CN109735478A - One plant height produces construction method and its application of L-threonine genetic engineering bacterium - Google Patents
One plant height produces construction method and its application of L-threonine genetic engineering bacterium Download PDFInfo
- Publication number
- CN109735478A CN109735478A CN201910077955.XA CN201910077955A CN109735478A CN 109735478 A CN109735478 A CN 109735478A CN 201910077955 A CN201910077955 A CN 201910077955A CN 109735478 A CN109735478 A CN 109735478A
- Authority
- CN
- China
- Prior art keywords
- threonine
- genetic engineering
- gene
- engineering bacterium
- iclr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses construction method and its applications that a plant height produces L-threonine genetic engineering bacterium, belong to genetic engineering and technical field of microbial fermentation.The present invention checks the missing of iclR gene and the missing of encoding Thr transport protein tdcC gene by missing, the encoding transcription of encoding transcription regulatory factor arcA gene, improves the yield of L-threonine by a relatively large margin.The L-threonine output increased that makes to ferment after 36h reaches 0.67 to 20.1g/L, conversion ratio.
Description
Technical field
The present invention relates to a plant height produce L-threonine genetic engineering bacterium construction method and its application, belong to genetic engineering and
Technical field of microbial fermentation.
Background technique
L-threonine, molecular formula C4H9NO3, relative molecular weight 119.12, white crystals or crystalline powder, be human body must
Need one of amino acid.Threonine is chipal compounds, have respectively L-threonine, D-Thr, L- not-threonine and D- Bie-Soviet Union
These four isomers of propylhomoserin, wherein having physiological activity and naturally occurring only L-threonine.
In field of food, L-threonine is widely used as food additive, and nutritive value of food can be improved in it, tool
It relieves fatigue, the effect of enhancing development.L-threonine and other amino acid be used in mixed way can play the role of it is oxidation resistant,
Burnt odor taste can be generated after heating together with glucose.
In field of fodder, L-threonine is important feed additive, is the second largest or third in formula for pig forage
The third-largest or the fourth-largest limiting amino acid in big limiting amino acid and critical in poultry feed formulation.L- Soviet Union ammonia is added in feed
Acid can not only be formed with amino acid, promote poultry growth, the utilization rate of nitrogen also can be improved, reduce feeding cost.
In field of medicaments, L-threonine has the effect of promoting growth in humans's development, mitigating human-body fatigue and anti-fatty liver, and
And the pharmaceutical intermediate for still producing efficient antibiotic monobactam etc., therefore it is widely used in field of medicaments.L-threonine
It can promote lymphopoiesis, improve immune function of human body；Cell membrane can also be protected, promote fatty acid oxidation etc..
Although industry mass production L-threonine yield has reached 120g/l now, its conversion ratio (40%-50%) and theory
Conversion ratio (81%) still has larger gap.Therefore L-threonine Producing Strain is constructed with the means of metabolic engineering, reduces cost, it is right
Industrial production and national economy of L-threonine etc. are all of great significance.
Summary of the invention
It is with Escherichia coli for bacterium germination out the first purpose of the invention is to provide one plant of production L-threonine genetic engineering bacterium
Strain, has lacked arcA, iclR and tdcC gene on genome.
In one embodiment of the invention, the Escherichia coli were Escherichia coli TWF001, it has been disclosed that in 2018
Paper " Increasing L-threonine production in Escherichia coli by engineering
The glyoxylate shunt and the l-threonine biosynthesis pathway " in.
In one embodiment of the invention, the gene order of the arcA is as shown in SEQ ID NO.1.
In one embodiment of the invention, the gene order of the iclR is as shown in SEQ ID NO.2.
In one embodiment of the invention, the gene order of the tdcC is as shown in SEQ ID NO.3.
A second object of the present invention is to provide the method for constructing the genetic engineering bacterium, the method is with CRISPR
Gene editing technology has knocked out arcA, iclR and tdcC gene on genome of E.coli.
Third object of the present invention is to provide a kind of method for improving Escherichia coli L-threonine yield, the method is
Any gene silencing or missing Escherichia coli being located in arcA, iclR, tdcC on genome.
In one embodiment of the invention, the method is to knock out arcA, iclR and tdcC gene.
Fourth object of the present invention is to provide a kind of method for producing L-threonine, and the method is with above-mentioned either method
The genetic engineering bacterium of building is production bacterium, in 35~37 DEG C of 24~48h of fermentation.
In one embodiment of the invention, the genetic engineering bacterium is first cultivated 4 hours in 37 DEG C, 200r/min, then
With initial OD600It is transferred in fermentation medium for 0.2,37 DEG C, 200r/min culture 36 hours.
In one embodiment of the invention, the fermentation medium contains 25.0g/l glucose, 30.0g/l (NH4)2SO4, 2.0g/l yeast powder, 2.0g/l citric acid, 7.46g/l KH2PO4, 2g/l MgSO4·7H2O, 5mg/l FeSO4·
7H2O, 5mg/l MnSO4·4H2O, 20g/lCaCO3, pH 6.8.
The present invention passes through the missing of encoding transcription regulatory factor arcA gene, makes bacterial strain TCA circulation flux enhancing, and bacterial strain is raw
Long to accelerate, L-threonine yield is largely increased；The missing that iclR gene is checked by encoding transcription follows bacterial strain glyoxalic acid
The enhancing of ring flux, reduces the consumption of carbon flow and the generation of acetic acid, L-threonine yield obtains larger raising；Pass through coding Soviet Union ammonia
The missing of acid transporter albumen tdcC gene blocks threonine to turn to approach intracellular by extracellular, improves L- Soviet Union ammonia by a relatively large margin
The yield of acid.
Beneficial effects of the present invention:
(1) genetic engineering bacterium of the production L-threonine constructed using method of the invention carries out shake flask fermentation, can increase
Glucose consumption rate, after fermentation 18 hours, the glucose of 30g/l has been run out of, and starting strain needs 33 hours ability
It has consumed.
(2) missing of transcription regulatory factor ArcA and transcription repression IclR makes a large amount of reductions of the synthesis of acetic acid, reduces
Inhibition to thalli growth, while fermentation medium pH maintains 7.0 or so in the later period, is conducive to the metabolism of thallus.
(3) genetic engineering bacterium for the production L-threonine that the present invention constructs does not carry the plasmid component of related overexpression, upper tank
Fermentation prevents the loss of related plasmids without adding antibiotic, saves fermentation costs, is conducive to industrial practical application.
(4) the genetic engineering bacterium TWF018 yield for the production L-threonine that the present invention constructs reaches 20.1g/l, and conversion ratio is
0.67,0.5 conversion ratio compared to industrial production L-threonine at present improves 34%.
Detailed description of the invention
Fig. 1 is pTargetF-arcA, the plasmid map of pTargetF-iclR, pTargetF-tdcC.
Specific embodiment
In following embodiments of the invention, plasmid extraction kit used, genome extraction kit, glue recycling examination
Agent box, e. coli jm109 bacterial strain are purchased from Tiangeng biotech firm, restriction enzyme used, T4DNA ligase, PCR reagent
Deng TaKaRa biotech firm is purchased from, the primer is synthesized by Jin Weizhi biotech firm.
Seed culture medium (LB): the yeast powder of 5.0g/l, 10.0g/l peptone, 10.0g/l NaCI.Seed solid culture
Base adds 18.0g/l agar powder.
Fermentation medium: 30.0g/l glucose, 25.0g/l (NH4)2SO4, 2.0g/l yeast powder, 2.0g/l citric acid,
7.46g/l KH2PO4, 2g/l MgSO4·7H2O, 5mg/l FeSO4·7H2O, 5mg/l MnSO4·4H2O, 20g/lCaCO3,
pH 6.8.Sterilising conditions are 115 DEG C, 15min.
Embodiment 1:pTargetF-arcA, pTargetF-iclR, pTargetF-tdcC knock out the building of plasmid
Using pTargetF as template, sgRNA-arcA-F and T-sgRNA-R, sgRNA-iclR-F and T-sgRNA-R,
SgRNA-tdcC-F and T-sgRNA-R tri- carries out PCR amplification to primer respectively, and PCR product is carried out detected through gel electrophoresis respectively,
The primer size of acquisition meets expected size, and the linear pTargetF-arcA of purifying is obtained using plastic recovery kit,
PTargetF-iclR, pTargetF-tdcC segment, then above-mentioned segment 200ng is taken respectively, 0.5ul Dpn I, 1ul Dpn I is added
Buffer, 6ul ddH2O is placed in 37 DEG C of water-baths digestion template plasmid pTargeTF, be then added 2ul PNK phosphorylase and
2ul buffer, 6ul ddH2O is placed in 37 DEG C of water-baths and carries out phosphorylation, then above-mentioned system is placed in 65 DEG C water baths
10min inactivates enzyme, is eventually adding T4DNA ligase and is placed in 22 DEG C of connections 4 hours.The above linked system is converted into Escherichia coli
JM109, and it is coated with the LB plate of the spectinomycin containing 50mg/l, transformant is obtained after culture and is identified, will correctly be turned
Beggar accesses in 5ml LB liquid medium and is incubated overnight rear upgrading grain, finally obtains pTargetF-arcA, pTargetF-
IclR, pTargetF-tdcC knock out plasmid.The primer sequence are as follows:
SgRNA-arcA-F:CTTCACTTCTGTGAAAACCCGTTTTAGAGCTAGAAATAGC
SgRNA-iclR-F:CAGGTTCAGTCTTTAACGCGGTTTTAGAGCTAGAAATAGC
SgRNA-tdcC-F:GAGCATTTTGGTAAAACTGGGTTTTAGAGCTAGAAATAGC
T-sgRNA-R:ACTAGTATTATACCTAGGACTGAGC
Embodiment 2:arcAUD, iclRUD, tdccUD knock out the building of segment
The arcA (SEQ ID NO.1), iclR (SEQ ID NO.2), tdcC (SEQ ID reported according to Genebank
NO.3) gene order, select the segment of each 500bp of gene upstream and downstream or so size as knock out gene upstream and downstream homology arm,
Middle arcAU, arcAD are used for the knockout of arcA gene；IclRU, iclRD are used for the knockout of iclR gene；TdccU, tdccD are used for
The knockout of tdcc gene.Following 6 pairs of primers are devised, clone arcAU, arcAD, iclRU, iclRD are successively respectively used to,
TdccU, tdccD sequence:
ArcAf1:ACGCATATTGCCACTCTTCT
ArcAr1:TTACGAATACGGCGGATCTGCGTGTTACCAACTCGTC
ArcAf2:GACGAGTTGGTAACACGCAGATCCGCCGTATTCGTAA
ArcAr2:GCAAGCGGTATTGAAAGG
IclRf1:ATCGCAATGGTCGTGGAG
IclRr1:GACACCCTTATTCTATTGCCACGTTTATGCCAGTATGGTTTG
IclRf2:CAAACCATACTGGCATAAACGTGGCAATAGAATAAGGGTGTC
IclRr2:CTCAGGGTTTGGTGTTCATT
TdcCf1:GAGAAATAACCACGCACCG
TdcCr1:AACAGGCACAGCAGGGATTGATTTACGCCAGGACGAT
TdcCf2:ATCGTCCTGGCGTAAATCAATCCCTGCTGTGCCTGTT
TdcCr2:CGCCGATTCAATACCACT
Wherein arcAf1 and arcAr1 is for expanding arcAU segment, arcAf2 and arcAr2 for expanding arcAD segment；
IclRf1 and iclRr1 is for expanding iclRU segment, iclRf2 and iclRr2 for expanding iclRD segment；TdcCf1 and
TdcCr1 is for expanding tdccU segment, tdcCf2 and tdcCr2 for expanding tdccD segment.Overlapping pcr is recycled, is led to
Crossing arcAf1 and rcAr2, iclRf1 and iclRr2, tdcCf1 and tdcCr2 are respectively by arcAU and arcAD, iclRU and iclRD,
TdccU and tdccD is overlapped into arcAUD, tri- knockout segments of iclRUD, tdccUD.
The building of embodiment 3:arcA, iclR, tdcC deletion mycopremna
(paper " Increasing L-threonine in 2018 is had been disclosed in Escherichia coli TWF001
production in Escherichia coli by engineering the glyoxylate shunt and the l-
Threonine biosynthesis pathway " in) it is starting strain, electricity turns to knock out plasmid pTargetF-arcA, and knocks out
Segment arcAUD constructs deletion mycopremna TWF001 missing arcA into TWF001, and concrete operations process is as follows:
(1) plasmid pTargetF-arcA is extracted from e. coli jm109, it is spare with the water elution of pH8.0.
(2) electricity turns to knock out plasmid pTargetF-arcA and knocks out segment arcAUD to containing pCas Escherichia coli TWF001,
Bacterium solution is coated with containing kanamycin and spectinomycin LB plate and is cultivated, and screening obtains correct transformant.
(3) by the transformant of (2) respectively by IPTG induction and 42 DEG C be incubated overnight successively removal pTargetF-arcA and
Two kinds of plasmids of pCas, line the LB plate of nonreactive, and 37 DEG C are screened.The correct transformant obtained is named as TWF010.
Using the above method, using TWF010 as starting strain, electricity turns to knock out plasmid pTargetF-iclR and knocks out segment
IclRUD obtains the common deletion mycopremna of arcA and iclR, is named as TWF017 into TWF010.
Using the above method, using TWF017 as starting strain, electricity turns to knock out plasmid pTargetF-tdcC and knocks out segment
TdccUD obtains the common deletion mycopremna of arcA, iclR and tdcC, is named as TWF018 into TWF017.
Embodiment 4: the horizontal production of L-threonine by fermentation of recombination bacillus coli shaking flask
Culture medium prescription used in this example is as follows:
Seed culture medium (LB): 5g/l yeast powder, 10g/l peptone, 10g/l sodium chloride
Fermentation medium: the yeast powder of 2g/l, 2g/l citric acid, 7.46g/l KH2PO4, 30g/l glucose, 2g/l
MgSO4·7H2O, 20g/l CaCO3, 5mg/l FeSO4·4H2O, 5mg/l MnSO4·7H2O。
It chooses the single bacterium activated to fall in the test tube equipped with 5ml seed culture medium, then 37 DEG C, 200rpm culture 4h are pressed
Initial OD600It is forwarded in 30ml/250ml seed culture medium for 0.1,37 DEG C, 200rpm culture 4h finally press initial OD600For
0.2 is forwarded in 30ml/500ml fermentation medium, and the yield of L-threonine is measured by sampling in 37 DEG C, 200rpm culture 36h.
Fermentation liquid amino acid content is measured using HPLC in the present embodiment, and the specific method is as follows:
Fermented sample 1ml, 12000rpm is taken to be centrifuged 2min, take supernatant dilute with 5% trichloroacetic acid in clean EP pipe
20 times are released, 4 DEG C of standing 4h.Sample after standing is centrifuged 20min in 12000rpm, and 0.22nm water phase needle examination filter is filtered to amino
Upper machine testing in sour sample bottle.
The yield comparison of L-threonine is as follows in each mutant strain:
The L-threonine yield of 1 different strains of table
Comparative example 1:
The same Examples 1 to 3 of specific embodiment, difference are, using TWF001 as starting strain, electricity turns to knock out plasmid
PTargetF-iclR and knock out segment iclRUD into TWF001, obtain iclR deletion mycopremna, according to the step of embodiment 4 into
Row fermentation, the results show that singly striking iclR bacterial strain production amount of threonine after fermentation 36 hours only reaches 11.76g/l.
Comparative example 2:
The same Examples 1 to 3 of specific embodiment, difference are, using TWF001 as starting strain, electricity turns to knock out plasmid
PTargetF-tdcC and knock out segment tdcCUD into TWF001, obtain tdcC deletion mycopremna, according to the step of embodiment 4 into
Row fermentation, the results show that singly striking tdcC bacterial strain production amount of threonine after fermentation 36 hours also only reaches 13.7g/l.
Comparative example 3:
The same Examples 1 to 3 of specific embodiment, difference are, using TWF001 as starting strain, electricity turns to knock in plasmid
PTargetF-trc-gltA and segment Ptrc-gltA is knocked in into TWF001, obtain gltA and be overexpressed bacterial strain, according to embodiment 4
The step of ferment, the results show that be overexpressed gltA bacterial strain fermentation 36 after yield reach 11.0g/l, compare and bacterium germination out
Strain TWF001, is not significantly improved, and the citrate synthase of gltA coding is the first step key enzyme of TCA circulation.So this
The expression quantity of entire TCA cyclic gene can be enhanced in the missing of arcA in invention, plays a decisive role to the volume increase of threonine.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>one plant heights produce construction method and its application of L-threonine genetic engineering bacterium
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 717
<212> DNA
<213>artificial sequence
<400> 1
atgcagaccc cgcacattct tatcgttgaa gacgagttgg taacacgcaa cacgttgaaa 60
agtattttcg aagcggaagg ctatgatgtt ttcgaagcga cagatggcgc ggaaatgcat 120
cagatcctct ctgaatatga catcaacctg gtgatcatgg atatcaatct gccgggtaag 180
aacggtcttc tgttagcgcg tgaactgcgc gagcaggcga atgttgcgtt gatgttcctg 240
actggccgtg acaacgaagt cgataaaatt ctcggcctcg aaatcggtgc agatgactac 300
atcaccaaac cgttcaaccc gcgtgaactg acgattcgtg cacgcaacct actgtcccgt 360
accatgaatc tgggtactgt cagcgaagaa cgtcgtagcg ttgaaagcta caagttcaat 420
ggttgggaac tggacatcaa cagccgttcg ttgatcggcc ctgatggcga gcagtacaag 480
ctgccgcgca gcgagttccg cgccatgctt cacttctgtg aaaacccagg caaaattcag 540
tcccgtgctg aactgctgaa gaaaatgacc ggccgtgagc tgaaaccgca cgaccgtact 600
gtagacgtga cgatccgccg tattcgtaaa catttcgaat ctacgccgga tacgccggaa 660
atcatcgcca ccattcacgg tgaaggttat cgcttctgcg gtgatctgga agattaa 717
<210> 2
<211> 825
<212> DNA
<213>artificial sequence
<400> 2
atggtcgcac ccattcccgc gaaacgcggc agaaaacccg ccgttgccac cgcaccagcg 60
actggacagg ttcagtcttt aacgcgtggc ctgaaattac tggagtggat tgccgaatcc 120
aatggcagtg tggcactcac ggaactggcg caacaagccg ggttacccaa ttccacgacc 180
caccgcctgc taaccacgat gcaacagcag ggtttcgtgc gtcaggttgg cgaactggga 240
cattgggcaa tcggcgcaca tgcctttatg gtcggcagca gctttctcca gagccgtaat 300
ttgttagcga ttgttcaccc tatcctgcgc aatctaatgg aagagtctgg cgaaacggtc 360
aatatggcgg tgcttgatca aagcgatcac gaagcgatta ttatcgacca ggtacagtgt 420
acgcatctga tgcgaatgtc cgcgcctatc ggcggtaaat tgccgatgca cgcttccggt 480
gcgggtaaag cctttttagc ccaactgagc gaagaacagg tgacgaagct gctgcaccgc 540
aaagggttac atgcctatac ccacgcaacg ctggtgtctc ctgtgcattt aaaagaagat 600
ctcgcccaaa cgcgcaaacg gggttattca tttgacgatg aggaacatgc actggggcta 660
cgttgccttg cagcgtgtat tttcgatgag caccgtgaac cgtttgccgc aatttctatt 720
tccggaccga tttcacgtat taccgatgac cgcgtgaccg agtttggcgc gatggtgatt 780
aaagcggcga aggaagtgac gctggcgtac ggtggaatgc gctga 825
<210> 3
<211> 1332
<212> DNA
<213>artificial sequence
<400> 3
atgagtactt cagatagcat tgtatccagc cagacaaaac aatcgtcctg gcgtaaatca 60
gataccacat ggacgttagg cttgtttggt acggcaatcg gcgccggggt gctgttcttc 120
cctatccgcg caggttttgg cggactgatc ccgattcttc tgatgttggt attggcatac 180
cccatcgcgt tttattgcca ccgggcgctg gcgcgtctgt gtctttctgg ctctaaccct 240
tccggcaaca ttacggaaac ggtggaagag cattttggta aaactggcgg cgtggttatc 300
acgttcctgt acttcttcgc gatttgccca ctgctgtgga tttatggcgt tactattacc 360
aataccttta tgacgttctg ggaaaaccag ctcggctttg caccgctgaa tcgcggcttt 420
gtggcgctgt tcctgttgct gctgatggct ttcgtcatct ggtttggtaa ggatctgatg 480
gttaaagtga tgagctacct ggtatggccg tttatcgcca gcctggtgct gatttctttg 540
tcgctgatcc cttactggaa ctctgcagtt atcgaccagg ttgacctcgg ttcgctgtcg 600
ttaaccggtc atgacggtat cctgatcact gtctggctgg ggatttccat catggttttc 660
tcctttaact tctcgccaat cgtctcttcc ttcgtggttt ctaagcgtga agagtatgag 720
aaagacttcg gtcgcgactt caccgaacgt aaatgttccc aaatcatttc tcgtgccagc 780
atgctgatgg ttgcagtggt gatgttcttt gcctttagct gcctgtttac tctgtctccg 840
gccaacatgg cggaagccaa agcgcagaat attccagtgc tttcttatct ggctaaccac 900
tttgcgtcca tgaccggtac caaaacaacg ttcgcgatta cactggaata tgcggcttcc 960
atcatcgcac tcgtggctat cttcaaatct ttcttcggtc actatctggg aacgctggaa 1020
ggtctgaatg gcctggtcct gaagtttggt tataaaggcg acaaaactaa agtgtcgctg 1080
ggtaaactga acactatcag catgatcttc atcatgggct ccacctgggt tgttgcctac 1140
gccaacccga acatccttga cctgattgaa gccatgggcg caccgattat cgcatccctg 1200
ctgtgcctgt tgccgatgta tgccatccgt aaagcgccgt ctctggcgaa ataccgtggt 1260
cgtctggata acgtgtttgt taccgtgatt ggtctgctga ccatcctgaa catcgtatac 1320
aaactgtttt aa 1332
<210> 4
<211> 40
<212> DNA
<213>artificial sequence
<400> 4
cttcacttct gtgaaaaccc gttttagagc tagaaatagc 40
<210> 5
<211> 40
<212> DNA
<213>artificial sequence
<400> 5
caggttcagt ctttaacgcg gttttagagc tagaaatagc 40
<210> 6
<211> 40
<212> DNA
<213>artificial sequence
<400> 6
gagcattttg gtaaaactgg gttttagagc tagaaatagc 40
<210> 7
<211> 25
<212> DNA
<213>artificial sequence
<400> 7
actagtatta tacctaggac tgagc 25
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
acgcatattg ccactcttct 20
<210> 9
<211> 37
<212> DNA
<213>artificial sequence
<400> 9
ttacgaatac ggcggatctg cgtgttacca actcgtc 37
<210> 10
<211> 37
<212> DNA
<213>artificial sequence
<400> 10
gacgagttgg taacacgcag atccgccgta ttcgtaa 37
<210> 11
<211> 18
<212> DNA
<213>artificial sequence
<400> 11
gcaagcggta ttgaaagg 18
<210> 12
<211> 18
<212> DNA
<213>artificial sequence
<400> 12
atcgcaatgg tcgtggag 18
<210> 13
<211> 42
<212> DNA
<213>artificial sequence
<400> 13
gacaccctta ttctattgcc acgtttatgc cagtatggtt tg 42
<210> 14
<211> 42
<212> DNA
<213>artificial sequence
<400> 14
caaaccatac tggcataaac gtggcaatag aataagggtg tc 42
<210> 15
<211> 42
<212> DNA
<213>artificial sequence
<400> 15
caaaccatac tggcataaac gtggcaatag aataagggtg tc 42
<210> 16
<211> 19
<212> DNA
<213>artificial sequence
<400> 16
gagaaataac cacgcaccg 19
<210> 17
<211> 37
<212> DNA
<213>artificial sequence
<400> 17
aacaggcaca gcagggattg atttacgcca ggacgat 37
<210> 18
<211> 37
<212> DNA
<213>artificial sequence
<400> 18
atcgtcctgg cgtaaatcaa tccctgctgt gcctgtt 37
<210> 19
<211> 18
<212> DNA
<213>artificial sequence
<400> 19
cgccgattca ataccact 18
Claims (10)
1. one plant of production L-threonine genetic engineering bacterium, which is characterized in that using Escherichia coli as starting strain, lacked and be located at gene
ArcA, iclR and tdcC gene in group.
2. genetic engineering bacterium according to claim 1, which is characterized in that the gene order of the arcA such as SEQ ID
Shown in NO.1.
3. genetic engineering bacterium according to claim 1, which is characterized in that the gene order of the iclR such as SEQ ID
Shown in NO.2.
4. genetic engineering bacterium according to claim 1, which is characterized in that the gene order of the tdcC such as SEQ ID
Shown in NO.3.
5. genetic engineering bacterium according to any one of claims 1 to 4, which is characterized in that with Escherichia coli TWF001 be set out
Bacterial strain.
6. a kind of method for constructing any genetic engineering bacterium of Claims 1 to 4, which is characterized in that the method is to use
CRISPR gene editing technology has knocked out arcA, iclR and tdcC gene on genome of E.coli.
7. a kind of method for improving Escherichia coli L-threonine yield, which is characterized in that Escherichia coli are located on genome
Any gene silencing or missing in arcA, iclR, tdcC.
8. a kind of method for producing L-threonine, which is characterized in that be with any genetic engineering bacterium of Claims 1 to 5
Bacterium is produced, in 35~37 DEG C of 24~48h of fermentation.
9. according to the method described in claim 8, it is characterized in that, the fermentation medium contains 25~30g/l glucose, 20
~25g/l (NH4)2SO4, 1~2g/l yeast powder, 1~2g/l citric acid, 7~7.5g/l KH2PO4, 1~3g/l MgSO4·
7H2O, 4~6mg/l FeSO4·7H2O, 4~6mg/l MnSO4·4H2O, 15~25g/lCaCO3。
10. any genetic engineering bacterium of Claims 1 to 5 answering in product of the production containing L-threonine or derivatives thereof
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910077955.XA CN109735478B (en) | 2019-01-28 | 2019-01-28 | Construction method and application of high-yield L-threonine genetic engineering bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910077955.XA CN109735478B (en) | 2019-01-28 | 2019-01-28 | Construction method and application of high-yield L-threonine genetic engineering bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109735478A true CN109735478A (en) | 2019-05-10 |
| CN109735478B CN109735478B (en) | 2021-03-30 |
Family
ID=66366368
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910077955.XA Active CN109735478B (en) | 2019-01-28 | 2019-01-28 | Construction method and application of high-yield L-threonine genetic engineering bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109735478B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852572A (en) * | 2019-01-28 | 2019-06-07 | 江南大学 | A method of it knocking out Escherichia coli PTS system and improves L-threonine yield |
| CN110241062A (en) * | 2019-06-27 | 2019-09-17 | 江南大学 | New escherichia expression system |
| CN111363757A (en) * | 2020-01-19 | 2020-07-03 | 江南大学 | Temperature switch system and application thereof in improving yield of amino acid |
| CN113174356A (en) * | 2021-05-08 | 2021-07-27 | 廊坊梅花生物技术开发有限公司 | Recombinant bacterium for producing threonine and application thereof |
| CN113402593A (en) * | 2021-06-09 | 2021-09-17 | 江南大学 | L-threonine transport protein and coding gene and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1194088C (en) * | 2002-03-21 | 2005-03-23 | 第一制糖株式会社 | Process for prodn. of L-Thr |
| WO2009088183A1 (en) * | 2008-01-04 | 2009-07-16 | Cj Cheiljedang Corp. | Escherichia coli having an improved ability to produce l-threonine, and a method for producing l-threonine in which the said escherichia coli is employed |
| CN107699525A (en) * | 2017-11-09 | 2018-02-16 | 吉林大学 | L threonines high-yield genetic engineering bacterium and its application |
| CN105176906B (en) * | 2015-10-20 | 2018-08-31 | 上海工业生物技术研发中心 | L-threonine genetic engineering produces bacterium |
-
2019
- 2019-01-28 CN CN201910077955.XA patent/CN109735478B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1194088C (en) * | 2002-03-21 | 2005-03-23 | 第一制糖株式会社 | Process for prodn. of L-Thr |
| WO2009088183A1 (en) * | 2008-01-04 | 2009-07-16 | Cj Cheiljedang Corp. | Escherichia coli having an improved ability to produce l-threonine, and a method for producing l-threonine in which the said escherichia coli is employed |
| CN105176906B (en) * | 2015-10-20 | 2018-08-31 | 上海工业生物技术研发中心 | L-threonine genetic engineering produces bacterium |
| CN107699525A (en) * | 2017-11-09 | 2018-02-16 | 吉林大学 | L threonines high-yield genetic engineering bacterium and its application |
Non-Patent Citations (3)
| Title |
|---|
| BLATTNER, F.R.等: "Escherichia coli str. K-12 substr. MG1655, complete genome", 《GENBANK DATABASE》 * |
| HUI ZHAO等: "Increasing L-threonine production in Escherichia coli by engineering the glyoxylate shunt and the L-threonine biosynthesis pathway", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| PENGFEI GU等: "Construction of an L-serine producing Escherichia coli via metabolic engineering", 《JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852572A (en) * | 2019-01-28 | 2019-06-07 | 江南大学 | A method of it knocking out Escherichia coli PTS system and improves L-threonine yield |
| CN110241062A (en) * | 2019-06-27 | 2019-09-17 | 江南大学 | New escherichia expression system |
| CN111363757A (en) * | 2020-01-19 | 2020-07-03 | 江南大学 | Temperature switch system and application thereof in improving yield of amino acid |
| CN111363757B (en) * | 2020-01-19 | 2022-08-09 | 江南大学 | Temperature switch system and application thereof in improving yield of amino acid |
| CN113174356A (en) * | 2021-05-08 | 2021-07-27 | 廊坊梅花生物技术开发有限公司 | Recombinant bacterium for producing threonine and application thereof |
| CN113402593A (en) * | 2021-06-09 | 2021-09-17 | 江南大学 | L-threonine transport protein and coding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109735478B (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735478A (en) | One plant height produces construction method and its application of L-threonine genetic engineering bacterium | |
| JP6341936B2 (en) | High production strain of 5-aminolevulinic acid and its production method and use | |
| KR102013873B1 (en) | A microorganism of the genus Corynebacterium producing purine nucleotide and method for producing purine nucleotide using the same | |
| CN109852572B (en) | Method for knocking out escherichia coli PTS system to improve L-threonine yield | |
| CN109868254B (en) | Genetically engineered bacterium for high yield of pantothenic acid, construction method and application | |
| JP7090159B2 (en) | Corynebacterium microorganisms that produce L-amino acids and methods for producing L-amino acids using them | |
| MX2014006502A (en) | Microorganism for simultaneously producing l-amino acid and riboflavin, and method for producing l-amino acid and riboflavin using same. | |
| CN102021154A (en) | Method for improving yield of arginine by mutation of Corynebacterium crenatum N-acetyl glutamic acid kinase | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN104878034A (en) | L-lysine gene engineering producing bacterium | |
| CN103555779A (en) | Method for producing gamma-aminobutyric acid through fermentation | |
| CN104480058A (en) | High yield L-leucine engineering bacterium and application thereof | |
| CN108794635A (en) | A kind of Bovine lactoferricin-human lysozyme fusion protein, gene and its application | |
| CN103114069B (en) | Bacterium for fermenting L-tryptophan from mixed saccharum and fermentation method thereof | |
| CN108250278A (en) | The method for producing the bacterial strain and production Pidolidone of Pidolidone | |
| CN106635944A (en) | Glutamic acid corynebacterium and construction method and application thereof | |
| CN105112437A (en) | Method for producing L-ornithine by aid of recombinant corynebacterium crenatum one-step fermentation process | |
| EP2348101B1 (en) | Corynebacterium genus microorganism having ability to produce n-acetyl glucosamine and method for producing n-acetyl glucosamine or glucosamine using same | |
| CN105483069A (en) | Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain | |
| CN103468665B (en) | A kind of Corn phenylalanine ammonia enzyme and application thereof | |
| CN107312723B (en) | The yeast strain of high yield cAMP a kind of and its application | |
| CN103555739A (en) | Recombined microorganism glutamine transaminase gene and preparation method thereof | |
| CN109706106A (en) | A method of strengthening Fatty acid degradation and glyoxalic acid circulation improves production amount of threonine | |
| CN115838645A (en) | Yeast strain for high yield of orotic acid and application thereof | |
| CN109055417A (en) | A kind of recombinant microorganism, preparation method and its application in production Co-Q10 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |