CN109706147A - Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit - Google Patents
Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit Download PDFInfo
- Publication number
- CN109706147A CN109706147A CN201810439106.XA CN201810439106A CN109706147A CN 109706147 A CN109706147 A CN 109706147A CN 201810439106 A CN201810439106 A CN 201810439106A CN 109706147 A CN109706147 A CN 109706147A
- Authority
- CN
- China
- Prior art keywords
- seq
- bcr
- circular rna
- cml
- abl1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of circular rna circBA9.3 and its purposes in CML diagnostic kit, its cyclic annular mRNA for deriving from BCR-ABL1 fusion, wherein 3 ' end the 3rd exon reverse splicings of ABL1 hold the 9th exons of BCR to 5 ' and form cyclic structure from beginning to end, and nucleotide sequence is as shown in SEQ ID NO:8.Kit can in specific detection chronic myelocytic leukemia (CML) clinical sample circBA9.3 expression, so as to study CML patient, and provide the method for diagnosing and treating.
Description
Technical field
The present invention relates to field of biotechnology, especially with respect to a kind of CML diagnostic kit.
Background technique
BCR-ABL1 fusion is positioned at the Philadelphia chromosome of No. 22 and the mutual transposition formation of Chromosome 9
(Ph), which is that chronic myelocytic leukemia (chronic myelocytic leukemia, CML) patient makes a definite diagnosis, in advance
The mark molecule of judgement and recurrence prediction afterwards.The cause of disease of CML is mainly the lasting tyrosine kinase activity of BCR-ABL1, is promoted
The proliferation and Anti-G value of cell.Tyrosine kinase inhibitor (tyrosine kinase inhibitors, TKIs) is three
Competitive inhibitor of the adenosine phosphate (ATP) in conjunction with tyrosine kinase, the targeted drug clinically treated as CML patient.
There is the drug resistance situation of TKIs in CML chronic phase patient, often results in progression of disease to accelerated period and rapid change period, comes to CML treatment zone
It is difficult.The main reason for mutation of BCR-ABL1 kinase domain is CML patient's drug resistance.But still some BCR-ABL1 kinases
The drug resistance patient that structural domain does not mutate, needs to explore new resistance mechanism, provides more accurate treatment method.
Circular rna is that 5 ' ends of one kind and 3 ' terminal covalents combine the annular RNA molecule for forming phosphodiester bond.It is this kind of
RNA molecule has absorption microRNA, connection protein molecular, assists albumen migration and serve as the function such as scaffold molecule in the composite
Energy.Therefore they can play a significant role in terms of controlling gene expression and protein content level, and some researches show that rings
Shape RNA and the proliferation and drug resistance of leukaemia cell are closely related.But the level of most of circular rna expression is extremely low, is difficult to use
Conventional PCR method detection, and lack the accurate reference gene for measuring circular rna expression in vivo.
Summary of the invention
The present invention provides a kind of new CML diagnostic kit.
The present invention provides a kind of circular rna circBA9.3, derives from the cyclic annular mRNA of BCR-ABL1 fusion,
In 3 ' end the 3rd exon reverse splicings of ABL1 to 5 ' end the 9th exons of BCR and form cyclic structure from beginning to end,
Nucleotide sequence is as shown in SEQ ID NO:8.
The kit of circular rna circBA9.3 described in detection a kind of, including specific probe, the nucleosides of the probe
Acid sequence is as shown in SEQ ID NO:3.
A kind of circular rna circBA9.3 is preparing the purposes in CML (chronic myelocytic leukemia) diagnostic kit, institute
The cyclic annular mRNA that circular rna circBA9.3 derives from BCR-ABL1 fusion is stated, wherein 3 ' end the 3rd exons of ABL1 are anti-
Cyclic structure from beginning to end is formed to montage to 5 ' end the 9th exons of BCR, nucleotide sequence such as SEQ ID NO:8
It is shown.
The kit includes the primer of amplification circular rna circBA9.3.
The nucleotide sequence of upstream primer in the primer as shown in SEQ ID NO:1, draw by the downstream in the primer
The nucleotide sequence of object is as shown in SEQ ID NO:2.
A kind of digital pcr detection kit for circular rna circBA9.3 described in claim 1, feature exist
In, including upstream primer sequence, as shown in SEQ ID NO:1, downstream primer sequence is as shown in SEQ ID NO:2, and probe sequence is such as
Shown in SEQ ID NO:3.
A kind of primer for the special circular rna circBA9.3 of PCR amplification BCR-ABL1 fusion, the sequence of primer
It is classified as: 5 ' TCGCTGAGATACGAAGGGAG ' of upstream primer 3 (SEQ ID NO:1), downstream primer 5 '
AGGTCGGTGAACAGGAAGAC′3(SEQ ID NO:2).Expanded in CML patient's mononuclearcell sample using the primer and
Reversal connection region sequence (the reversal connection region sequence is as shown in SEQ ID NO:9) is identified, and the loop-forming sequences of the circBA9.3 are provided.
A kind of specific probe detecting circBA9.3, probe sequence are as follows: 5 ' CTGATGGCAAGCACCGGCAGC ' 3
(SEQ ID NO:3), and establish the digital pcr system that the circular rna is detected in clinical sample.
Steps are as follows for the acquisition of reversal connection region sequence:
(1) extraction and purifying of total serum IgE: separation CML patient's mononuclearcell extracts cell total rna, digests DNA.
(2) it using random hexamers reverse transcription is cDNA that RNA reverse transcription, which is cDNA:RNA,.
(3) it is reversely connected the amplification of region sequence: special according to the circBA9.3 of the sequence design departing direction of BCR-ABL1 corresponding circle of sensation
Specific primer, primer sequence are as follows: 5 ' TCGCTGAGATACGAAGGGAG ' of upstream primer sequence 3 (SEQ ID NO:1) and downstream are drawn
5 ' AGGTCGGTGAACAGGAAGAC ' 3 (SEQ ID NO:2) of object sequence.PCR amplification is carried out, amplified production is solidifying using agarose
Gel electrophoresis detection.
(4) PCR product utilizes T4DNA ligase is connected to pMD20-T carrier, transformed competence colibacillus escherichia coli DH5a, and 37
It is incubated overnight under the conditions of DEG C.Picking monoclonal, PCR detection clone, designs detection primer, primer sequence according to carrier M13 gene
Are as follows: 5 ' GAGCGGATAACAATTTCACACAGG ' of upstream primer 3 (SEQ ID NO:4), downstream primer 5 '
CGCCAGGGTTTTCCCAGTCACGAC′3(SEQ ID NO:5).Positive colony sequencing is taken to identify.
(5) according to the probe sequence of reversal connection region sequence design detection circBA9.3:
5 ' CTGATGGCAAGCACCGGCAGC ' 3 (SEQ ID NO:3) utilize 3D digital pcr detection system, detection
Expression of the circBA9.3 in cell line and clinical sample.
The concrete operations of step (1) are as follows:
1) take CML patient peripheral blood sample 1ml, be added 3ml erythrocyte cracked liquid, 4 DEG C are jiggled 15min, 450g from
Heart 10min, removes supernatant.2ml erythrocyte cracked liquid is added, rocks and mixes 5min, 450g is centrifuged 10min, removes supernatant.
1 × PBS suspension cell is added, takes 1 × 106A cell, centrifugation cell.
2) 1ml Trizol reagent is added, oscillation mixes 20s, is stored at room temperature 5min.
3) 200ul chloroform is added, oscillation mixes 20s, ice bath 10min.4 DEG C, 12000g, it is centrifuged 10min.
4) isometric isopropanol is added in Aspirate supernatant, mixes, ice bath 10min.4 DEG C, 12000g, it is centrifuged 10min.
5) precipitating is cleaned with 75% ethyl alcohol of 1ml, 4 DEG C, 7500g, is centrifuged 10min.
6) ethanol is outwelled, precipitating dries 15min, and 20ul DEPC water dissolution precipitating is added.
7) 2ul 10X TURBO DNase Buffer and 1ul TURBO DNase is added in RNA to mix gently, 37 DEG C incubate
Educate 15min.
8) addition 2ul DNase Inactivation Reagent is mixed gently.
9) quality of agarose gel electrophoresis detection RNA, the concentration of proposed RNA is detected using ultramicrospectrophotometer.
The concrete operations of step (2) are as follows:
1) 50uM random hexamers 1ul, dNTP mixture (10mM each) 1ul is added in 2ug RNA, adds water polishing
To 10ul.65 DEG C of incubation 5min, it is cooling rapidly on ice.
2) 5 × reverse transcription reaction buffer 4ul, reverse transcriptase 1ul (200U), RNase suppression is added in above-mentioned reaction of degeneration (RD) liquid
Preparation 0.5ul (20U), adds water polishing to 20ul.
3) 30 DEG C, 10min；42 DEG C, 60min；70 DEG C, 15min, cooled on ice.
The concrete operations of step (3) are as follows:
1) polymerase 0.25ul (1.25U), 10 × PCR buffer 5ul, dNTP (2.5mM each) 4ul, CML patient are single
A nucleus cDNA template 1ul, adds water polishing to 50ul.
2) 95 DEG C of preheating 3min；95 DEG C of denaturation 20s, 57 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 40 recycle；72 DEG C are prolonged
Stretch 10min；16 DEG C of preservations.
The concrete operations of step (4) are as follows: preparing coupled reaction system includes PCR product 3ul, pMD20-T carrier 1ul,
T4DNA ligase 1ul, 2 × connection buffer 5ul, mixes gently；Reaction condition is 16 DEG C of incubation 30min.
In CML patient's mononuclearcell sample, the circular rna, digital pcr detection are detected using digital pcr
Specific step is as follows for method:
(1) extraction and purifying of total serum IgE: extracting CML patient's mononuclearcell sample total serum IgE, and carries out at digestion DNA
Reason.
(2) it using random hexamers reverse transcription is cDNA that RNA reverse transcription, which is cDNA:RNA,.
(3) digital pcr detection system is utilized, reaction system is prepared, reaction condition is set, to circular rna circBA9.3
The CML cell line and CML patient's mononuclearcell sample of overexpression detect.Draw used in digital pcr detection circBA9.3
Object sequence are as follows: upstream primer: 5 ' TCGCTGAGATACGAAGGGAG ' 3, downstream primer: 5 ' AGGTCGGTGAACAGGAAGAC ' 3；
Probe sequence are as follows: 5 ' CTGATGGCAAGCACCGGCAGC ' 3.Specific reaction system are as follows: 2 × digital PCR Mix
7.25ul, each 0.4ul of upstream and downstream primer, probe 0.3ul, cDNA template 3ul, add water polishing to 14.5ul.Specific reaction condition
Are as follows: 96 DEG C of 10min；60 DEG C of 2min, 98 DEG C of 30s, totally 39 recycle；60℃2min；10 DEG C of preservations.Utilize https: //
The online website china.apps.thermofisher.com/quantstudio3d/, analyzes the copy number of the circular rna.
The beneficial effects of the present invention are: kit being capable of specific detection chronic myelocytic leukemia (CML) clinical sample
The expression of middle circBA9.3 so as to study CML patient, and provides the method for diagnosing and treating.
Detailed description of the invention
Fig. 1 is the agarose electrophoresis testing result figure of PCR amplification BCR-ABL1 circular rna circBA9.3, wherein H2O
For negative control, the BCR-ABL1 positive is considered as target sample that may be present；
Fig. 2 is the peak figure and the structural schematic diagram of cyclization of circBA9.3 sequencing identification, wherein the 14th exon of BCR
Connect the integration region to form BCR-ABL1 with 2 exons of ABL, and the 9th exon of 3 exons of ABL and BCR
Form the reversal connection area of circBA9.3；Ex refers to exon；
Fig. 3 is the canonical plotting of CircBA9.3 digital pcr detection, wherein ordinate is the digital pcr of circBA9.3
Testing result, abscissa are the cycles of concentration that template cDNA is 1 template relative to concentration；Template is that overexpression circBA9.3 is thin
The cDNA of born of the same parents, 32 times of dilution are denoted as 1 times of concentration, and 16 times of dilution is denoted as 2 times of concentration, and 8 times of dilution is denoted as 4 times of concentration, dilutes 4 times of notes
For 8 times of concentration, 2 times of dilution is denoted as 16 times of concentration, and undiluted cDNA is denoted as 32 times of concentration；
Fig. 4 is the scatter plot of circBA9.3 expression in digital pcr detection CML clinical samples, and wherein red dot R is represented
The aperture of the circBA9.3 positive on chip, and Huang point Y represents the negative aperture of circBA9.3 on chip, A. positive control was
Express the K562 cell of circBA9.3；B. negative control is H2O；CML patient's sample of C-F.circBA9.3 difference copy number.
Specific embodiment
Below by specific embodiment combination attached drawing, invention is further described in detail.
Embodiment 1: from CML patient's mononuclearcell sample of the BCR-ABL1 positive amplification obtain circBA9.3 at
Ring sequence, the mononuclearcell samples sources are in CML peripheral blood in patients, and by Shenzhen City Second People's Hospital, hematology is acquired, and suffer from
Person's signed informed consent form.Different patient's acquisition times is different, and the acquisition time of sample about is in 2016.01-
2017.12。
(1) extraction of RNA and digestion DNA
1) take CML patient peripheral blood sample 1ml, be added 3ml erythrocyte cracked liquid, 4 DEG C are jiggled 15min, 450g from
Heart 10min, removes supernatant.2ml erythrocyte cracked liquid is added, rocks and mixes 5min, 450g is centrifuged 10min, removes supernatant.
1 × PBS suspension cell is added, takes 1 × 106A cell, centrifugation cell.
2) 1ml Trizol reagent is added, oscillation mixes 20s, is stored at room temperature 5min.
3) 200ul chloroform is added, oscillation mixes 20s, ice bath 10min.4 DEG C, 12000g, it is centrifuged 10min.
4) isometric isopropanol is added in Aspirate supernatant, mixes, ice bath 10min.4 DEG C, 12000g, it is centrifuged 10min.
5) precipitating is cleaned with 75% ethyl alcohol of 1ml, 4 DEG C, 7500g, is centrifuged 10min.
6) ethanol is outwelled, precipitating dries 15min, and 20ul DEPC water dissolution precipitating is added.
7) 2ul 10X TURBO DNase Buffer and 1ul TURBO DNase is added in RNA to mix gently, 37 DEG C incubate
Educate 15min.
8) addition 2ul DNase Inactivation Reagent is mixed gently.
9) quality of agarose gel electrophoresis detection RNA, the concentration of proposed RNA is detected using ultramicrospectrophotometer.
(2) RNA reverse transcription is cDNA
1) 50uM random hexamers 1ul, dNTP mixture (10mM each) 1ul is added in 2ug RNA, adds water polishing
To 10ul.65 DEG C of incubation 5min, it is cooling rapidly on ice.
2) 5 × reverse transcription reaction buffer 4ul, reverse transcriptase 1ul (200U), RNase suppression is added in above-mentioned reaction of degeneration (RD) liquid
Preparation 0.5ul (20U), adds water polishing to 20ul.
3) 30 DEG C, 10min；42 DEG C, 60min；70 DEG C, 15min, cooled on ice.
(3) reaction system and condition of PCR amplification
1) PCR the primer sequence:
| BCR-ABL1.F | 5′CAGATCAAGAATGACATCCAG′3(SEQ ID NO:6) |
| BCR-ABL1.R | 5′CTTAGAGTGTTATCTCCACTG′3(SEQ ID NO:7) |
| CircBA9.3.F | 5′TCGCTGAGATACGAAGGGAG′3(SEQ ID NO:1) |
| CircBA9.3.R | 5′AGGTCGGTGAACAGGAAGAC′3(SEQ ID NO:2) |
2) polymerase 0.25ul (1.25U), 10 × PCR buffer 5ul, dNTP (2.5mM each) 4ul, CML patient are single
A nucleus cDNA template 1ul, adds water polishing to 50ul.
3) 95 DEG C of preheating 3min；95 DEG C of denaturation 20s, 57 DEG C of annealing 30s, 72 DEG C of extension 40s, totally 40 recycle；72 DEG C are prolonged
Stretch 10min；16 DEG C of preservations.
4) PCR product carries out 1% agarose gel electrophoresis detection, as shown in Figure 1.
(4) connection and conversion of PCR product
1) system of connection reaction are as follows: PCR product 3ul, pMD20-T carrier 1ul, T4DNA ligase 1ul, 2 × connection are slow
Fliud flushing 5ul.
2) reaction system, 16 DEG C of incubation 30min are mixed gently.
3) transformed competence colibacillus escherichia coli DH5a is incubated overnight under the conditions of 37 DEG C.Picking monoclonal PCR detection clone, benefit
With the primer of carrier M13 gene, primer sequence are as follows: (the SEQ ID of 5 ' GAGCGGATAACAATTTCACACAGG ' of upstream primer 3
NO:4)；5 ' CGCCAGGGTTTTCCCAGTCACGAC ' of downstream primer 3 (SEQ ID NO:5).Take the clone of the circBA9.3 positive
It is sequenced.According to sequencing result analyze reversal connection region sequence as shown in Figure 2 and circBA9.3 loop-forming sequences such as SEQ ID NO:
Shown in 8.
Embodiment 2: it is overexpressed the building of circular rna circBA9.3 stable conversion CML cell strain
(1) it is overexpressed the building of circBA9.3 slow virus carrier
The loop-forming sequences of chemical synthesis circBA9.3, sequence anneals form double chain DNA fragment, insertion expression circular rna
Slow virus carrier LV-Circ.The positive colony of recombinant plasmid carries out sequencing identification.
(2) packaging of slow virus
1) prepare pSPAX2, pMD2G and LV-Circ-circBA9.3, plasmid concentration is greater than 1 μ g/ μ L, quality A260/280
It can be transfected between 1.7~1.8.
2) the 293T cell of logarithmic growth phase, density reach 70~80% and are transfected when converging rate.It is added before transfection
Fresh complete culture solution DMEM+10%FBS+1% is dual anti-.
3) preparation of the every hole rotaring redyeing system of 12 orifice plates: 1.6ug pSPAX2,0.8ug pMD2G and 1.6ug LV-Circ-
CircBA9.3 Plasmid DNA utilizes the DMEM solution without antibiotic and glutamine to dilute, final volume 100ul.95.2μL
4.8 μ L LipoFiter are added in DMEM solution without antibiotic and glutamineTMTransfection reagent mixes gently, and room temperature is quiet
Set 5min.Diluted transfection reagent and Plasmid DNA are gently mixed, and final volume 200ul is stored at room temperature 20min.It is added to 12 orifice plates
A hole in.
4) 6h is cultivated in 37 DEG C, 5%CO2 incubator, replaces fresh complete culture solution.
5) 48h and 72h collects viral supernatants twice respectively after transfecting.Centrifugal condition: 4 DEG C, 2000g, 10min, removal is thin
Born of the same parents' fragment；Then it collects virus stock solution used supernatant to be placed in ultracentrifugation pipe, 4 DEG C, 82700g, is centrifuged 120min, it finally will slow disease
The super chaotropic of poison is dispensed into the viral pipe of sterilization treatment.- 80 DEG C of refrigerators save.
(3) slow-virus infection CML cell
1) dual anti-using cell culture fluid IMDM+10%FBS+1%, the cell suspension of K562 is prepared, concentration is 3 × 104
A/ml, takes 1ml that sterilizing 1.5ml centrifuge tube is added, and 200g is centrifuged 5min and collects cell.
2) 15ul virus stock solution used is diluted with 485ul cell culture fluid, the final concentration of 5ug/ml of polybrene is added, gently
It mixes, transfection liquid suspension k562 cell, is added in a hole of 12 orifice plates, the overnight incubation in cell incubator.
3) 200g centrifugation 5min collects cell after transfection overnight, removes transfection liquid, adds 1ml culture solution.
4) 48h is transfected, fluorescence microscope cell transfecting efficiency replaces the cell culture containing 2ug/ml puromycin
Liquid screening positive clone.
5) circBA9.3 positive colony carries out sequencing identification.
Embodiment 3: the 3D digital pcr system of detection circBA9.3 is established.
(1) extraction and DNA digestion of circBA9.3 cell RNA are overexpressed
It is collected by centrifugation 1 × 106A cell, 600rpm, 5min.1ml trizol reagent is added, extracts RNA with embodiment 1,
And digest DNA.
(2) taking 4ug RNA reverse transcription is cDNA, and step is the same as embodiment 1.
(3) sesquialter dilutes cDNA template, and 6 concentration gradients are arranged.
(4) 3D digital pcr reaction system: 2 × digital PCR Mix 7.25ul, each 0.4ul of upstream and downstream primer, probe
0.3ul, cDNA template 1ul, add water polishing to 14.5ul.
(5) 3D digital pcr reaction condition are as follows: 96 DEG C of 10min；60 DEG C of 2min, 98 DEG C of 30s, totally 39 recycle；60℃
2min；10 DEG C of preservations.
(6) it utilizeshttps://china.apps.thermofisher.com/quantstudio3d/Online website, is obtained
Obtain the copy number of circBA9.3.According to different templates concentration and corresponding copy number, standard curve is drawn, as shown in Figure 3.
Embodiment 4: the copy number of circBA9.3 in 3D digital pcr detection CML patient's sample is utilized
(1) extraction of CML peripheral blood mononuclear cells RNA and the digestion of DNA, step is the same as embodiment 1.
(2) 2ug RNA reverse transcription is cDNA, and step is the same as embodiment 1.
(3) 3D digital pcr reaction system, with embodiment 3.
(4) 3D digital pcr reaction condition, with embodiment 3.
(5) the online website https: //china.apps.thermofisher.com/quantstudio3d/ is utilized, is obtained
The scatter plot of circBA9.3 positive reaction is obtained, as shown in Figure 4.
The invention discloses the detection method of a kind of particularly ring-shaped RNA sequence and its digital pcr, the circular rna sources
In the mRNA of BCR-ABL1 fusion, wherein 3 ' end the 3rd exon reverse splicings of ABL1 hold the 9th exons of BCR to 5 ',
Referred to as circBA9.3 (or referred to as circBA), is made of 1137 nucleotide.The present invention is according to the fusion position of BCR-ABL1
Point design reverse primer amplifies the distinctive circular rna of BCR-ABL1 gene, clone and DNA sequencing by amplified production, mirror
Make circular rna reversal connection region sequence；The present invention designs specific probe according to reversal connection region sequence, establishes the number of circBA9.3
Word PCR detection architecture.The system being capable of circBA9.3 in specific detection chronic myelocytic leukemia (CML) clinical sample
Expression.The present invention furthers investigate circBA9.3, and the method for diagnosing and treating can be provided for CML patient.
The above content is specific embodiment is combined, further detailed description of the invention, and it cannot be said that this hair
Bright specific implementation is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, it is not taking off
Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made.
SEQUENCE LISTING
<110>Shenzhen City Second People's Hospital
<120>circular rna circBA9.3 and its purposes in CML diagnostic kit is being prepared
<130> 18I26218
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>upstream primer sequence
<400> 1
tcgctgagat acgaagggag 20
<210> 2
<211> 20
<212> DNA
<213>downstream primer sequence
<400> 2
aggtcggtga acaggaagac 20
<210> 3
<211> 21
<212> DNA
<213>probe sequence
<400> 3
ctgatggcaa gcaccggcag c 21
<210> 4
<211> 24
<212> DNA
<213>upstream primer sequence is detected
<400> 4
gagcggataa caatttcaca cagg 24
<210> 5
<211> 24
<212> DNA
<213>downstream primer sequence is detected
<400> 5
cgccagggtt ttcccagtca cgac 24
<210> 6
<211> 21
<212> DNA
<213>BCR-ABL1 upstream primer sequence
<400> 6
cagatcaaga atgacatcca g 21
<210> 7
<211> 21
<212> DNA
<213>BCR-ABL1 downstream primer sequence
<400> 7
cttagagtgt tatctccact g 21
<210> 8
<211> 1137
<212> DNA
<213>circBA9.3 sequence
<400> 8
caccggcagc tgctgaagga cagcttcatg gtggagctgg tggagggggc ccgcaagctg 60
cgccacgtct tcctgttcac cgacctgctt ctctgcacca agctcaagaa gcagagcgga 120
ggcaaaacgc agcagtatga ctgcaaatgg tacattccgc tcacggatct cagcttccag 180
atggtggatg aactggaggc agtgcccaac atccccctgg tgcccgatga ggagctggac 240
gctttgaaga tcaagatctc ccagatcaag aatgacatcc agagagagaa gagggcgaac 300
aagggcagca aggctacgga gaggctgaag aagaagctgt cggagcagga gtcactgctg 360
ctgcttatgt ctcccagcat ggccttcagg gtgcacagcc gcaacggcaa gagttacacg 420
ttcctgatct cctctgacta tgagcgtgca gagtggaggg agaacatccg ggagcagcag 480
aagaagtgtt tcagaagctt ctccctgaca tccgtggagc tgcagatgct gaccaactcg 540
tgtgtgaaac tccagactgt ccacagcatt ccgctgacca tcaataagga agatgatgag 600
tctccggggc tctatgggtt tctgaatgtc atcgtccact cagccactgg atttaagcag 660
agttcaaaag cccttcagcg gccagtagca tctgactttg agcctcaggg tctgagtgaa 720
gccgctcgtt ggaactccaa ggaaaacctt ctcgctggac ccagtgaaaa tgaccccaac 780
cttttcgttg cactgtatga ttttgtggcc agtggagata acactctaag cataactaaa 840
ggtgaaaagc tccgggtctt aggctataat cacaatgggg aatggtgtga agcccaaacc 900
aaaaatggcc aaggctgggt cccaagcaac tacatcacgc cagtcaacag tctggagaaa 960
cactcctggt accatgggcc tgtgtcccgc aatgccgctg agtatctgct gagcagcggg 1020
atcaatggca gcttcttggt gcgtgagagt gagagcagtc ctggccagag gtccatctcg 1080
ctgagatacg aagggagggt gtaccattac aggatcaaca ctgcttctga tggcaag 1137
<210> 9
<211> 146
<212> DNA
<213>it is reversely connected region sequence
<400> 9
tcgctgagat acgaagggag ggtgtaccat tacaggatca acactgcttc tgatggcaag 60
caccggcagc tgctgaagga cagcttcatg gtggagctgg tggagggggc ccgcaagctg 120
cgccacgtct tcctgttcac cgacct 146
Claims (6)
1. a kind of circular rna circBA9.3, which is characterized in that from the cyclic annular mRNA of BCR-ABL1 fusion, wherein
3 ' end the 3rd exon reverse splicings of ABL1 hold the 9th exons of BCR to 5 ' and form cyclic structure from beginning to end, core
Nucleotide sequence is as shown in SEQ ID NO:8.
2. a kind of kit for detecting circular rna circBA9.3 described in claim 1, which is characterized in that including specificity
Probe, the nucleotide sequence of the probe is as shown in SEQ ID NO:3.
3. a kind of circular rna circBA9.3 is preparing the purposes in CML diagnostic kit, which is characterized in that the circular rna
CircBA9.3 derives from the cyclic annular mRNA of BCR-ABL1 fusion, wherein 3 ' hold the 3rd exon reverse splicings of ABL1 to 5 '
It holds the 9th exon of BCR and forms cyclic structure from beginning to end, nucleotide sequence is as shown in SEQ ID NO:8.
4. purposes as claimed in claim 3, which is characterized in that the kit includes amplification circular rna circBA9.3
Primer.
5. purposes as claimed in claim 4, which is characterized in that the nucleotide sequence of the upstream primer in the primer such as SEQ
Shown in ID NO:1, the nucleotide sequence of the downstream primer in the primer is as shown in SEQ ID NO:2.
6. a kind of digital pcr detection kit for circular rna circBA9.3 described in claim 1, which is characterized in that
Including upstream primer sequence as shown in SEQ ID NO:1, downstream primer sequence is as shown in SEQ ID NO:2, probe sequence such as SEQ
Shown in ID NO:3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810439106.XA CN109706147A (en) | 2018-05-09 | 2018-05-09 | Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810439106.XA CN109706147A (en) | 2018-05-09 | 2018-05-09 | Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109706147A true CN109706147A (en) | 2019-05-03 |
Family
ID=66253682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810439106.XA Pending CN109706147A (en) | 2018-05-09 | 2018-05-09 | Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706147A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724741A (en) * | 2019-07-24 | 2020-01-24 | 艾普拜生物科技(苏州)有限公司 | Primer, probe and kit for detecting minimal residual leukemia related fusion gene |
| CN113403392A (en) * | 2021-02-20 | 2021-09-17 | 北京金则医学检验实验室有限公司 | Composition and kit for detecting tiny residual focus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015060703A2 (en) * | 2013-10-10 | 2015-04-30 | Moroccan Foundation For Advanced Science, Innovation & Research (Mascir) | Kit for diagnosing chronic myeloid leukaemia in a multiplex reaction and applications of same to monitor the treatment and the residual disease |
| CN107988370A (en) * | 2017-12-28 | 2018-05-04 | 山东大学齐鲁医院 | A kind of application of circRNA genes in diagnosing chronic granulocytic leukemia reagent is prepared |
-
2018
- 2018-05-09 CN CN201810439106.XA patent/CN109706147A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015060703A2 (en) * | 2013-10-10 | 2015-04-30 | Moroccan Foundation For Advanced Science, Innovation & Research (Mascir) | Kit for diagnosing chronic myeloid leukaemia in a multiplex reaction and applications of same to monitor the treatment and the residual disease |
| CN107988370A (en) * | 2017-12-28 | 2018-05-04 | 山东大学齐鲁医院 | A kind of application of circRNA genes in diagnosing chronic granulocytic leukemia reagent is prepared |
Non-Patent Citations (3)
| Title |
|---|
| YUMING PAN等: "CircBA9.3 supports the survival of leukaemic cells by up-regulating c-ABL1or BCR-ABL1 protein levels", 《BLOOD CELLS, MOLECULES AND DISEASES》 * |
| 刘雨函等: "环状RNA在肿瘤中的研究进展", 《中国肿瘤》 * |
| 王衬等: "CircRNA在髓系白血病中的研究进展", 《现代肿瘤医学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724741A (en) * | 2019-07-24 | 2020-01-24 | 艾普拜生物科技(苏州)有限公司 | Primer, probe and kit for detecting minimal residual leukemia related fusion gene |
| CN110724741B (en) * | 2019-07-24 | 2020-05-19 | 艾普拜生物科技(苏州)有限公司 | Primer, probe and kit for detecting minimal residual leukemia related fusion gene |
| CN113403392A (en) * | 2021-02-20 | 2021-09-17 | 北京金则医学检验实验室有限公司 | Composition and kit for detecting tiny residual focus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104726570B (en) | The kit of lncRNA NEAT1 and its application in liver cancer serum diagnosis in a kind of detection serum | |
| CN110384800B (en) | Application of LncRNA XLOC _075168 in preparation of medicine for promoting angiogenesis | |
| WO2018024034A1 (en) | Circular rna circ-nfatc3 and application thereof | |
| CN110791501B (en) | Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| Chen et al. | Long noncoding RNA (lncRNA) FOXD2-AS1 promotes cell proliferation and metastasis in hepatocellular carcinoma by regulating MiR-185/AKT axis | |
| CN105177132A (en) | RT-PCR method for quantitatively detecting miRNA | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN110123828A (en) | Application of the inhibitor of PRALR in the drug that resistance to taxol oophoroma is treated in preparation | |
| CN110403954A (en) | Application of the inhibitor of LncRNA XLOC_110286 in the drug that preparation promotes angiogenesis | |
| CN109706147A (en) | Circular rna circBA9.3 and its preparing the purposes in CML diagnostic kit | |
| CN106480033B (en) | One kind ring-type circRNA-005365 gene relevant to leukaemia and application thereof | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN107557472B (en) | Glioma diagnosis marker circ9:135881633|135883078 and application | |
| CN113186226B (en) | RNA virus nucleic acid detection reference standard and application thereof | |
| CN106119423A (en) | The general PCR primer of detection Avianreovirus and detection kit thereof | |
| CN106435021A (en) | Kit for detecting Newcastle disease viruses of chicken with different genotypes | |
| CN109486816B (en) | Polynucleotide for treating tumor and its application | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN114002431B (en) | Application of TNNT1 in preparation of virus type hepatocellular carcinoma diagnosis kit and preparation or screening of anti-liver cancer drugs | |
| CN106434667B (en) | Relevant ring-type circRNA-016901 gene of a kind of leukaemia and application thereof | |
| CN107227362A (en) | A kind of gene related to liver cancer and its application | |
| CN111826433B (en) | Application of LncRNA in prognosis evaluation of diabetes and early warning of recurrent abortion | |
| CN103695427B (en) | Small interfering RNA (Ribonucleic Acid) and recombinant vector for knocking down VPS11 (Vacuolar Protein Sorting-Associated Protein 11), and application of small interfering RNA and recombinant vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190503 |
|
| RJ01 | Rejection of invention patent application after publication |