CN109722479A - The kit of cancer screening, treatment and prognosis is carried out using non-coding RNA - Google Patents

Abstract

The present invention provides a kind of kit that cancer detection, treatment and prognosis are carried out using non-coding RNA.Non-coding RNA provided by the invention is used as the marker of detection and the prognosis of cancer, can simultaneously serve as the target for the treatment of of cancer.

Description

The kit of cancer screening, treatment and prognosis is carried out using non-coding RNA

Technical field

It is the present invention relates to technical field of molecular biology, in particular to a kind of to carry out cancer detection using non-coding RNA, control Treat the kit with prognosis.

Background technique

With the rapid development of genomic sequencing technique, it has been found that 70% genome sequence, which is transcribed, generates RNA, but The wherein sequential coding albumen only less than 2%, remaining is referred to as non-coding RNA.Long-chain non-coding RNA (long non- Coding RNA, lncRNA) refer to that transcript length is greater than 200 nucleotide, do not have a kind of RNA of encoding histone function.With It is past it is believed that non-coding RNA is " waste products ", but recently the study found that long-chain non-coding RNA to participate in regulation multinomial important Life process, including the occurrence and development of tumour.Long-chain non-coding RNA has primary sequence information, can be mutual by base It recruits and interacts to nucleic acid molecules；Secondary structure and albumen or nucleic acid molecules interaction or even shape can also be formed simultaneously At RNA-RNA- albumen or RNA-DNA- albumen MULTIPLE COMPOSITE body.Long-chain non-coding RNA source is wide, quantity is big and secondary structure is clever Work is changeable, therefore the mechanism of action also has diversity, is currently known the mode of action of long-chain non-coding RNA to sum up at least Following four: signaling molecule, bait, guide and scaffold.

In the past few decades, people achieve huge advance on the road for capture cancer, but it is still and causes the mankind Dead major reason.Tumor development research for a long time is primarily upon the effect of encoding gene, and obtains some progress. Such as to the research of E- calcium glutinous plain (E-cadherin), E- calcium sticks element and is to rely on Ca²⁺Transmembrane protein, the high table in epithelial cell It reaches, the close connection between directing epithelial, the downward of the gene can reduce the adhesion strength between epithelial cell, be conducive to tumour The malignant development of cell, this point is low with the expression quantity of the gene in malignant tumour sample to match.The similar glutinous element of E- calcium is in this way Encoding gene relevant to malignancy has very much, and the mechanism of action be also studied it is clear, clinically be directed to this The targeted drug performance that a little genes are developed is but not as good as people's will.A portion reason may is that these genes are not tumour The key of malignant development, is at least not all of, and understands their upstream regulated and control network and perhaps may consequently contribute to us and more fully understands Tumor development simultaneously and then develops suitable drug.The major function of long-chain non-coding RNA is controlling gene expression, therefore Paying close attention to long-chain non-coding RNA also seems very urgent in the effect of tumor development process.

There are reports for effect of long-chain non-coding RNA during tumor development in recent years.Long-chain non-coding Gene M ALAT1 (Metastasis-Associated Lung Adenocarcinoma Transcript1, MALAT1) is One of them, MALAT1 is initially concerned because of expression high in lung cancer, other subsequent study groups find it a variety of pernicious swollen There is unconventionality expression in tumor, and the high patient's poor prognosis for expressing the lncRNA, life cycle are short.Another known long-chain is non- Encoding gene HOTAIR (HOX transcript antisense RNA, HOTAIR), expression is in malignant breast carcinomas sample It is significantly raised in this.In mouse model, the source of people breast cancer cell line for being overexpressed the lncRNA has stronger Lung metastases energy Power.In summary, the process of research tumor development is gone using lncRNA as research object, can be diagnosis, the treatment of cancer New thinking is provided with prognosis.

Summary of the invention

In one embodiment, the present invention provides a kind of for detecting kit existing for cancer in subject, described It include the reagent of the non-coding RNA expression of detection subject in kit, wherein the non-coding RNA is HGNC number The non-coding RNA of LINC00973.

In one embodiment, the reagent of the non-coding RNA expression of the detection subject is for detecting The reagent of the transcript of non-coding RNA is stated, the transcript of the non-coding RNA is connected by SEQ ID NO:2 and SEQ ID NO:Y3 It connects and to be formed.

In one embodiment, non-coding RNA is before testing or period is converted to cDNA.

In one embodiment, the reagent of the non-coding RNA expression of the detection subject is using selected from survey The reagent that sequence technology, nucleic acid hybridization technique, nucleic acid amplification technologies and the method for immunoassays carry out.However, the present invention is not limited to Used technology.In some embodiments, nucleic acid amplification technologies are that polymerase chain reaction, reverse transcriptase polymerase chain formula are anti- It answers, the amplification of transcriptive intermediate, ligase chain reaction, strand displacement amplification or the amplification based on nucleic acid sequence.

In one embodiment, the cancer be leukaemia, osteocarcinoma, lymph cancer, intestinal cancer, liver cancer, gastric cancer, cancer of the esophagus, Uterine cancer, cervical carcinoma, lung cancer, the cancer of the brain, neural cancer, breast cancer, cancer of the esophagus, cancer of pancreas, lymph cancer, nasopharyngeal carcinoma, laryngocarcinoma, kidney, It is gallbladder cancer, kidney, bladder cancer, cervical carcinoma, uterine cancer, oophoroma, prostate cancer, fatty cancer, squamous carcinoma, thyroid cancer, lip cancer, black Any one of melanoma, tongue cancer or cutaneum carcinoma.

In one embodiment, a kind of composition for the treatment of cancer is provided, includes for inhibiting cancer in the composition The therapeutic agent of non-coding RNA function in disease patient, wherein the non-coding RNA is the non-coding of HGNC number LINC00973 RNA.In some embodiments, these therapeutic agents can be oligonucleotides or some small molecule compounds, and oligonucleotides can be with By in conjunction with LINC00973, to achieve the purpose that degrade the non-coding RNA to inhibit the function of the non-coding RNA.One In a little embodiments, according to the mode that LINC00973 is acted on, function of the targeting design small molecule compound to the non-coding RNA It carries out hindering to reach therapeutic purposes.

In one embodiment, a kind of kit for cancer patient's prognosis is provided, includes using in the kit The reagent of non-coding RNA content in detection cancer patient, wherein the non-coding RNA is the non-of HGNC number LINC00973 Coding RNA.

In one embodiment, the reagent for providing the expression for detecting non-coding RNA is used for screening in preparation Purposes in subject in kit existing for cancer, wherein the non-coding RNA is the non-coding of HGNC number LINC00973 RNA, the screening are the methods by including the following steps:

(a) biological sample from subject is contacted with the reagent for the expression for being used to detect the non-coding RNA； And

(b) expression of non-coding RNA described in the sample is detected using external test,

Wherein the expression of non-coding RNA described in the sample is increased relative to the level in normal human cell, Indicate that there are cancers in the subject.

A kind of reagent of the reagent in preparation for cancer patient's prognosis for detecting the expression of non-coding RNA is provided Purposes in box, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973, the prognosis is by including The method of following steps: (a) by the examination of biological sample and the expression for being used to detect the non-coding RNA from subject Agent contact；And the expression of non-coding RNA described in the sample (b) is detected using external test, wherein the sample Described in non-coding RNA expression relative in normal human cell level increase, indicate cancer patient's prognosis It is bad.

Detailed description of the invention

It in order to more clearly explain the technical solutions in the embodiments of the present application, below will be to needed in the embodiment Attached drawing is briefly described, it should be apparent that, the accompanying drawings in the following description is only some embodiments as described in this application, right For those of ordinary skill in the art, without creative efforts, it can also be obtained according to these attached drawings Its attached drawing.

Fig. 1 is cloning and sequencing result figure, and wherein Fig. 1 a is PLKO-NC sequencer map, and Fig. 1 b is PLKO-WN2 sequencer map, and figure 1c is PLKO-WN5 sequencer map；

Fig. 2 is that WN strikes inefficient result figure in LM2 cell；

Fig. 3 is colony formation baseline results picture；

Fig. 4 is the influence result figure that low WN cell proliferation ability is struck by clonality detection；

Fig. 5 is the influence result figure that low WN cell proliferation ability is struck by the experiment detection of low adsorption plate；

Fig. 6 is mouse tumor original image；

Fig. 7 is to strike low WN to the influence result figure of one-tenth knurl ability in cell body by internal tumor formation experiment detection；

Fig. 8 is to strike low WN to the influence result figure of one-tenth knurl ability in cell body by internal tumor formation experiment detection；

Fig. 9 be WN strike it is low to A549 Cell clonality test original image；

Figure 10 is that WN strikes the low influence result figure to A549 Cell clonality；

Figure 11 is the gene recovery efficiency result figure in CHIRP sample, wherein Figure 11 a: in CHIRP A sample, detection Probe recovery efficiency, abscissa are the primer designed for each gene, and ordinate is recovery efficiency；With Figure 11 b: in CHIRP In B sample, detection probe recovery efficiency, abscissa is for the primer of each gene design, ordinate is recovery efficiency；

Figure 12 is to be selected as the albumen further verified in the albumen of Mass Spectrometer Method out；

Figure 13 is the interaction diagram of RIP experimental verification LDHA and WN；

Figure 14 is the interaction diagram that RIP experiment repeats LDHA and WN；

Figure 15 be seahorse experiment detection WN strike it is low after to the influence diagram of glycolysis whole process；

Figure 16 be WN strike it is low after to the influence diagram of glycolysis；

Figure 17 is LDHA and WN interaction diagram in MDA-MB-231 cell；

Figure 18 is LDHA and WN interaction diagram in A549 cell；

Figure 19 is that expression of the WN in normal sample and breast cancer tumour sample has significant difference result figure；

Figure 20 is that expression of the WN in the different breast cancer tumour sample of grade malignancy has significant difference result figure；

Figure 21 is the highly expressed breast cancer sample prognosis figure of WN, and wherein 21a is WN in normal specimens and breast cancer sample Expression spirogram in this, 21b and 21c are WN expression figure in breast cancer sample respectively；With

Figure 22 is expression quantity distribution results figure of the WN in different samples, and Figure 22 a is the expression result chart in bladder cancer, figure 22b is the expression result chart in head and neck cancer, and Figure 22 c is in Expression In Renal Cell Carcinoma result figure, and Figure 22 d is in Expressions in Lung Cancer result Figure and Figure 22 e are the expression result charts in thyroid cancer.

Specific embodiment

In order to make art technology field personnel more fully understand the technical solution in the application, below in conjunction with following knot Closing embodiment, the invention will be further described, it is clear that and described embodiments are only a part of embodiments of the present application, without It is whole embodiments.Based on the embodiment in the application, those of ordinary skill in the art are not before making creative work All other embodiment obtained is put, shall fall within the protection scope of the present application.

One WN's of embodiment strikes the low influence to Cells Proliferation of Human Breast Cancer ability

WN, LINC00973, position on chromosome are as follows: hg38chr3:98,981,058-98,983,096, transcript Number is ENST00000473756.1, and altogether there are two exon, it is as follows to transcribe out RNA full length sequence by transcript overall length 962nt:

Sequence number SEQ ID NO:1:

agaagctcttgggagcatgtggacagttgtggctgctcctgagctgacactaactgctcatgactcctctgtgggag aagtaggtggtttcctagaggaagaagtttgggtaatgaagccacagagatttgctgatacatttgctaggcacgac ttctggtcatttagaaagctattttgtggcttcatcaataaggtattccccagctgtgttactccttcgcattgtta tctctttccctggaattgaaggcttcctggtctgaggcaaggacaattattccctcactgtcaaccctgatctctgg ctgcagtaatgagtagaggaaatgaagaaataagaatggaagcataatcatttgtccgaggtcacagagggagatga ttacacagctggaatgtaagcctcagtactttactgaatccttggctttgtccatgggcccagctacaggcataaag cttttctcttccccagcagtgacttcgagtaccagctttcaaatttatttgacattgaatctaagctttgtgaccag tatgtagaaggagaagaaggggaggaattacttatcctttggcatacattagcatgcaaataaatcctttctctgca ttgtggaagggtctgaaattatcacatatacaatgtatcttttatcaatggccttgcatacaaattttactttgaag aatccagatttagaggtcttctccaaacatttgcattgtttctttttcttaggatcagaacttctacctattgtcat tttaagaaaaaagatcatgaattaattaatttattcattatttacacccttatattctttcccaaatgttttaatgt ggcttacattgtatacatgtacacaataaatatttatatttaaataagttataatcacagaatgagaatattattac aaccactcatactcattcaaatagcttgattatatcat

First exon sequence is as follows:

Sequence number SEQ ID NO:2:

agaagctcttgggagcatgtggacagttgtggctgctcctgagctgacactaactgctcatgactcctctgtgggag aagtaggtggtttcctagaggaagaagtttgggtaatgaagccacagagatttgctgatacatttgctaggcacgac ttctggtcatttagaaagctattttgtggcttcatcaataaggtattccccagctgtgttactccttcgcattgtta tctctttccctggaattgaaggcttcctggtctgaggcaaggacaattattccctcactgtcaaccctgatctctgg ctgcagtaatgagtagaggaa

Second exon sequence is as follows:

Sequence number SEQ ID NO:3:

atgaagaaataagaatggaagcataatcatttgtccgaggtcacagagggagatgattacacagctggaatgtaagc ctcagtactttactgaatccttggctttgtccatgggcccagctacaggcataaagcttttctcttccccagcagtg acttcgagtaccagctttcaaatttatttgacattgaatctaagctttgtgaccagtatgtagaaggagaagaaggg gaggaattacttatcctttggcatacattagcatgcaaataaatcctttctctgcattgtggaagggtctgaaatta tcacatatacaatgtatcttttatcaatggccttgcatacaaattttactttgaagaatccagatttagaggtcttc tccaaacatttgcattgtttctttttcttaggatcagaacttctacctattgtcattttaagaaaaaagatcatgaa ttaattaatttattcattatttacacccttatattctttcccaaatgttttaatgtggcttacattgtatacatgta cacaataaatatttatatttaaataagttataatcacagaatgagaatattattacaaccactcatactcattcaaa tagcttgattatatcat

1. design shRNA sequence strike to WN low

In order to detect whether WN influences the proliferative capacity of breast cancer Lung metastases cell line LM2, inventor designs shRNA first Sequence strike to WN low.Inventor designs shRNA sequence to WN, and sequence is as follows: 5'- Ccgggcacgacttctggtcatttagctcgagctaaatgaccagaagtcgtgctttt tg-3'(SEQ ID NO:4) and 5'-ccggcgagtaccagctttcaaatttctcgagaaatttgaaagctggtactcgtttttg-3'(SEQ ID NO: 5) PLKO-WN2 and PLKO-WN5, are respectively designated as；PLKO-NC sequence derives from the document delivered, and (sequence is from text It offers, documentation & info is as follows: Willmann K L, Milosevic S, Pauklin S, et al.A role for the RNA polII–associated PAF complex in AID-induced immune diversification[J].Journal ofExperimental Medicine,2012,209(11):2099.).Following inventor synthesizes following sequence (SEQ ID NO:6 and SEQ ID NO:7 is the upstream and downstream sequence of PLKO-NC；SEQ ID NO:8 and SEQ ID NO:9 is the upper of PLKO-WN2 Downstream sequence；SEQ ID NO:10 and SEQ ID NO:11 is the upstream and downstream primer sequence of PLKO-WN5；), such as table 1:

Table 1: for striking the shRNA sequence of low WN experiment

Sequence names	Sequence number	Sequence
			PLKO-NC FP	SEQ ID NO:6	ccggcaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttgtttttg
PLKO-NC RP	SEQ ID NO:7	aattcaaaaacaacaagatgaagagcaccaactcgagttggtgctcttcatcttgttg
			PLKO-WN2FP	SEQ ID NO:8	ccgggcacgacttctggtcatttagctcgagctaaatgaccagaagtcgtgctttttg
PLKO-WN2RP	SEQ ID NO:9	aattcaaaaagcacgacttctggtcatttagctcgagctaaatgaccagaagtcgtgc
			PLKO-WN5FP	SEQ ID NO:10	ccggcgagtaccagctttcaaatttctcgagaaatttgaaagctggtactcgtttttg
PLKO-WN5RP	SEQ ID NO:11	aattcaaaaacgagtaccagctttcaaatttctcgagaaatttgaaagctggtactcg

Vector construction is carried out, carrier construction method is as follows:

Each serial dilution is equipped with lower system at 10uM:

FP (10uM) (upstream primer is diluted to 10uM)	10ul
		RP (10uM) (downstream primer is diluted to 10uM)	10ul
T4DNA ligase buffer solution	5ul
		H2O	25ul

Reaction condition: 95 ° of water-bath 5min are then shut off water-bath, are down to room temperature naturally to temperature, take out for next Step reaction.

Inventor carries out digestion to PLKO.1.puro carrier (deriving from addgene), and digestion system is as follows:

37 ° of reaction 30min, gel extraction.

The shRNA sequence of the annealing carrier good with digestion is attached in next step, linked system is as follows:

Anneal sequence (1:40 dilution)	3.5ul
		T4DNA ligase	0.5ul
T4DNA ligase buffer solution	0.5ul
		The PLKO.1.puro carrier of digestion	25ng
H2O	It is added to 50ul

22 ° of connections 60min, transformed competence colibacillus cell DH5a choose correct clone, cloning and sequencing the result shows that, shRNA sequence On column successful clone to carrier, vector construction success；It is specifically shown in Fig. 1 a-1c.

After completing vector construction, further progress virus packaging.Steps are as follows: the 0th day first paving 293T cell；1st day Reach 60% or so to 293T cell density, takes 10ug to distinguish in PLKO-NC, PLKO-WN2 and PLKO-WN5 carrier built Be mixed together with 10ug PsPAX2 and 5ug PMD2.G, with health be DNA transfection reagent DNAfect transfection 293T cell, 8 hours After change liquid；Virus is received respectively within 48 hours and 72 hours, be filtered with 0.45um filter membrane, complete filtering packing and be put in -70 ° of progress It saves；LM2 cell is spread in six orifice plates, grows to 60% or so to cell density, virus infection, each hole 2ml virus+0.5ml Fresh culture (DMEM+10%FBS), every group to do three biologies parallel, changes liquid after eight hours；It changes after liquid 48 hours, gives cell Fresh culture is changed, while puromycin is added, until final concentration of 2ug/ml；After puromycin screens 48 hours, at trizol Cell is managed, RNA is extracted.RNA extraction step is as follows: abandoning cell culture medium, 400ul trizol is added in each hole, and piping and druming is resuspended thin Born of the same parents are placed in EP pipe；The cell being resuspended is mixed, 80ul chloroform is added, acutely shakes, is put in room temperature 5min；13000rpm 4° It is centrifuged 15min, carefully draws supernatant liquid, is managed in new EP；The isopropanol of 1/2 supernatant is added, mixing is stored at room temperature 5min, in 13000rpm4 ° of centrifugation 15min；Supernatant is removed, 70% ethyl alcohol of 750ul is added, is mixed by inversion, 4 ° of centrifugation 5min of 8000rpm； It is repeated 1 times；Supernatant is removed, is volatilized to ethyl alcohol, 20ul water is added and dissolves RNA.Concentration survey is carried out with Nanodrop after RNA dissolution It is fixed, it is inverted with Thermo Scientific RevertAid First Strand cDNA Synthesis Kit, each 3ug RNA, each reaction 20ul reaction system is added in reaction；After the completion of reversion, cDNA is diluted 20 times, is reacted for qPCR.

Each hole 10ul reaction system configures reaction system according to following table:

2XSYBR mixed liquor	5ul
		FP (1uM) (upstream primer is diluted to 1uM)	1ul
RP (1uM) (downstream primer is diluted to 1uM)	1ul
		cDNA	3ul

Table 2:qPCR primer sequence table

Sequence names	Sequence number	Sequence
			WN FP	SEQ ID NO:12	cagctgtgttactccttcgc
WN RP	SEQ ID NO:13	ctgctggggaagagaaaagc
			Actin FP	SEQ ID NO:14	atctggcaccacaccttctac
Actin RP	SEQ ID NO:15	cagccaggtccagacgcagg

QPCR program is as follows:

95°10min；

95 ° of 15s, 60 ° of 45s, 35 circulations；

Obtain qPCR initial data such as table 3:

Ct value of the table 3:WN in PLKO-NC, PLKO-WN2 and PLKO-WN5 sample

Method carries out data analysis, obtains the following table 4:

Table 4: according toTwo shRNA of method calculated PLKO-WN2 and PLKO-WN5 strike poor efficiency

	Average	Standard deviation
			PLKO-NC	1	0.084035
PLKO-WN2	0.095633223	0.008424
			PLKO-WN5	0.060398626	0.002235

Thus table is used it is found that two shRNA of PLKO-WN2 and PLKO-WN5 reach 90% or more to the poor efficiency of striking of WN GraphPad Prism mapping, such as Fig. 2.

2.WN's strikes the enough obvious inhibition ability of cell proliferation of low energy

Following inventor has carried out colony formation to prove that the low energy of striking of WN enough influences ability of cell proliferation.The reality It is as follows to test operating procedure: paving LM2 cell grows to 60% or so in six orifice plates, to cell density, infects PLKO-WN2, PLKO- The virus of WN5 and PLKO-NC packaging, each hole 2ml virus+0.5ml fresh culture (DMEM+10%FBS), every group is done three It is biological parallel, liquid is changed after eight hours；It changes after liquid 48 hours, changes fresh culture to cell, while puromycin is added, until dense eventually Degree is 2ug/ml；After puromycin is handled 48 hours, culture medium is removed, every hole is added pancreatin 400ul, removes after being handled with pancreatin Pancreatin is placed on 37 ° of incubator 2min, and fresh culture (DMEM+10%FBS) is added and is resuspended, counts to cell；By cell It spreads in six orifice plates, every hole spreads 1500 cells, and after cell is 8 days long, microscopically observation has apparent Clone formation；With more Polyformaldehyde is fixed, half an hour set time, then removes paraformaldehyde, then with 0.2% violet staining half an hour, PBS Cleaning, dries；It takes pictures, is analyzed with ImageJ, count purple area, account for one hole of entire six orifice plate with purple area Area as statistical value.Original image such as Fig. 3.

It is handled through ImageJ, as a result such as table 5, as can be seen from the results, compared with PLKO-NC, PLKO-WN2 and PLKO-WN5 group Clone's occupied area ratio is substantially reduced, and illustrates that striking for WN low inhibits tumor cell proliferation ability.Use GraphPad Prism mapping, such as Fig. 4.

Table 5: the colony formation ImageJ result that carries out that treated

3.WN's strikes the enough obvious inhibition non-adsorbed clonalities of cell of low energy

Following inventor has carried out non-adsorbed colony formation, which needs using low adsorption plank, analog Cell forms the ability of clone ball under non-adsorbed state in vivo.The experimental procedure is as follows: LM2 cell is spread in six orifice plates, to Cell density grows to 60% or so, the virus of infection PLKO-WN2, PLKO-WN5 and PLKO-NC packaging, and each hole 2ml virus+ 0.5ml fresh culture (DMEM+10%FBS), every group to do three biologies parallel, changes liquid after eight hours；It changes after liquid 48 hours, gives Cell changes fresh culture, while puromycin is added, until final concentration of 2ug/ml；After puromycin is handled 48 hours, removal Culture medium, every hole are added pancreatin 400ul, remove pancreatin after being handled with pancreatin, are placed on 37 ° of incubator 2min, and fresh cultured is added Base (DMEM+10%FBS) is resuspended, and terminates the digestion of pancreatin；1200rpm be centrifuged 5min remove culture medium, use instead containing The culture medium of 0.1%FBS is resuspended, and cell count is carried out；Cell is spread in 24 orifice plate low adsorption plates, every hole spreads 2000 Cell, 8 holes of every group of paving, after 8 days, counts cell clone ball number under microscope.Original clone ball number statistical Such as table 6:

Table 6: low adsorption tests raw statistical data

Hole	PLKO-NC	PLKO-WN2	PLKO-WN5
				1	10	2	7
2	8	0	5
				3	17	1	5
4	17	2	8
				5	15	3	6
6	13	3	4
				7	14	2	6
8	14	1	4

Turned by the table it is found that having transfected PLKO-WN2 and having been compared with the viral cell that two plasmids of PLKO-WN5 are packed out The virus that negative control PLKO-NC plasmid is packed out is contaminated, the clone ball number of formation obviously tails off, and illustrates that WN's strikes low energy Enough obvious inhibition non-adsorbed clonalities of cell.It is mapped with GraphPad Prism, such as Fig. 5.

What following inventor further verified WN strikes low whether influenced on the one-tenth knurl ability of tumour cell.The experiment Operating procedure is as follows: paving LM2 cell grows to 60% or so in 10cm ware, to cell density, infects PLKO-WN2 and PLKO-NC The virus of packaging, every ware 6ml virus+4ml fresh culture (DMEM+10%FBS), changed liquid after eight hours；It changes after liquid 48 hours, Fresh culture is changed to cell, while puromycin is added, until final concentration of 2ug/ml；After puromycin is handled 48 hours, go Except culture medium, pancreatin 2ml is added in every ware, removes pancreatin after being handled with pancreatin, is placed on 37 ° of incubator 2min, and fresh cultured is added Base (DMEM+10%FBS) is resuspended, and terminates pancreatin effect；1200rpm5min centrifugation, removes supernatant, is resuspended with PBS, dilutes At every milliliter of 2*10^6, every nude mice injects 2*10^5 cell, and nude mice number used in every group is 8, and injection system is subcutaneous Injection；At 40 days, nude mice is put to death, tumor is removed, weighed to tumor size.Tumor size such as Fig. 6, tumor weight Amount such as table 7.

Table 9: tumor sizes values

Mouse	PLKO-NC(mg)	PLKO-WN2(mg)
			1	33	It is not detected
2	258	It is not detected
			3	131	It is not detected
4	45	It is not detected
			5	152	It is not detected
6	312	It is not detected
			7	It is not detected	It is not detected
8	It is not detected	It is not detected

As seen from table, the cell tumor formation in Mice Body for the virus that negative control PLKO-NC plasmid is packed out has been transfected Knurl be considerably greater in weight than the tumor for having transfected the cell for the virus that PLKO-WN2 plasmid packs out in the subcutaneous tumor formation of mouse The weight of body.GraphPad Prism mapping such as Fig. 7.

Embodiment two: WN strikes the low influence to proliferation of lung cancer cells ability

Inventor has found the WN not only high expression in breast cancer, while the also high expression in kinds cancer, including lung Cancer, therefore inventor verifies its phenotype in human lung adenocarcinoma cell line A549's cell.Inventor first verifies that in mammary gland Whether the good two shRNA sequence PLKO-WN2 and PLKO-WN5 of effect can be to A549 in cancer Lung metastases cell line LM2 Have and strikes inefficient fruit well.Detection method is with the detection method in LM2, qPCR initial data such as table 8:

Table 8:WN strikes the original ct value of the low qPCR in A549 cell

According toMethod carries out data analysis, table 9 is obtained, by the table it is found that with negative plasmid PLKO-NC packet has been transfected The cell for taking on the virus come is compared, in the cell for having transfected the virus that PLKO-WN2 and PLKO-WN5 plasmid is packed out, WN Expression quantity reduce, it could be assumed that two shRNA sequences of PLKO-WN2 and PLKO-WN5 can obviously inhibit WN thin in A549 Expression quantity in born of the same parents.It is mapped with GraphPad Prism, such as Fig. 8.

Table 9: according toMethod calculates WN and strikes poor efficiency in A549 cell

	Average value	Standard deviation
			PLKO-NC	1	0.083505972
PLKO-WN2	0.150726	0.012587
			PLKO-WN5	0.374042	0.019957

Next, inventor strikes the low proliferation that whether will affect A549 cell by clonality experimental verification WN Ability.Method is the same as the method in LM2.Violet staining result such as Fig. 9.With ImageJ processing result such as table 10；With GraphPad Prism mapping, as a result such as Figure 10.

Table 10: the colony formation result handled with ImageJ

It can be seen from the above result that striking for WN low is able to suppress lung cell A549 body outer clone Forming ability.

Repercussion study of the embodiment 3WN and LDHA in breast cancer cell line LM2

After the influence for having verified WN cell proliferation ability, inventor thinks the mechanism of action for further exploring WN.Inventor Experimental method is CHIRP.The technology is a kind of method for probing into RNA and DNA interaction, later researcher earliest It was found that this method can also be used to probe into the interaction between RNA and albumen.The principle is as follows: first by synthesizing a plurality of target To the probe of the complementary series of lncRNA, and modification is carried out to it plus biotin, be later crushed the probe with crosslinked The cell sample crossed is hybridized, and the probe that end has biotin modification is captured with the magnetic bead with streptomysin, thus will The albumen that purpose lncRNA is combined pulls out together, and treated, and sample is analyzed by mass spectrometry by protein detection center Find the albumen that there may be interaction with purpose lncRNA.

For the experiment, it is parallel that inventor has done two biologies.Firstly, inventor has collected 30 15cm ware LM2 cells, As 1 group, every solencyte is crosslinked every 10 ware with 3% formaldehyde, after the completion of crosslinking, is resuspended with 1ml cell pyrolysis liquid, weight Ultrasound carries out clasmatosis after outstanding, and ultrasound to cell pyrolysis liquid becomes clear, is then centrifuged for removal cell fragment, collects supernatant Liquid, every 10 pipe mix as one group.One group echo be WN-A, a group echo be WN-B, every group of 10ml cell pyrolysis liquid, often Group takes 100ul as reserved sample, finally extracts RNA and uses.While two biologies of setting are parallel, it is right that a feminine gender is set According to group, negative control group processing is different from experimental group, and to negative control group, 10ul is added in ultrasonication in every solencyte RNAseA processing and protease inhibitors, digestion removes the RNA in cell, and experimental group is added in each step treatment process RNAse inhibitor and protease inhibitors.Next every group of sample and the pretreated Streptavidin of use cell pyrolysis liquid is even The magnetic bead 500ul of connection mixes, and pre-processes to cell pyrolysis liquid, 37 ° of incubation 30min, after the completion of incubation, in magnetic frame Upper absorption removes magnetic bead.Then the probe of hybridization solution and the biotin labeling for WN design is added, probe is final concentration of 0.2uM is protected from light incubation reaction 4 hours in 37 °.The probe sequence such as table 11 having for the label of WN design:

For probe designed by WN in table 11:CHIRP experiment

Primer	Sequence number	Sequence (from left to right 5` to 3`)	Modification
				NWN-1	SEQ ID NO:16	agtcatgagcagttagtgtc	3'Biotin-TEG
NWN-2	SEQ ID NO:17	cattactgcagccagagatc	3'Biotin-TEG
				NWN-3	SEQ ID NO:18	gaagtcgtgcctagcaaatg	3'Biotin-TEG
NWN-4	SEQ ID NO:19	agaccaggaagccttcaatt	3'Biotin-TEG
				OWN-5	SEQ ID NO:20	aagctggtactcgaagtcac	3'Biotin-TEG
OWN-6	SEQ ID NO:21	tgcatgctaatgtatgccaa	3'Biotin-TEG
				OWN-7	SEQ ID NO:22	gtatgcaaggccattgataa	3'Biotin-TEG
OWN-8	SEQ ID NO:23	gaatgagtatgagtggttgt	3'Biotin-TEG
				OWN-9	SEQ ID NO:24	ctttatgcctgtagctggg	3'Biotin-TEG
OWN-10	SEQ ID NO:25	tggagaagacctctaaatct	3'Biotin-TEG

When reacting 3.5 hours, it is added and recycles life with the magnetic bead of the pretreated 1ml marked by streptavidin of cell pyrolysis liquid The probe of object element label, is adsorbed on magnetic frame, recycles magnetic bead.Magnetic bead is cleaned with cleaning solution, cleaning is clear with 1ml every time Washing lotion is cleaned 4 times altogether, and after last time cleaning is resuspended, 1ml re-suspension liquid takes 50ul to be used to mention RNA.Remaining 950ul Adsorption Supernatant elutes it with the eluent 500ul containing biotin, albumen wash-out is got off, and with acetone precipitation, it is heavy to take albumen It forms sediment, is resuspended with WB sample solution, run protein adhesive after being resuspended, protein band is sent to and does Mass Spectrometric Identification.

Firstly, inventor passes through qPCR detection probe efficiency.Sample and last 50ul are reserved in experimentation by extracting The RNA of re-suspension liquid, RNA are resuspended with 25ul, are then inverted to RNA, and reserved sample takes 1ul to be inverted, and are finally returned It receives sample to be inverted with 10ul, inverts system 20ul, the cDNA after reversion dilutes 5 times and tests for qPCR, will finally be resuspended The expression quantity of WN just obtains recovery efficiency compared with reserved sample in liquid.In order to detect whether WN different fragments recovery efficiency has Difference devises different qPCR primers, respectively WN-3, WN-5 and WN-6 for WN difference section.In order to verify probe Whether specificity, i.e. probe are specifically to be enriched with to WN, are also detected to the recovery efficiency of other genes, this A little genes include 16S, 18S and 7SK.Specific experiment data are as follows, such as table 12 of the primer sequence for qPCR, qPCR initial data Such as table 13.

The primer sequence in table 12:CHIRP-qPCR

Primer	Upstream primer sequence	Downstream primer sequence
			WN-3	tggtctgaggcaaggacaat(SEQ ID NO:26)	tactcgaagtcactgctggg(SEQ ID NO:27)
WN-5	cccagcagtgacttcgagta(SEQ ID NO:28)	acccttccacaatgcagaga(SEQ ID NO:29)
			WN-6	cgaggtcacagagggagatg(SEQ ID NO:30)	tactcgaagtcactgctggg(SEQ ID NO:31)
7SK	gacatctgtcaccccattga(SEQ ID NO:32)	gcctcatttggatgtgtctg(SEQ ID NO:33)
			16S-1	attaagaaagcgttcaag(SEQ ID NO:34)	tatgcggaggagaatgt(SEQ ID NO:35)
18S	gtaacccgttgaaccccatt(SEQ ID NO:36)	ccatccaatcggtagtagcg(SEQ ID NO:37)

The original ct value of table 13:CHIRP-qPCR

According to formula

Table 14 and table 15 is calculated:

Recovery efficiency of the table 14:WN-A sample middle probe to different genes

Recovery efficiency of the table 15:WN-B sample middle probe to different genes

By table 14 and table 15 it is found that the recycling for primer WN-3, WN-5 and WN-6 of WN design WN that detected is imitated Rate is than more consistent in two parallel samples, and between 10%-60%, and the recovery efficiency of crt gene is very low.It can obtain Conclusion probe can specific enrichment WN, and to other crt genes without concentration effect.With GraphPad Prism mapping as schemed 11, Figure 11 a: in CHIRP A sample, detection probe recovery efficiency, abscissa is the primer designed for each gene, indulges and sits It is designated as recovery efficiency；Figure 11 b: in CHIRP B sample, detection probe recovery efficiency, abscissa is to design for each gene Primer, ordinate is recovery efficiency.

According to mass spectral results, hundreds of albumen is detected altogether, is first parallel samples according to two samples of WN-A and WN-B, NC is negative control sample, and inventor is chosen at the egg for occurring in two samples of WN-A and WN-B and not occurring in NC sample White to be further analyzed, such albumen shares 54, albumen list such as table 16.

The albumen that table 16:WN-A and WN-B sample standard deviation occurs and do not occur in NC sample

It further excludes the low albumen of expression quantity and affine albumen is known as to biology, finally obtain 12 albumen as schemed 12。

Wherein lactate dehydrogenase L DHA high expression in kinds of tumors, and its expression is related to grade malignancy, this feature With WN than more consistent, therefore inventor first verifies LDHA.Inventor is carried out with LDHA antibody and TXN antibody RIP experiment, negative control is IgG, and totally three groups, every group with a 15cm ware cell concentration.Firstly, being cracked to cell, with three A 15cm ware cell concentration, is obtained 500ul cell pyrolysis liquid, and every group with cell pyrolysis liquid 100ul, is reserved cell pyrolysis liquid 100ul.Then 5ug LDHA antibody, 5ug TXN antibody and 5ug IgG antibody are respectively coupled to the magnetic bead of proteinA/G coupling On, after completing antibody connection, antibody magnetic bead compound is added in 100ul cell pyrolysis liquid, four degree of reaction overnights, is reacted Afterwards, cleaning 6 times is carried out with cleaning solution, after the completion of cleaning, the Adsorption supernatant on magnetic frame obtains magnetic bead, and keeps sample in advance This is separately added into Trizol together and carries out RNA extraction, and RNA 25ul water is dissolved, then inverted to RNA, reserved sample takes 1ul is inverted, and is finally recycled sample and is inverted with 10ul, inverts system 20ul, and the cDNA after reversion dilutes 5 times and is used for Whether qPCR experiment detects WN by RT-qPCR and is enriched in the amount in sample that finally obtains relative to reserved sample, thus really Determine whether WN with LDHA has interaction.QPCR initial data such as table 17.

The original ct value of table 17:RIP-qPCR

According to formula

Calculated result such as table 18,19 and 20:

Table 18:IgG group, the bioaccumulation efficiency of different genes

	Originate reserved sample	IgG antibody group	Ct (reserved+the log of recycling-2 9.5)	2[- Ct (reserved+log2 9.5 of recycling -)]	Recovery efficiency
						WN-primer3	22.69	29.14	9.697928	0.001204017	0.120401744
WN-primer6	22.17	28.5	9.577928	0.001308448	0.130844772
						18S	6.86	16.88	13.267928	0.000101381	0.010138079
7SK	14.4	24.61	13.457928	8.8871E-05	0.008887098

Table 19:LDHA antibody group, the bioaccumulation efficiency of different genes

Table 20:TXN antibody, the bioaccumulation efficiency of different genes

WN-primer3 in the experimentation, WN-primer6,18S and 7SK primer sequence is the same as table 12.

As can be seen from the results, it compared with TXN and IgG, is imitated for the WN recycling that the primer WN-3 and WN-6 of WN design are detected Rate is apparently higher than IgG combination TXN antibody group in LDHA antibody addition group, illustrates that LDHA can interact with WN, for control The recovery efficiency for the 18S and 7SK gene that the primer detection of gene 18S and 7SK gene design arrives is very low, illustrates that LDHA can be special Specific enrichment WN, rather than other independent basis because.With GraphPad Prism mapping such as Figure 13.Inventor to LDHA antibody group and IgG group has carried out further repetition, and operation is same as above.QPCR initial data such as table 21.

Table 21:RIP-qPCR tests original ct value

Sample ID	Gene Name	Cq	Cq average
				Reserved sample	WN-primer3	24.37	24.33
Reserved sample	WN-primer3	24.28	24.33
				Reserved sample	WN-primer6	23.41	23.44
Reserved sample	WN-primer6	23.47	23.44
				Reserved sample	18S	7.66	7.66
Reserved sample	18S	7.66	7.66
				Reserved sample	7SK	14.45	14.49
Reserved sample	7SK	14.52	14.49
				IgG antibody group	WN-primer3	31.86	31.47
IgG antibody group	WN-primer3	31.08	31.47
				IgG antibody group	WN-primer6	30.09	30.22
IgG antibody group	WN-primer6	30.35	30.22
				IgG antibody group	18S	17.01	17.02
IgG antibody group	18S	17.02	17.02
				IgG antibody group	7SK	24.07	23.99
IgG antibody group	7SK	23.9	23.99
				LDHA antibody group	WN-primer3	22.88	22.84
LDHA antibody group	WN-primer3	22.8	22.84
				LDHA antibody group	WN-primer6	22.76	22.73
LDHA antibody group	WN-primer6	22.69	22.73
				LDHA antibody group	18S	16.39	16.37
LDHA antibody group	18S	16.35	16.37
				LDHA antibody group	7SK	23.22	23.29
LDHA antibody group	7SK	23.35	23.29

According to formula

Calculated result such as table 22 and table 23:

The bioaccumulation efficiency of table 22:IgG group different genes

The bioaccumulation efficiency of table 23:LDHA antibody group different genes

It can be found by table 22 and table 23, WN is only enriched in LDHA antibody group really, and in IgG group without enrichment, explanation LDHA can interact with WN, and compare crt gene 18S and 7SK, and LDHA specificity and WN interact, and to other Genetic enrichment efficiency is very low.Therefore inventors have demonstrated that LDHA can interact with WN.Made with GraphPad Prism Figure such as Figure 14.

LDHA is the enzyme of glycolysis reaction final step, and catalysis pyruvic acid generates lactic acid, and glycolysis is non-to tumour cell It is often important, even if tumour cell also preferentially carries out energetic supersession using glycolysis and generates ATP, because of the invention under aerobic conditions People wants to verify whether WN has an impact to cell glycolysis.Inventor is struck low to cell glycolysis by seahorse experimental verification WN Influence, which mainly reflects cell glycolysis rate by extracellular acidification rate.Inventor use first PLKO-NC and The virus infection LM2 cell that PLKO-WN5 packaging generates, the cell surely turned, then every group of cell spreads 10 holes, Mei Gekong It spreads 12000 cells to be tested after cell covers with, gives glucose to cell first, after giving glucose, cell It starting with glucose and carries out respiration reaction, the acid that glycolysis at this time generates is discharged to extracellularly, and extracellular acidification rate increases, As cell absorbs more and more glucose, extracellular acidification rate progressivelyes reach saturation, then at 2uM oligomycin Reason, the drug can inhibit mitochondrial metabolism, therefore cell can maximumlly carry out glycolysis at this time, and cell produces acid and further increases By force, it is then again introduced into plateau, finally cell is handled with glucalogue 2-DG, 2-DG structure is similar to grape Sugar, can be by cell traffic to intracellular, but can not be metabolized, at this point, glycolysis is suppressed, the decline of extracellular acidification rate.The reality Test reaction such as Figure 15 of whole process.The data such as table 24 that software statistics come out, to glycolysis portion GraphPad Prism Mapping such as Figure 16.

Raw value in table 24:seahorse experiment

It can be seen from the above result that being infected compared with the cell for having transfected the virus that negative control plasmids PLKO-NC is packed out The cell extracellular acidification rate decline for the virus that PLKO-WN5 plasmid is packed out, i.e. cell glycolysis ability decline.

The repercussion study of example IV WN and LDHA in kinds cancer

WN high expression in kinds of tumors, and it has also been found that WN, which strikes low energy, enough influences lung cell A549 in lung cancer cell line Proliferative capacity, but whether be by similar mechanism do not know.Before the experimental results showed that WN in LM2 cell by with LDHA interacts to function, thus inventor want to verify WN whether in other breast cancer cell lines such as MDA-MB-231 It is functioned in cell and again by with LDHA interaction in lung cancer cell line A549 cell.

Inventor has first verified that MDA-MB-231 cell line, and inventor's LDHA antibody, negative control is IgG, totally two Group, every group with a 15cm ware cell concentration.Firstly, cracking to cell, with two 15cm ware cell concentrations, 300ul is obtained Cell pyrolysis liquid, every group is reserved 100ul with cell pyrolysis liquid 100ul, Input.Then 5ug LDHA antibody and 5ug IgG are resisted Body is respectively coupled on the magnetic bead of proteinA/G coupling, and after completing antibody connection, it is thin that antibody magnetic bead compound is added to 100ul In cellular lysate liquid, four degree of reaction overnights after reaction, are cleaned with cleaning solution, after the completion of cleaning, the Adsorption on magnetic frame Supernatant, obtains magnetic bead and Input sample is separately added into Trizol together and carries out RNA extraction, after obtaining RNA, passes through RT- QPCR detection WN whether be effectively enriched in the amount in sample that finally obtains relative to Input, so that it is determined that WN whether with LDHA There is interaction.Initial data such as table 25.

Table 25: the original ct value of RIP-qPCR in MDA-MB-231 cell

Sample ID	Gene Name	Cq	Cq average
				231 reserved sample groups	WN-primer3	23.45	23.43
231 reserved sample groups	WN-primer3	23.46	23.43
				231 reserved sample groups	WN-primer3	23.37	23.43
231 reserved sample groups	WN-primer6	22.95	23.01
				231 reserved sample groups	WN-primer6	22.99	23.01
231 reserved sample groups	WN-primer6	23.08	23.01
				231 reserved sample groups	18S	7.31	7.35
231 reserved sample groups	18S	7.34	7.35
				231 reserved sample groups	18S	7.4	7.35
231 reserved sample groups	7SK	15.51	15.58
				231 reserved sample groups	7SK	15.6	15.58
231 reserved sample groups	7SK	15.62	15.58
				231IgG antibody group	WN-primer3	29.69	30.11
231IgG antibody group	WN-primer3	30.38	30.11
				231IgG antibody group	WN-primer3	30.27	30.11
231IgG antibody group	WN-primer6	30.34	29.97
				231IgG antibody group	WN-primer6	29.76	29.97
231IgG antibody group	WN-primer6	29.82	29.97
				231IgG antibody group	18S	16.91	16.9
231IgG antibody group	18S	16.88	16.9
				231IgG antibody group	18S	16.91	16.9
231IgG antibody group	7SK	24.64	24.6
				231IgG antibody group	7SK	24.6	24.6
231IgG antibody group	7SK	24.56	24.6
				231LDHA antibody group	WN-primer3	22.71	22.67
231LDHA antibody group	WN-primer3	22.62	22.67
				231LDHA antibody group	WN-primer3	22.67	22.67
231LDHA antibody group	WN-primer6	22.56	22.55
				231LDHA antibody group	WN-primer6	22.53	22.55
231LDHA antibody group	WN-primer6	22.57	22.55
				231LDHA antibody group	18S	15.31	15.25
231LDHA antibody group	18S	15.23	15.25
				231LDHA antibody group	18S	15.22	15.25
231LDHA antibody group	7SK	22.64	22.67
				231LDHA antibody group	7SK	22.62	22.67
231LDHA antibody group	7SK	22.75	22.67

According to formula

Calculated result such as table 26 and table 27:

The bioaccumulation efficiency of table 26:IgG group different genes

	Originate reserved sample	IgG antibody group	Ct (reserved+the log of recycling-2 9.5)	2[- Ct (reserved+log2 9.5 of recycling -)]	Recovery efficiency
						WN-primer3	23.43	30.11	8.342965	0.003079763	0.307976
WN-primer6	23.01	29.97	8.622965	0.002536465	0.253647
						18S	7.35	16.9	11.212965	0.000421271	0.042127
7SK	15.58	24.6	10.682965	0.000608285	0.060828

The bioaccumulation efficiency of table 27:LDHA antibody group different genes

As seen from the above table, compared with IgG, exist for the primer WN-3 and WN-6 of WN design the WN recovery efficiency detected LDHA antibody addition group is apparently higher than IgG group, illustrates that LDHA can interact with WN, for crt gene 18S and 7SK gene The recovery efficiency for the 18S and 7SK gene that the primer detection of design arrives is very low, illustrate LDHA can specific enrichment WN, without Other independent basis because.With GraphPad Prism mapping such as Figure 17.Same method invention people tests A549 cell Card.Initial data such as table 28.

Table 28: the original ct value of RIP-qPCR in A549 cell

According to formula

Calculated result such as table 29 and table 30:

Table 29: in A549 cell, the bioaccumulation efficiency of IgG group different genes

Table 30: in A549 cell, the bioaccumulation efficiency of LDHA antibody group different genes

As seen from the above table, compared with IgG, exist for the primer WN-3 and WN-6 of WN design the WN recovery efficiency detected LDHA antibody addition group is apparently higher than IgG group, illustrates that LDHA can interact with WN, for crt gene 18S and 7SK gene The recovery efficiency for the 18S and 7SK gene that the primer detection of design arrives is very low, illustrate LDHA can specific enrichment WN, without Other independent basis because.In lung adenocarcinoma cell line A549, LDHA and WN have interaction.Such as with GraphPad Prism mapping Figure 18.

Expression and prognostic study of five WN of embodiment in tumor tissues

WN high expression, low expression in normal sample in tumor sample.By to Gene Expression Omnibus (GEO) two breast cancer sample data sets (GSE3744, GSE20685) in database are analyzed, and inventor has found that WN exists Expression quantity in breast cancer sample is higher than in normal sample, as a result has statistical significance.Meanwhile in the higher cream of grade malignancy The expression quantity of WN is higher in gland cancer sample, as a result such as Figure 19 and 20.Following inventor has checked the expression quantity and neoplastic disease of WN The patient of the relationship of people's prognosis, height expression WN has worse prognosis.The Cancer Genome Atlas of the inventor from the U.S. (TCGA) about 1100 breast cancer transcript profile data have been downloaded in database, after filtering out the sample for not expressing WN, inventor is protected About 400 samples have been stayed to carry out subsequent analysis, inventor has found that WN expression quantity in normal sample is very low, only in tumor sample Detect high expression, the sample of these height expression WN has worse prognosis than the sample of low expression WN, as a result sees 21a, 21b.Hair Bright people has checked the data set (GSE16446) of another GEO database simultaneously, same conclusion has also been obtained, such as Figure 21 c.

Inventor has also checked expression quantity situation of the WN in different tumor tissues, Figure 22 be according to 2015 one Nature genetics article (Iyer M K, Niknafs Y S, Malik R, et al.Nature genetics, 2015, 47 (3): 199-208.) data made by figure, abscissa is different sample, and ordinate is the expression quantity of WN.Pass through comparison The expression quantity of WN in tumor sample and corresponding normal sample in figure, inventor have found WN not only in breast cancer sample It is expressed relative to normal sample height, such as kidney, lung cancer, bladder cancer, head and neck cancer and thyroid cancer in kinds of tumors tissue Versus normal tissues expression quantity is also high, and instruction WN may work in the generation of kinds of tumors, development process.

It should be understood that the present invention disclosed is not limited only to specific method, scheme and the substance of description, because these It is alterable.It will also be understood that purpose of the terminology used here just for the sake of the specific embodiment scheme of description, rather than It is intended to limit the scope of the invention, the scope of the present invention is limited solely by the attached claims.

Those skilled in the art, which will also be appreciated that or be able to confirm that, uses no more than routine experiment, institute herein The many equivalents for the specific embodiment of the invention stated.These equivalents are also contained in the attached claims.

Sequence table

<110>Tsinghua University

<120>kit of cancer screening, treatment and prognosis is carried out using non-coding RNA

<130> BR3525

<150> 201711025485.X

<151> 2017-10-27

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 962

<212> DNA

<213>homo sapiens (Homo sapiens)

<400> 1

agaagctctt gggagcatgt ggacagttgt ggctgctcct gagctgacac taactgctca 60

tgactcctct gtgggagaag taggtggttt cctagaggaa gaagtttggg taatgaagcc 120

acagagattt gctgatacat ttgctaggca cgacttctgg tcatttagaa agctattttg 180

tggcttcatc aataaggtat tccccagctg tgttactcct tcgcattgtt atctctttcc 240

ctggaattga aggcttcctg gtctgaggca aggacaatta ttccctcact gtcaaccctg 300

atctctggct gcagtaatga gtagaggaaa tgaagaaata agaatggaag cataatcatt 360

tgtccgaggt cacagaggga gatgattaca cagctggaat gtaagcctca gtactttact 420

gaatccttgg ctttgtccat gggcccagct acaggcataa agcttttctc ttccccagca 480

gtgacttcga gtaccagctt tcaaatttat ttgacattga atctaagctt tgtgaccagt 540

atgtagaagg agaagaaggg gaggaattac ttatcctttg gcatacatta gcatgcaaat 600

aaatcctttc tctgcattgt ggaagggtct gaaattatca catatacaat gtatctttta 660

tcaatggcct tgcatacaaa ttttactttg aagaatccag atttagaggt cttctccaaa 720

catttgcatt gtttcttttt cttaggatca gaacttctac ctattgtcat tttaagaaaa 780

aagatcatga attaattaat ttattcatta tttacaccct tatattcttt cccaaatgtt 840

ttaatgtggc ttacattgta tacatgtaca caataaatat ttatatttaa ataagttata 900

atcacagaat gagaatatta ttacaaccac tcatactcat tcaaatagct tgattatatc 960

at 962

<210> 2

<211> 329

<212> DNA

<213>homo sapiens (Homo sapiens)

<400> 2

agaagctctt gggagcatgt ggacagttgt ggctgctcct gagctgacac taactgctca 60

tgactcctct gtgggagaag taggtggttt cctagaggaa gaagtttggg taatgaagcc 120

acagagattt gctgatacat ttgctaggca cgacttctgg tcatttagaa agctattttg 180

tggcttcatc aataaggtat tccccagctg tgttactcct tcgcattgtt atctctttcc 240

ctggaattga aggcttcctg gtctgaggca aggacaatta ttccctcact gtcaaccctg 300

atctctggct gcagtaatga gtagaggaa 329

<210> 3

<211> 633

<212> DNA

<213>homo sapiens (Homo sapiens)

<400> 3

atgaagaaat aagaatggaa gcataatcat ttgtccgagg tcacagaggg agatgattac 60

acagctggaa tgtaagcctc agtactttac tgaatccttg gctttgtcca tgggcccagc 120

tacaggcata aagcttttct cttccccagc agtgacttcg agtaccagct ttcaaattta 180

tttgacattg aatctaagct ttgtgaccag tatgtagaag gagaagaagg ggaggaatta 240

cttatccttt ggcatacatt agcatgcaaa taaatccttt ctctgcattg tggaagggtc 300

tgaaattatc acatatacaa tgtatctttt atcaatggcc ttgcatacaa attttacttt 360

gaagaatcca gatttagagg tcttctccaa acatttgcat tgtttctttt tcttaggatc 420

agaacttcta cctattgtca ttttaagaaa aaagatcatg aattaattaa tttattcatt 480

atttacaccc ttatattctt tcccaaatgt tttaatgtgg cttacattgt atacatgtac 540

acaataaata tttatattta aataagttat aatcacagaa tgagaatatt attacaacca 600

ctcatactca ttcaaatagc ttgattatat cat 633

<210> 4

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

ccgggcacga cttctggtca tttagctcga gctaaatgac cagaagtcgt gctttttg 58

<210> 5

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ccggcgagta ccagctttca aatttctcga gaaatttgaa agctggtact cgtttttg 58

<210> 6

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ccggcaacaa gatgaagagc accaactcga gttggtgctc ttcatcttgt tgtttttg 58

<210> 7

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aattcaaaaa caacaagatg aagagcacca actcgagttg gtgctcttca tcttgttg 58

<210> 8

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

ccgggcacga cttctggtca tttagctcga gctaaatgac cagaagtcgt gctttttg 58

<210> 9

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

aattcaaaaa gcacgacttc tggtcattta gctcgagcta aatgaccaga agtcgtgc 58

<210> 10

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

ccggcgagta ccagctttca aatttctcga gaaatttgaa agctggtact cgtttttg 58

<210> 11

<211> 58

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

aattcaaaaa cgagtaccag ctttcaaatt tctcgagaaa tttgaaagct ggtactcg 58

<210> 12

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

cagctgtgtt actccttcgc 20

<210> 13

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ctgctgggga agagaaaagc 20

<210> 14

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

atctggcacc acaccttcta c 21

<210> 15

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

cagccaggtc cagacgcagg 20

<210> 16

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

agtcatgagc agttagtgtc 20

<210> 17

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

cattactgca gccagagatc 20

<210> 18

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

gaagtcgtgc ctagcaaatg 20

<210> 19

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

agaccaggaa gccttcaatt 20

<210> 20

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

aagctggtac tcgaagtcac 20

<210> 21

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

tgcatgctaa tgtatgccaa 20

<210> 22

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

gtatgcaagg ccattgataa 20

<210> 23

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

gaatgagtat gagtggttgt 20

<210> 24

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

ctttatgcct gtagctggg 19

<210> 25

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

tggagaagac ctctaaatct 20

<210> 26

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

tggtctgagg caaggacaat 20

<210> 27

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

tactcgaagt cactgctggg 20

<210> 28

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 28

cccagcagtg acttcgagta 20

<210> 29

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 29

acccttccac aatgcagaga 20

<210> 30

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 30

cgaggtcaca gagggagatg 20

<210> 31

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 31

tactcgaagt cactgctggg 20

<210> 32

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 32

gacatctgtc accccattga 20

<210> 33

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 33

gcctcatttg gatgtgtctg 20

<210> 34

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 34

attaagaaag cgttcaag 18

<210> 35

<211> 17

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 35

tatgcggagg agaatgt 17

<210> 36

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 36

gtaacccgtt gaaccccatt 20

<210> 37

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 37

ccatccaatc ggtagtagcg 20

Claims (10)

1. one kind is for detecting kit existing for cancer in subject, it is characterised in that include that detection is tested in the kit The reagent of the non-coding RNA expression of person, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973.

2. kit according to claim 1, feature is in the examination of the non-coding RNA expression of the detection subject Agent is the reagent for detecting the transcript of the non-coding RNA, the transcript of the non-coding RNA by SEQ ID NO:2 with SEQ ID NO:3, which is connected, to be formed.

3. kit according to claim 1, it is characterised in that the non-coding RNA is before testing or period is converted to cDNA。

4. kit according to claim 1, it is characterised in that the non-coding RNA expression of the detection subject Reagent is to utilize the reagent carried out selected from sequencing technologies, nucleic acid hybridization technique, nucleic acid amplification technologies and the method for immunoassays.

5. kit according to claim 4, it is characterised in that the nucleic acid amplification technologies are polymerase chain reactions.

6. kit according to claim 1, it is characterised in that the cancer be leukaemia, osteocarcinoma, lymph cancer, intestinal cancer, Liver cancer, gastric cancer, cancer of the esophagus, uterine cancer, cervical carcinoma, lung cancer, the cancer of the brain, neural cancer, breast cancer, cancer of the esophagus, cancer of pancreas, lymph cancer, Nasopharyngeal carcinoma, laryngocarcinoma, kidney, gallbladder cancer, kidney, bladder cancer, cervical carcinoma, uterine cancer, oophoroma, prostate cancer, fatty cancer, squama Any one of cancer, thyroid cancer, lip cancer, melanoma, tongue cancer or cutaneum carcinoma.

7. a kind of composition for the treatment of cancer, it is characterised in that include for inhibiting non-coding in cancer patient in the composition The therapeutic agent of RNA function, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973.

8. a kind of kit for cancer patient's prognosis, it is characterised in that include for detecting cancer patient in the kit The reagent of middle non-coding RNA content, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973.

9. the reagent of the expression for detecting non-coding RNA is in preparation for kit existing for cancer in screening subject In purposes, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973, the screening is by including such as The method of lower step:

(a) biological sample from subject is contacted with the reagent for the expression for being used to detect the non-coding RNA；And

(b) expression of non-coding RNA described in the sample is detected using external test,

Wherein the expression of non-coding RNA described in the sample is increased relative to the level in normal human cell, is indicated There are cancers in the subject.

10. use of the reagent of the expression for detecting non-coding RNA in the kit that preparation is used for cancer patient's prognosis On the way, wherein the non-coding RNA is the non-coding RNA of HGNC number LINC00973, the prognosis is by including the following steps Method:

(a) biological sample from subject is contacted with the reagent for the expression for being used to detect the non-coding RNA；And

(b) expression of non-coding RNA described in the sample is detected using external test,

Wherein the expression of non-coding RNA described in the sample is increased relative to the level in normal human cell, is indicated Cancer patient's prognosis is bad.