CN109706182A - A method of the high expression CTLA4Ig in mesenchymal stem cell - Google Patents
A method of the high expression CTLA4Ig in mesenchymal stem cell Download PDFInfo
- Publication number
- CN109706182A CN109706182A CN201910169108.6A CN201910169108A CN109706182A CN 109706182 A CN109706182 A CN 109706182A CN 201910169108 A CN201910169108 A CN 201910169108A CN 109706182 A CN109706182 A CN 109706182A
- Authority
- CN
- China
- Prior art keywords
- ctla4ig
- gene
- stem cell
- mesenchymal stem
- ctla4
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention provides the relationships that CTLA4Ig imported into gene expression amount under the conditions of rear different promoters in mesenchymal stem cell, by research shows that, the CTLA4Ig expression quantity highest expressed using MSCp promoter, mesenchymal stem cell is imported into for clinically CTLA4Ig, theoretical foundation and experimental data are provided to the treatment of immunological rejection, have broad application prospects.
Description
Technical field
The invention belongs to biomedicine fields, more particularly to one kind high expression CTLA4Ig in mesenchymal stem cell
Method.
Background technique
MSC is derived from the mesoblastic a kind of heterogeneous multipotential stem cell of mesoderm growing early stage, be distributed widely in marrow, fat,
The Various Tissues such as umbilical cord.According to the standard of perfection of international cell therapy association (ISCT), people MSC at least has 3 essential characteristics:
(1) there is frosting adhesion under Standard culture conditions；(2) express specific cells surface marker CD105, CD73,
CD90, while CD45, CD34, CD14 (or CD11b), CD79 α (or CD19) and human leukocyte antigen (HLA)-DR are not expressed,
The surface marker of different plant species MSC expression slightly has difference compared with people；It (3) can Induction of committed differentiation be in vitro that skeletonization is thin
Born of the same parents, fat cell and cartilage cell.In addition, MSC under given conditions can it is interdepartmental, even across differentiation of germinal layers be other types
Histocyte.
Recent study discovery, MSC have unique immunological characteristic, are expected to play a significant role in organ transplant.
Firstly, MSC itself has extremely low immunogenicity and lower HLA-II antigen.MSC itself expresses low-level main group
Histocompatibility complex (MHC) class Ⅰmolecule is knitted, hardly expression MHC class Ⅱmolecule and FasL (Fasligand, FasL), with
And costimulatory molecules CD80, CD86, CD40 and CD40L etc., usually body will not be stimulated to generate strong immune response.Due to lacking
Weary costimulatory molecules keep the HLA-II antigen of itself relatively low, it is not easy to cause serious immunological rejection.But,
MSC is not the lethal effect for being fully able to escape immune system, there is that researches show that the MSC through being injected intraperitoneally to be transplanted to immune deficiency
It after in Mice Body, can have more than 120d, can still exist about in the homogenic type Mice Body that immune system perfects
40d is but only capable of the presence of about 20d in allogeneic mice body.The people MSC that the discovery such as Schmuck is injected through jugular vein is moved
Internal Different Organs can be distributed in after planting in SD rat body rapidly, but after transplanting 8d, only 0.06% can be detected.So
And MSC is being premise that it plays a role by intracorporal survival, would generally repeatedly be transfused MSC to maintain it in the application at present
The time to play a role in vivo.Secondly, MSC has immunoregulation capability, recipient immune rejection can be reduced.MSC energy
Enough relying on the various immune factors of paracrine includes the immune tune of the performances such as T cell, B cell, Dendritic Cells to various immunocytes
Section effect, effectively inhibits immunological rejection caused by these immunocytes.Bartholomew etc. is proved in vitro experiment
MSC is able to suppress the lymphopoiesis in mixed lymphocyte reaction (MLP).The discoveries application such as Wu MSC is able to extend allogeneic shifting
The rat heart of plant is finding that MSC can effectively reduce inflammatory cell by the intracorporal time-to-live, and by pathological analysis
Infiltration in donor tissue.Moreover, the immunoregulation effect of MSC can even cross over species, not limited by MHC, donor,
Receptor and the MSC in third party source can inhibit immune response caused by heterogenetic antigen.It is not one that MSC, which plays immune suppression function,
At constant, and it is to rely on the inflammatory microenvironment locating for it.The immunoloregulation function of MSC needs inflammatory mediator in inflammatory microenvironment
" assign power ", and show under low inflammatory conditions " proinflammatory " or under high inflammatory conditions " anti-inflammatory " immunoregulation effect.
Immunological rejection caused by organ transplant is strong, is usually at high inflammatory conditions, using the immunoregulation effect of MSC come
It is the selection of a great application prospect that protection graft survives for organ transplant in receptor.
Finally, MSC has migration and chemotaxis, it can be enrolled into inflammation or site of tissue damage, participate in resisting rush
The release and tissue repair of inflammatory factor.Stroma cell derivative factor (the stromalcell-derived of MSC expression
Factor-1 alpha, SDF-1 α) it with the interaction of Chemokine receptor CXCR4 is considered as that MSC is promoted to migrate to transplanting
The key factor of damage location, and the inflammatory factor interleukins (IL) -3 of T cell secretion is also proved to be able to promote SDF-1
Migration of the α-CXCR4 signal path to MSC.Teo etc. observe the MSC of intravenous injection can be passed through after 2h vascular wall into
Enter inflammation part, it was demonstrated that MSC has very strong chemotactic and transfer ability.In organ transplant, this characteristic of MSC facilitates it
It navigates to transplanting and causes damage location, play targeted therapy effect.
Organ transplant is effective treatment method of terminal phase organ failure, or even is rely as many critical patients
The unique channel of existence.However, immunosuppressor need to be used for a long time to resist immunological rejection in the receptor for receiving transfer operation,
Immune tolerance is maintained, donor organ is prevented to be ostracised.On the one hand, immunosuppressor can alleviate Acute immune rejection reaction, but
May not can avoid Chronic immune rejection and its caused by transplant organ function lose；On the other hand, it is used for a long time immune
Inhibitor is mostly with serious adverse reaction, such as increases diabetes and risk of cardiovascular diseases, is also easy to cause repeated infection
Even malignant tumour.Therefore, researcher at this stage needs to explore the new method for reducing organ transplant immunological rejection, finds clinical
Upper feasible inducing transplantation organ tolerance and the new way for maintaining its long-term surviving.
In recent years, associational cells transplanting is increasingly becoming new research to mitigate the immunological rejection during organ transplant
Hot spot, Dendritic Cells, candidate stem cell, mescenchymal stem cell (mesenchymal stem cell, MSC) etc. successively by with
In inducing immune tolerance research and achieve good result.Wherein, MSC is more and more paid attention to and achieves many
Infusive effect is expected to become and resists immunological rejection, inducing immune tolerance, maintains the ideal of transplant organ function thin for a long time
Born of the same parents.
The immunological rejection of the postoperative complexity of organ transplant is to influence transplant organ long-term surviving and function huge
Obstacle, and the adverse reaction of nonspecific immunosuppressor can seriously affect the prognosis and quality of life of organ graft recipient.
Immunological characteristic based on MSC, more and more researchers are dedicated to reducing organ graft recipient using its immunoregulation effect
Immunological rejection and then induction permanent immunity tolerance to graft, while being recruited more using the inflammation damnification of transplantation site
MSC participates in tissue targeting and repairs that transplant organ is protected to function for a long time.In fact, MSC is used in existing clinical research trial
To replace certain immunosuppressor to carry out the function of digital preservation transplant organ.The receptor that Pan etc. receives kidney transplant to 32 carries out
Up to follow-up in 2 years, discovery MSC can partially substitute the immunosuppressor with renal toxicity, and then maintain transplanting kidney pair
The resistivity that recipient immune repels.In recent years, application study of the MSC in organ transplant has achieved progress abundant.
The problem of donor organ shortage seriously constrains the development of organ transfer operation, only just has 300,000 people every year in China
Organ transplant is needed, but can finally obtain the patient that donor receives to transplant and be less than 10,000.Therefore, many people place hope on use
Xenogeneic organ solves the insufficient matter of great urgency of donor organ, however, body more reinforces the immunological rejection of Xenogeneic organ
It is strong.Donor of the pig as xenotransplant, its organ can effectively reduce Hyperacute immunological rejection after genetic modification
And it survives in receptor body for a long time.Nevertheless, the immunological rejection of other forms still remains and can damage xenogenesis shifting
The transplant organ of plant.The immunological rejection in Islets Xenotransplantation can be effectively relieved in recent existing research discovery joint MSC co-transplantation
Reaction.Research and utilization MSC's induces the immune tolerance of xenotransplantation organ, and the clinic for helping speed up xenotransplant answers
With to alleviate the problem of organ shortage.
But still there can be certain immune rejection problems when using stem cell transplantation.It in the prior art, is understanding
The certainly problem, CN105802907A provide it is a kind of raising the elderly's Bone Marrow Mesenchymal Stem Cells Transplantation after survival ability pre- place
Reason method, this method are to be placed in the stable mescenchymal stem cell of the passage acquired by the elderly's marrow to joined 0.5 μm of ol/
It in the conventional medium of the glutamine of the NAD+ and 20mM of SRT1720,5mM of L, pre-processes 24 hours, treated for acquisition
Mesenchymal stem cell is used for cellular transplantation therapy.The beneficial effects of the present invention are embodied in: SRT1720 pretreatment can pass through suppression
It makes the old exogenous apoptosis pathway of human marrow mesenchymal stem cell and inhibits its apoptosis under stressed condition, it is pre- through SRT1720
Survival rate after the mesenchymal stem cell transplantation of processing in ischemic myocardium increases, and the effect for treating ischemic cardiomyopathy obviously changes
It is kind.
CN102764272A provides the mesenchymal stem cell through PD-Ll gene modification and is inhibiting graft rejection anti-
It answers, induce application in peripheral immune tolerance.The mesenchymal stem cells not only maintain the immunoregulation effect of BMSCs itself, together
When increase PD-Ll again to the inhibiting effect of τ cell activation, impart the stronger immunoregulation effect of the cell, can
In conjunction with the T cell after transplanting, thus mitigation or the generation of Delayed grafting rejection.
In addition, immune modulatory molecules CTLA4Ig has the function of inducing transplantation immune tolerance, by the transfection energy of adenovirus
Power, it is possible to make CTLA4Ig high efficient expression in organ graft, realize organ specificity immune tolerance.But current
When being expressed in stem cell, however it remains the low defect of expression efficiency, and then affect immune tolerance effect.Therefore, it is necessary to right
It is improved.
Summary of the invention
The present invention provides the method for high expression CTLA4Ig a kind of.
Further, the present invention provides a kind of method for preparing pIg-CTLA4 (or CTLA4Ig) gene,
The primer sequence of fully synthetic first P1, P2 and P3.
P1:5'-GGGGATATCCACCATGGGTGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCAC
TC-3'
P2:5'-CTCAGTCTGGTCCTTGCACTCCTGTTTCCAGCATGGCGAGCATGGCAATGCACGTGGCCCAG
CC-3'
P3:5'-GCGGATCCACTTACCTGTAGAATCTGGGCACGG-3'
With P2 and P3 primer, using mouse DNA as template, after the amplification of half sleeve type PCR, then with P1 and P3 primer, through primer weight
Folded PCR obtains the fusion of oncostatinM signal peptide and CTLA4 extracellular fragment to CTLA4 gene modification.PCR product is through limiting
Property restriction endonuclease EcoRV and BamH I digestion, electrophoresis recycling, be connected to the expression vector pIg through identical digestion.It is identified through digestion
Afterwards, it is named as pIg-CTLA4.
Further, the present invention provides a kind of mesenchymal stem cell for turning CTLA4Ig gene.
The present invention provides a kind of expression vector, particularly connect CTLA4Ig gene with pCDH slow virus skeleton carrier
It is built-up afterwards.
Further, the present invention provides promoter-MSCp promoter highly expressed in mesenchymal stem cell,
Its sequence is as shown in SEQ ID NO:1.Promoter in pCFH is replaced with into MSCp promoter.
Further, the present invention is provided in a kind of method for identifying the stem cell, including identification transgenosis stem cell
The expression quantity of mRNA and target protein.
Beneficial effect
The present invention has studied gene expression under the conditions of different promoters after CTLA4Ig is imported into mesenchymal stem cell
The relationship of amount, by studies have shown that the CTLA4Ig expression quantity highest expressed using MSCp promoter, is led for clinically CTLA4Ig
Enter to mesenchymal stem cell and theoretical foundation and experimental data are provided to the treatment of immunological rejection.
Detailed description of the invention
Fig. 1 is carrier structure figure.
Fig. 2 is protein expression spirogram, and swimming lane 1 is the CTLA-4Ig protein expression knot of pCDH-MSCp-pIg-CTLA4-MSCs
Fruit, swimming lane 2 and 4 are the CTLA-4Ig albumen table of pCDH-SV40-pIg-CTLA4-MSCs, pCDH-pIg-CTLA4-MSCs respectively
Up to as a result, swimming lane 3 is the expressing quantity of blank control.
Fig. 3 is mRNA relative expression spirogram, and 1 is blank control, and 2 be pCDH-MSCp-pIg-CTLA4-MSCs, and 3 are
PCDH-SV40-pIg-CTLA4-MSCs, 4 be pCDH-pIg-CTLA4-MSCs, and black stripe is CTLA-4Ig gene with respect to table
Up to amount, gray bars are the expression quantity of β-Actin.
Specific embodiment
Below with reference to embodiment, the invention will be further described:
It is prepared by the separation of 1 mesenchymal stem cell of embodiment
Mesenchymal stem cell (MSC) separation and culture
It draws neck to put to death the deferred shares of stock bone Wistar rat to separate with shin bone, bone marrow cell suspension, and and equivalent is made
It is centrifuged after DMEM mixing, adds the centrifugation of Percoll separating liquid, extract karyocyte layer, the fetal calf serum containing 100mL/L is added
DMEM is inoculated in culture bottle, is placed in 37 DEG C, volume fraction 5%CO2Constant incubator in cultivate.It is replaced after inoculation 48h
Culture solution replaces a culture solution every 3d later.It is digested close to after 80% fusion, then with 0.25% pancreatin wait cultivate cell,
Secondary culture is spare to the 5th generation cell.
The building of 2 expression vector of embodiment
The primer sequence of fully synthetic first P1, P2 and P3.
P1:5'-GGGGATATCCACCATGGGTGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCAC
TC-3'
P2:5'-CTCAGTCTGGTCCTTGCACTCCTGTTTCCAGCATGGCGAGCATGGCAATGCACGTGGCCCAG
CC-3'
P3:5'-GCGGATCCACTTACCTGTAGAATCTGGGCACGG-3'
With P2 and P3 primer, using mouse DNA as template, after the amplification of half sleeve type PCR, then with P1 and P3 primer, through primer weight
Folded PCR obtains the fusion of oncostatinM signal peptide and CTLA4 extracellular fragment to CTLA4 gene modification.PCR product is through limiting
Property restriction endonuclease EcoRV and BamH I digestion, electrophoresis recycling, be connected to the expression vector pIg through identical digestion.The carrier contains can
The human IgG1 Fc of fusion, and the gene for wanting desire to express donor containing shearing, its own band shearing receptor.After digestion is identified, life
Entitled pIg-CTLA4.Finally, sequencing shows that gene is correct.Then drawn with double containing EcoRI and BamH I restriction enzyme site
Object expands pIg-CTLA4 gene, with EcoRI and BamH I double digestion.The target fragment and pCDH slow virus skeleton of recycling carry
Body connection is overnight.PCDH slow virus skeleton carrier of the present invention is that (purchase is public from SBI by pCDH-EF1 α-CymR-T2A-RFP
Department, article No. QM300PA-1), hereinafter referred to as pCDH slow virus skeleton carrier, structure chart are as shown in Figure 1.
In addition, applicant is prepared for MSCp promoter early period oneself, can have in mesenchymal stem cell compared with
Good starting expression effect.Here, using the experimental method of this field routine, by the promoter in pCDH slow virus skeleton carrier
MSCp promoter is replaced with, pCDH-MSCp carrier is prepared, in addition, with by the promoter in pCDH slow virus skeleton carrier
SV40 promoter is replaced with, pCDH-SV40 carrier is prepared.By pIg-CTLA4 and pCDH-MSCp carrier and pCDH-SV40
Equally connection is stayed overnight after carrier distinguishes double digestion.Next day connection product is transferred to competence DH5a, extracts plasmid in a small amount, is respectively adopted
PIg-CTLA4 gene PCR and MSCp promoter and SV40 promoter sequence carry out PCR identification, all expand respectively by identification
The product of more than 1100 bp and 400bp and SV40 promoter corresponding length have been obtained, has illustrated to construct successfully.
The preparation of 3 transgenic bone marrow mescenchymal stem cell of embodiment
One, the packaging of slow virus
First 1 day of transfection, by 293T 105A cell inoculation is in 15cm2In culture dish, 37 DEG C of 5%CO2It is incubated overnight.It takes
(the pCDH-MSCp-pIg-CTLA4 containing shuttle plasmid and packaging plasmid of 100 μ l is added in 1.5ml Opti-MEM culture medium
Carrier or pCDH-pIg-CTLA4 carrier or pCDH-SV40-pIg-CTLA4 carrier: PPA2X2: EMG=5: 3: 2) slow virus；Separately
1.5ml Opti-MEM is taken, 300 μ l Lip2000 are added；Above two liquid is mixed well, is stored at room temperature 25 minutes.Then
The cell in culture dish is transfected, transfection liquid is removed after 8 hours, fresh medium is added.72 hours collection supernatants, utilize Biomiga
Company's EZgeneTM kit is saved according to normal process concentrating virus, -80 DEG C of refrigerators.By 293T cell with 1 × 104Concentration connects
Kind is in 24 orifice plates, 37 DEG C of 5%CO2The 100 μ l (10 of virus liquid of various concentration gradient is added in each hole after culture 24 hours-1、10-2、
10-3、10-5) with pCDH-GFP virus infection 293T cell dye cell as a control group.It is seen after 72 hours by fluorescence microscope
It examines, calculates fluorecyte number, and (disease is added in GFP positive cell rate × transfection cell number/100 × every hole according to formula TU/ μ l=
Malicious dilution volume) × 1/ dilution gfactor calculates virus liquid titre.After 3 kinds of plasmids of slow virus transfect 293T cell jointly, 72
Observation cell fluorescence expression after hour.The plasmid of building can successfully infect 293T cell.Concentration is calculated according to calculation formula
PCDH-MSCp-pIg-CTLA4 carrier slow virus virus liquid titre is 7.2 × 10 afterwards8TU/ml, pCDH-SV40-pIg-CTLA4
Carrier slow virus virus liquid titre is 6.9 × 108TU/ml, pCDH-pIg-CTLA4 carrier slow virus virus liquid titre be 6.5 ×
108The titre of TU/ml, empty plasmid pCDH-GFP are 4.2 × 108TU/ml is able to satisfy exogenous gene expression and wants to virus titer
It asks.
Two, slow-virus infection MSCs
First 1 day of infection, by the MSCs in exponential phase of growth with 5 × 104It is inoculated in 12 orifice plates, by cell to be transfected point
Group: A-C group: target gene plasmid transfection group；D group: empty plasmid transfection group.Next day, by virus with 180 times of infection multiplicity (MOI
=180) infection cell, and be added 5 μ g/ml of final concentration Polybrene increase transfection efficiency (D group in kind transfect sky matter
Grain pCDH-GFP).24 hours replacement culture mediums, observation in 72 hours transfect cell fluorescence expression.Pass through puromycin (2 μ g/
Ml) screening obtains carrying out gene expression detection after stablizing expansion culture.It is detected by PCR, has as a result obtained stable expression purpose
The transgenosis MSCs cell of gene, is respectively designated as pCDH-MSCp-pIg-CTLA4-MSCs, pCDH-SV40-pIg-CTLA4-
MSCs, pCDH-pIg-CTLA4-MSCs and pCDH-GFP-MSCs.
Expressing quantity is analyzed in 4 stem cell of embodiment
CTLA-4Ig Protein Detection is through Protein A affinity chromatography column purification in 4 kinds of cell conditioned mediums of CTLA-4Ig transfection,
The obtained protein sample of cell conditioned medium is detected with Western blot, on the basis of same cell amount, CTLA-4Ig protein expression knot
Fruit is as shown in Fig. 2, swimming lane 1 is the CTLA-4Ig protein expression of pCDH-MSCp-pIg-CTLA4-MSCs as a result, swimming lane 2 and 4 point
It is not the CTLA-4Ig protein expression of pCDH-SV40-pIg-CTLA4-MSCs, pCDH-pIg-CTLA4-MSCs as a result, swimming lane 3
For the expressing quantity of blank control.From the results, it was seen that the pCDH-MSCp-pIg- that CTLA-4Ig is transfected in supernatant
CTLA4-MSCs, pCDH-SV40-pIg-CTLA4-MSCs, pCDH-pIg-CTLA4-MSCs respectively have a molecular weight about 50KD attached
The close protein immunoblot band that can be specifically bound with anti-human CTLA-4Ig monoclonal antibody, and control cell supernatant corresponding position without
Specific band.And as can be seen that the expression quantity of pCDH-MSCp-pIg-CTLA4-MSCs is much high from expressing quantity
In the expression quantity of both promoters of pCDH-SV40-pIg-CTLA4-MSCs, pCDH-pIg-CTLA4-MSCs, this is absolutely proved
The special sexual compatibility of MSCp promoter expresses foreign protein in mesenchymal stem cell.
CTLA4Ig mrna expression amount detects in 5 transgenosis stem cell of embodiment
RT-PCR detection gene expression is each 3* of BMMSCs transgenosis stem cell for taking recombined adhenovirus to infect respectively 4 days
105, extract cell total rna respectively using TRIzol reagent and referring to kit specification, and as template reverse transcription its
In mRNA be cDNA. separately design and synthesize following primer, using cDNA be template progress PCR amplification, amplified production is through 1.2%
Agarose gel electrophoresis, detection transgenosis stem cell are not inducing and the expression conditions of different induction time CTLA4Ig, and
Result is analyzed with AlphaImager3300 software.
CTLA4Ig:F:5’-TCAAGATCTATGGGGGTACTGCTCACACA-3’
R:5’-ACTCTCGAGCTATTTACCAGGAGAGCGGGA-3’
β-Actin:F:5’-AGAAAATCTGGCACCACACC-3’
F:5’-AGGAAGGAAGGCTGGAAGAG-3’
Using the expression quantity of the β-Actin of blank group as control, the relative expression quantity of each transgenosis group is calculated, as a result as schemed
Shown in 3,2 it is pCDH-MSCp-pIg-CTLA4-MSCs, 3 is pCDH-SV40-pIg-CTLA4-MSCs, 4 pCDH-pIg-
CTLA4-MSCs, black stripe are CTLA-4Ig gene relative expression quantity, and gray bars are the expression quantity of β-Actin.From result
As can be seen that the CTLA4pIgmRNA expression quantity highest in pCDH-MSCp-pIg-CTLA4-MSCs, can achieve β-Actin's
1.8 times, and the CTLA4pIg mrna expression amount in pCDH-SV40-pIg-CTLA4-MSCs and pCDH-pIg-CTLA4-MSCs
Only 1.3 and 1.4 times of β-Actin, expression quantity is well below pCDH-MSCp-pIg-CTLA4-MSCs.This adequately illustrates,
In pCDH-MSCp-pIg-CTLA4-MSCs, the available high expression of CTLA4pIg.
In addition, it should be understood that although this specification is described in terms of embodiments, but not each embodiment is only wrapped
Containing an independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should
It considers the specification as a whole, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art
The other embodiments being understood that.
Sequence table
<110>Yichuan Lian Ze biotechnology Development Co., Ltd
<120>a kind of method of expression ctLa4Ig high in mesenchymal stem cell
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 400
<212> DNA
<213> Homo sapiens
<400> 1
tttatttctt tatcctagac cattagtttt gcagtactca tgagcctctt tcaactccct 60
cgagagtgtc atggcatcct ctaaaggtaa cttgtggggc atgcaaatct ctctgccttg 120
acatctttca cccctacagg tagggtttga tgctgtacct ttgcactact tggtggcata 180
tctttctcct caccaccacc ctcccacccc cggcacccca ctgctggctt caactccaaa 240
acttagagca tggttgggtg tccatcacct tctctttttg caggaactat aaaatacata 300
gataagtgta taatctgtac aactaatgcc catttcatca ctggcattta caaaaatgaa 360
gaaatgaaaa tgctgtaaat aaaattaaaa tctctttgac 400
<210> 2
<211> 64
<212> DNA
<213> Homo sapiens
<400> 2
ggggatatcc accatgggtg tactgctcac acagaggacg ctgctcagtc tggtccttgc 60
actc 64
<210> 3
<211> 64
<212> DNA
<213> Homo sapiens
<400> 3
ctcagtctgg tccttgcact cctgtttcca gcatggcgag catggcaatg cacgtggccc 60
agcc 64
<210> 4
<211> 33
<212> DNA
<213> Homo sapiens
<400> 4
gcggatccac ttacctgtag aatctgggca cgg 33
<210> 5
<211> 29
<212> DNA
<213> Homo sapiens
<400> 5
tcaagatcta tgggggtact gctcacaca 29
<210> 6
<211> 30
<212> DNA
<213> Homo sapiens
<400> 6
actctcgagc tatttaccag gagagcggga 30
Claims (7)
1. a kind of method of expression CTLA4Ig high in mesenchymal stem cell, it is characterised in that: using expression vector in bone
CTLA4Ig gene is expressed in bone marrow-drived mesenchymal stem.
2. the method as described in claim 1, it is characterised in that: construct table by promoter of sequence shown in SEQ ID NO:1
The expression of CTLA4Ig gene is carried out up to carrier.
3. the method according to claim 1: it is characterized by: wherein CTLA4Ig gene obtains with the following method
:
The primer sequence of fully synthetic first P1, P2 and P3:
P1:5'-GGGGATATCCACCATGGGTGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTC-3'
P2:5'-CTCAGTCTGGTCCTTGCACTCCTGTTTCCAGCATGGCGAGCATGGCAATGCACGTGGCCCAGCC-3'
P3:5'-GCGGATCCACTTACCTGTAGAATCTGGGCACGG-3'
With P2 and P3 primer, using mouse DNA as template, after the amplification of half sleeve type PCR, then with P1 and P3 primer, it is overlapped through primer
PCR obtains the fusion of oncostatinM signal peptide and CTLA4 extracellular fragment to CTLA4 gene modification；PCR product is through restricted
Restriction endonuclease EcoRV and BamH I digestion, electrophoresis recycling, are connected to the expression vector pIg through identical digestion；After digestion is identified,
It is named as pIg-CTLA4 or CTLA4Ig.
4. method as claimed in claim 3, it is characterised in that: the expression vector replaces CTLA4Ig gene and promoter
It is built-up after the pCDH slow virus skeleton carrier connection of SEQ ID NO:1.
5. the mesenchymal stem cell obtained such as any one of claim 1-4 method.
6. a kind of prepare the method for turning the mesenchymal stem cell of CTLA4Ig gene, it is characterised in that: prepare first
CTLA4Ig gene is connect structure with the pCDH slow virus skeleton carrier that promoter replaces with SEQ ID NO:1 by CTLA4Ig gene
Recombinant vector is built, then gene-transfected BMSCs obtain.
7. mesenchymal stem cell described in claim 5 is in the application being used to prepare in anti-rejection medication.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910169108.6A CN109706182B (en) | 2019-03-06 | 2019-03-06 | Method for highly expressing CTLA4Ig in mesenchymal stem cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910169108.6A CN109706182B (en) | 2019-03-06 | 2019-03-06 | Method for highly expressing CTLA4Ig in mesenchymal stem cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706182A true CN109706182A (en) | 2019-05-03 |
| CN109706182B CN109706182B (en) | 2020-05-22 |
Family
ID=66266442
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910169108.6A Active CN109706182B (en) | 2019-03-06 | 2019-03-06 | Method for highly expressing CTLA4Ig in mesenchymal stem cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706182B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101269089A (en) * | 2008-01-24 | 2008-09-24 | 中国人民解放军军事医学科学院野战输血研究所 | Application of CTLA4Ig gene modified medulla mesenchyma stem cell |
| CN101343640A (en) * | 2008-01-24 | 2009-01-14 | 中国人民解放军军事医学科学院野战输血研究所 | Common expression CTLA4Ig and CTLA4 recombinant adenovirus carrier, recombinant adenovirus and uses thereof |
| CN102030828A (en) * | 2009-09-25 | 2011-04-27 | 上海抗体药物国家工程研究中心有限公司 | CTLA4-Ig fusion protein mutants with high affinity |
| WO2015182953A1 (en) * | 2014-05-27 | 2015-12-03 | Samsung Electronics Co., Ltd. | Composition and kit for prevention or treatment of arthritis, and method using the same |
-
2019
- 2019-03-06 CN CN201910169108.6A patent/CN109706182B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101269089A (en) * | 2008-01-24 | 2008-09-24 | 中国人民解放军军事医学科学院野战输血研究所 | Application of CTLA4Ig gene modified medulla mesenchyma stem cell |
| CN101343640A (en) * | 2008-01-24 | 2009-01-14 | 中国人民解放军军事医学科学院野战输血研究所 | Common expression CTLA4Ig and CTLA4 recombinant adenovirus carrier, recombinant adenovirus and uses thereof |
| CN102030828A (en) * | 2009-09-25 | 2011-04-27 | 上海抗体药物国家工程研究中心有限公司 | CTLA4-Ig fusion protein mutants with high affinity |
| WO2015182953A1 (en) * | 2014-05-27 | 2015-12-03 | Samsung Electronics Co., Ltd. | Composition and kit for prevention or treatment of arthritis, and method using the same |
Non-Patent Citations (1)
| Title |
|---|
| 尹东亮等: "CTLA4-Ig基因修饰骨髓间充质干细胞抑制大鼠肝移植排斥反应", 《器官移植》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706182B (en) | 2020-05-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2432744T3 (en) | Extramedullary adipose tissue cells and their applications in cardiac tissue reconstitution | |
| Lin et al. | Efficient lentiviral transduction of human mesenchymal stem cells that preserves proliferation and differentiation capabilities | |
| US8852570B2 (en) | Cardiac muscle regeneration using mesenchymal stem cells | |
| Henry et al. | Adult lung spheroid cells contain progenitor cells and mediate regeneration in rodents with bleomycin-induced pulmonary fibrosis | |
| ES2589311T3 (en) | Cell populations that have immunoregulatory activity, isolation method and uses | |
| JP5371445B2 (en) | Method for culturing adipose tissue-derived cells and use thereof | |
| Etzion et al. | Cellular cardiomyoplasty of cardiac fibroblasts by adenoviral delivery of MyoD ex vivo: an unlimited source of cells for myocardial repair | |
| EA004928B1 (en) | Polypeptides increasing gene introduction efficiency into target cells by a retrovirus and genes encoding them | |
| JP2002511094A (en) | Myocardial regeneration using mesenchymal stem cells | |
| WO2006078034A1 (en) | Cells capable of differentiating into cardiac muscle cells | |
| Werner et al. | Transfer of endothelial progenitor cells improves myocardial performance in rats with dilated cardiomyopathy induced following experimental myocarditis | |
| JP2006515759A (en) | Mesenchymal stem cells as transport means for ion channel transport in syncytium structures | |
| Chen et al. | The role of notch 1 activation in cardiosphere derived cell differentiation | |
| JP2022543445A (en) | Cell compositions and methods of treatment containing viral vectors | |
| CN107937442A (en) | A kind of immortal human fat mesenchymal stem cell system and its method for building up | |
| Yamada et al. | Single-cell-derived mesenchymal stem cells overexpressing Csx/Nkx2. 5 and GATA4 undergo the stochastic cardiomyogenic fate and behave like transient amplifying cells | |
| CN107119020B (en) | Liver injury targeted mesenchymal stem cell based on miR-9 and preparation method and application thereof | |
| WO2024183423A1 (en) | Crispr/cas9-grna targeting plasmid, donor plasmid, and method for preparing immortalized mouse cell line | |
| Liu et al. | Efficient isolation of cardiac stem cells from brown adipose | |
| CN106011074B (en) | Mesenchymal stem cell with high expression of CXCR5 and preparation and application thereof | |
| CN109706182A (en) | A method of the high expression CTLA4Ig in mesenchymal stem cell | |
| JP2020533981A (en) | Mesenchymal stem cells overexpressing CXCR5, their production methods and uses | |
| Zhu et al. | Sfrp1 as a pivotal paracrine factor in the trained pericardial stem cells that foster reparative activity | |
| KR100952368B1 (en) | Development of dual promoter-driven reporter systems and their application in simultaneous tracing of mesenchymal stem cells differentiating into the cardiomyogenic or the endothelial cell lineage | |
| CN111321169A (en) | Genetically modified NK cell and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Xiangshi Inventor after: Wu Manxiang Inventor after: Chen Shuai Inventor after: Li Na Inventor before: Wu Manxiang Inventor before: Chen Shuai Inventor before: Li Na |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200429 Address after: 132300 no.1277, Antai Road, Panshi Economic Development Zone, Jilin City, Jilin Province Applicant after: Jilin runfengyuan biopharmaceutical Co., Ltd Address before: 336000 Yintai Square, Yuanzhou District, Yichun City, Jiangxi Province, 8 501 Applicant before: YICHUN LIANZE BIOTECHNOLOGY DEVELOPMENT Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |