1, and the downstream primer sequence for detecting the long-chain non-coding RNA is shown as SEQ ID NO. 2; the internal reference used for detection is beta-actin, the upstream primer sequence for detecting beta-actin is shown as SEQ ID NO.3, and the downstream primer sequence for detecting beta-actin is shown as SEQ ID NO. 4.

Images