CN109706105A - One plant of deformation pseudomonad fliA gene silencing bacterial strain - Google Patents
One plant of deformation pseudomonad fliA gene silencing bacterial strain Download PDFInfo
- Publication number
- CN109706105A CN109706105A CN201910013458.3A CN201910013458A CN109706105A CN 109706105 A CN109706105 A CN 109706105A CN 201910013458 A CN201910013458 A CN 201910013458A CN 109706105 A CN109706105 A CN 109706105A
- Authority
- CN
- China
- Prior art keywords
- flia
- pseudomonad
- deformation
- bacterial strain
- gene silencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000012226 gene silencing method Methods 0.000 title claims abstract description 22
- 230000001580 bacterial effect Effects 0.000 title claims abstract description 19
- 230000030279 gene silencing Effects 0.000 title claims abstract description 17
- 101150017109 fliA gene Proteins 0.000 title description 4
- 208000015181 infectious disease Diseases 0.000 claims abstract description 20
- 238000004321 preservation Methods 0.000 claims abstract description 5
- 108091027967 Small hairpin RNA Proteins 0.000 claims description 9
- 230000014509 gene expression Effects 0.000 claims description 9
- 241000251468 Actinopterygii Species 0.000 claims description 8
- 239000004055 small Interfering RNA Substances 0.000 claims description 8
- 108091030071 RNAI Proteins 0.000 claims description 4
- 238000005516 engineering process Methods 0.000 claims description 4
- 230000009368 gene silencing by RNA Effects 0.000 claims description 4
- 210000001835 viscera Anatomy 0.000 claims description 4
- 241000248484 Ichthyophthirius Species 0.000 claims description 3
- 238000004458 analytical method Methods 0.000 claims description 3
- 238000000137 annealing Methods 0.000 claims description 3
- 238000010276 construction Methods 0.000 claims description 3
- 230000005611 electricity Effects 0.000 claims description 3
- 238000012360 testing method Methods 0.000 claims description 3
- 208000032536 Pseudomonas Infections Diseases 0.000 claims description 2
- 230000015572 biosynthetic process Effects 0.000 claims description 2
- 230000003993 interaction Effects 0.000 claims description 2
- 238000012216 screening Methods 0.000 claims description 2
- 238000012358 sourcing Methods 0.000 claims description 2
- 238000003786 synthesis reaction Methods 0.000 claims description 2
- 238000002360 preparation method Methods 0.000 claims 2
- 230000001018 virulence Effects 0.000 abstract description 6
- 229940031567 attenuated vaccine Drugs 0.000 abstract description 3
- 230000003111 delayed effect Effects 0.000 abstract description 3
- 230000002458 infectious effect Effects 0.000 abstract description 2
- 241001596950 Larimichthys crocea Species 0.000 description 21
- 108020004414 DNA Proteins 0.000 description 13
- 210000000952 spleen Anatomy 0.000 description 10
- 108090000623 proteins and genes Proteins 0.000 description 9
- 230000037432 silent mutation Effects 0.000 description 9
- 210000003495 flagella Anatomy 0.000 description 7
- 241000196324 Embryophyta Species 0.000 description 6
- 239000013612 plasmid Substances 0.000 description 6
- 230000004083 survival effect Effects 0.000 description 6
- 238000011049 filling Methods 0.000 description 5
- 238000002347 injection Methods 0.000 description 5
- 239000007924 injection Substances 0.000 description 5
- 210000004185 liver Anatomy 0.000 description 5
- 230000035772 mutation Effects 0.000 description 5
- 210000004027 cell Anatomy 0.000 description 4
- 238000004519 manufacturing process Methods 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 210000001519 tissue Anatomy 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 238000011529 RT qPCR Methods 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 239000000284 extract Substances 0.000 description 3
- 210000003734 kidney Anatomy 0.000 description 3
- 238000013518 transcription Methods 0.000 description 3
- 230000035897 transcription Effects 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 102000053602 DNA Human genes 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 230000007423 decrease Effects 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000000034 method Methods 0.000 description 2
- 230000004899 motility Effects 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 230000002062 proliferating effect Effects 0.000 description 2
- 239000013535 sea water Substances 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- 241000357444 Epinephelus coioides Species 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 108010022355 Fibroins Proteins 0.000 description 1
- 239000007836 KH2PO4 Substances 0.000 description 1
- 241000589248 Legionella Species 0.000 description 1
- 208000007764 Legionnaires' Disease Diseases 0.000 description 1
- 102000003960 Ligases Human genes 0.000 description 1
- 108090000364 Ligases Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241000589517 Pseudomonas aeruginosa Species 0.000 description 1
- 241001223182 Pseudomonas plecoglossicida Species 0.000 description 1
- 238000003559 RNA-seq method Methods 0.000 description 1
- 240000004980 Rheum officinale Species 0.000 description 1
- 235000008081 Rheum officinale Nutrition 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- BNIILDVGGAEEIG-UHFFFAOYSA-L disodium hydrogen phosphate Chemical compound [Na+].[Na+].OP([O-])([O-])=O BNIILDVGGAEEIG-UHFFFAOYSA-L 0.000 description 1
- 229910000397 disodium phosphate Inorganic materials 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 238000003209 gene knockout Methods 0.000 description 1
- 102000034356 gene-regulatory proteins Human genes 0.000 description 1
- 108091006104 gene-regulatory proteins Proteins 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 101150013736 gyrB gene Proteins 0.000 description 1
- 230000000968 intestinal effect Effects 0.000 description 1
- 101150044508 key gene Proteins 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 210000002540 macrophage Anatomy 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910000402 monopotassium phosphate Inorganic materials 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- GNSKLFRGEWLPPA-UHFFFAOYSA-M potassium dihydrogen phosphate Chemical compound [K+].OP(O)([O-])=O GNSKLFRGEWLPPA-UHFFFAOYSA-M 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000000630 rising effect Effects 0.000 description 1
- 230000035939 shock Effects 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 230000006641 stabilisation Effects 0.000 description 1
- 238000011105 stabilization Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 210000000115 thoracic cavity Anatomy 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention provides one plant of deformation pseudomonadfliABacterial strain described in gene silencing bacterial strain isPseudomonas plecoglossicida fliA‑RNAi, on November 12nd, 2018 in China typical culture collection center preservation, deposit number is CCTCC NO:M 2018770.Constructed deformation pseudomonadfliAThe virulence of gene silencing bacterial strain is substantially less than the virulence for deforming pseudomonad wild strain, and the death initial time caused by same infectious condition is delayed, and the death rate substantially reduces, and has established theoretical basis to develop deformation pseudomonad attenuated vaccine.
Description
Technical field
The invention belongs to microorganisms technical fields, are more particularly to one plant of deformation pseudomonadfliAGene silencing bacterial strain.
Background technique
Deformation pseudomonad (Pseudomonas plecoglossicida) it is that the seawater such as Larimichthys crocea, Epinephelus coioides are supported
The pathogen of breeding fish " internal organ ichthyophthirius ", it is annual caused by direct economic loss surpass hundred million yuan.
fliAGene is the key gene in flagellar production, the FliA(σ of coding28) albumen in flagellar production to Guan Chong
It wants.σ28It is the positive regulator protein in flagellar production, is transcription, third class flagellum promoter which determine third class flagellum promoter
The transcription of flagellum late gene is controlled, flagellum late gene encodes the motor protein of flagellum, trend albumen and flagellum silk-fibroin.
When bacterium lacksfliAAfter gene, locomitivity and pathogenic is all weakened film Forming ability.
Previous in research, compared with the pure culture of wild type deformation pseudomonad (being cultivated at 18 DEG C), infecting
24,48,72 and 96 hours afterwards,fliAGene expression amount all raises.Pass through Larimichthys crocea infection experiment, discovery deformation pseudomonadfliADeath initial time caused by gene silencing mutant strain is delayed, and the death rate substantially reduces.Deform pseudomonadfliASilencing
Mutant strain is to develop deformation pseudomonad attenuated vaccine to have established theoretical basis, and the internal organ caused for research deformation pseudomonad are white
The sick preventing and controlling of point provide potential target spot.
Summary of the invention
The purpose of the present invention is to provide one plant of deformation pseudomonadsfliAGene silencing bacterial strain.
To achieve the above object, the present invention adopts the following technical scheme:
One plant of deformation pseudomonadfliAGene silencing bacterial strain, the bacterial strain arePseudomonas plecoglossicida fliA-RNAi, on November 12nd, 2018 in China typical culture collection center preservation, deposit number is CCTCC NO:M
2018770, address is Wuhan Wuhan University.
This strain provided by the invention deforms pseudomonadfliAGene silencing bacterial strain is carried out by following technological means
Building,
(1): by comparing analysis deformation pseudomonas infection host interaction transcript profile data, screening expression quantity in course of infection
It improvesfliAGene；
(2): synthesis shRNA is connected into pCM130/tac carrier after annealing, turn technological sourcing by electricity and deform pseudomonad competence
Cell, building deformation pseudomonadfliAGene silencing mutant strain；It using QPCR technology, tests to silencing efficiency, finally
Obtain building deformation pseudomonadfliAGene silencing mutant strain.The pCM130/tac carrier is added using plasmid pCM130
Upper promoter tac is constituted.
(3) utilize artificial liver support, research deformation pseudomonad wild strain,fliAThe virulence of gene silencing mutant strain,
AndfliAInfluence of the gene silencing to deformation pseudomonad and Larimichthys crocea gene expression.
By gene sequencing and comparison, bacterial strain provided by the invention is one plant of deformation pseudomonadfliAGene silencing bacterium
Strain.
The present invention has the advantages that
Artificial liver support the result shows that, deform pseudomonadfliAThe virulence of gene silencing mutant strain, which is substantially less than, deforms false list
The virulence of born of the same parents' bacterium wild strain, the death initial time caused by same infectious condition are delayed, and the death rate substantially reduces, and are become to develop
Shape pseudomonad attenuated vaccine has established theoretical basis.
Dual RNA-seq analysis the result shows that, deform pseudomonadfliAThe stabilization silencing of gene can not only significant shadow
The transcript profile expression of deformation pseudomonad is rung, and the transcript profile expression of Larimichthys crocea can be significantly affected, this is false for research deformation
The internal organ ichthyophthirius preventing and controlling that monad causes provide potential target spot.
Detailed description of the invention
Fig. 1 Larimichthys crocea is by the survival rate after deformation pseudomonad.Black thin represents wild by deformation pseudomonad in figure
The Larimichthys crocea survival rate of strain infection；Grey filament is represented by deformation pseudomonadfliAThe Larimichthys crocea existence of silent mutation strain infection
Rate；Heavy black line represents the Larimichthys crocea survival rate injected by PBS.
Fig. 2 Larimichthys crocea spleen is by the phenotype after deformation each strain infection of pseudomonad.In first box is to be deformed
The 3rd day spleen of Larimichthys crocea of pseudomonad wild strain infection；In second box is to be deformed pseudomonadfliASilencing
The 7th day spleen of Larimichthys crocea of mutant infection；In third box is the spleen for injecting the fish of PBS.
Fig. 3 Larimichthys crocea Different Organs are for deformation pseudomonad carrying capacity measurement.Abscissa is the metainfective time in figure；It is vertical
Coordinate is to deform pseudomonad in the tissuefliARatio of the silent mutation strain number amount compared to wild strain.Different filling shapes
Pillar represents different tissues: small grid filling is spleen；Big grid filling is body kidney；Horizontal line filling is blood；It is perpendicular
Line filling is liver.
Specific embodiment
Embodiment 1
Deformation pseudomonad provided in an embodiment of the present inventionfliAGene stablize silencing bacterial strain construction method the following steps are included:
S101: by comparing transcription group analytical technology, deformation pseudomonad gene expression dose is detected, is foundfliA
Gene expression quantity in course of infection significantly improves.After consulting literatures, pseudomonas aeruginosa is foundfliAGene knockout mutant strain
Flagellum, motility decline cannot be synthesized, the proliferative capacity in mouse intestinal weakens；Legionella pneumophiliafliAGene mutation strain
Motility decline, film forming ability weaken, and infection ability and proliferative capacity to macrophage and host cell all weaken.Therefore it chooses
ChoosingfliAGene；
S102: using the online shRNA design tool of Thermo-fisher Scientific company (http: //
rnaidesigner.thermofisher.com/rnaiexpress/setOption.dodesignOption=shrna&pid=
708587103220684543) shRNA, is designed and synthesized, then anneals to form double-strand shRNA using annealing buffer.Building
Deform pseudomonadfliASilent mutation strain shRNA sequence, shRNA sequence F:5 '-TGGTCAAGCGCATTGTCAATCATTCA
AGAGATGATTGACAATGCGCTTGACCTTTTTTT-3 ', R:5 '-GTACAAAAAAAGGTCAAGCGCATTGTCAATCATC
TCTTGAATGATTGACAATGCGCTTGACCATGCA-3 ' (5 ' -3 ') buys original plasmid pCM130 from hundred Ao Maike companies
The promoter tac to add up constitutes pCM130/tac plasmid.Use restriction enzymeBsrGIWithNsiIDouble digestion
PCM130/tac plasmid makes its linearisation, is then connected linearization plasmid with double-strand shRNA using T4 ligase.Matter will be recombinated
The first thermal shock of grain is transformed into bacillus coli DH 5 alpha competent cell, and 37 DEG C of expansion cultures extract recombinant plasmid, electricity after being sequenced successfully
It hits and is transformed into deformation pseudomonad competent cell, expand culture under the conditions of 18 DEG C.This bacterial strain is to deform pseudomonadfliASilent mutation strain.The deformation pseudomonadfliASilent mutation strain isPseudomonas plecoglossicida fliA-RNAi, on November 12nd, 2018 in China typical culture collection center preservation, deposit number is CCTCC NO:M
2018770, address is Wuhan, Wuhan University.
Using qRT-PCR technology, test to silencing efficiency, upstream primer sequence (5 ' -3 ' ') are as follows:
CGAGGGTTTCTTCAGAGCGGTAC, downstream primer sequence (5 ' -3 ' ') are as follows: GCACCAGGCCAATTTCTTTAAGAT is examined
As a result consistent with transcript profile sequencing result, fliA gene expression amount raises after infection；
S103: utilize artificial liver support, to deformation pseudomonad wild strain andfliAThe virulence of silent mutation strain compares.
Deformation pseudomonad wild strain,fliASilent mutation strain and PBS(NaCl 0.8g, KCl 0.02g, Na2HPO4
0.36g、 KH2PO4 0.024g、H2O 1L) thoracic cavity infectable infection under preceding fin fin, every fish note are carried out to three groups of Larimichthys croceas respectively
0.2 mL is penetrated, strain infection concentration is 104Cfu/g, every group of 60 tails of the comparable Larimichthys crocea of length scale, then at 18 DEG C of water temperature
It is raised in seawater, records the survival condition of each group fish daily.
Larimichthys crocea infection deformation pseudomonad is inquired intofliAThe case where silent mutation strain is survived.The Larimichthys crocea of PBS is injected,
It does not observe after injection and did not all observe death up to 14 days.The Larimichthys crocea of injection deformation pseudomonad wild strain, the 3rd day
There is dead, all death in the 5th day, survival rate 0.Injection deformation pseudomonadfliAThe Larimichthys crocea of silent mutation strain goes out on the 6th day
Existing death no longer occurs dead, 30% (Fig. 1) of survival rate rising on the 10th day.Fish of the injection containing deformation pseudomonad wild strain
A large amount of white tubercles are observed in spleen on day 3, show symptom identical with natural disease, and reach identical phenotype disease
Shape, injection deformation pseudomonadfliAThe spleen of the fish of silent mutation strain need in the 7th talent it is observed that.Inject the fish of PBS
White dirt (Fig. 2) is not observed in spleen.
Acquisition deformation pseudomonad wild strain andfliA1,2,3,4th day Larimichthys crocea after-RNAi silent mutation strain infection
Spleen, liver, blood, body kidney, are respectively organized into powdery with liquid nitrogen grinding, weigh 30mg and organize powder, with Quan Shijin marine animal
Tissue DNA extracts kit extracts DNA.With qRT-PCR method detect deformation pseudomonad wild strain andfliA- RNAi silent mutation
Carrying capacity of the strain in Larimichthys crocea.gyrBGene is the single copy identification gene of specificity for deforming pseudomonad, specific upstream
Primer sequence (5 ' -3 '): TGCTGAAGGACGAGCGTTCG；Downstream primer sequence (5 ' -3 '):
ATCATCTTGCCGACAACAGC.Prepare the standard curve of gyrB gene, and with Synergy H1 global function micropore board detector
Measure 1 each gradient of μ lgyrBPCR product concentration.With the deformation pseudomonad wild strain at each time point andfliA- RNAi silencing
Each tissue DNA of the Larimichthys crocea of mutant infection is template,gyrBThe property identified primer is primer, carries out qRT-PCR experiment.
When data processing, calculating abscissa first is that the XY curve that Ct value ordinate is copy number needs in this step
By each gradient measuredgyrBThe concentration of gene PCR product is converted into copies, and calculation formula is:.Wherein 1mol=6.02*1023Copy number；DNA
Concentration * 10-9Afterwards, unit becomes g/ μ l；520*660 is the dalton number of double-stranded DNA, wherein 520 aregyrBThe production of gene magnification
Object length, unit are bases, and 660 be double-stranded DNA constant, and unit is dalton/base, 1 dalton=1g/mol.Because of measurement
1 μ l when concentration, thus obtain the result is that copies, XY curve can be calculated according to the Ct value of copies and each concentration.So
The copy number at each time point is calculated according to the Ct value at each time point afterwards.WithfliAEach time point each group of-RNAi silent mutation strain
The copy number knitted obtains ratio divided by the copy number in wild strain.
Fig. 3 shows the dynamic change of carrying capacity in infection different time different tissues.Each time point after infection, rheum officinale
Spleen, body kidney, blood in fish and the deformation pseudomonad in liverfliA- RNAi bacterial strain carrying capacity is significantly lower than wild strain.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>Collects The American University
<120>one plants of deformation pseudomonad fliA gene silencing bacterial strains
<130> 7
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 720
<212> DNA
<213>artificial sequence
<400> 1
ttggtcgctt acggtccaga tccccgcgac gctttgtcgc ccccattgtt gccaggcgcc 60
gagcagcgtt ggttgatgga ctacctaccg ctggtcaagc gcattgtcaa tcagctatcg 120
atacaggcca gccaagtcct cgaccgtgac gacatggagc agattggctt gatggggctg 180
ctcgaggggc tgcgtcgcta tggcgtgccc gatgagcagt ttgcccggtt tgccgcgatg 240
cgcattcgtg gggccattct cgacgagctg cgtcggcagg actggcgtcc acggcggctg 300
cggcaacagg cgcacaaggt ccgcgacgca gtacgccagc tcagtcgcag attaggccgc 360
cagcctaagg atgtagaggt gctcgaggcc accggcttga accatgcgca gtaccagtcc 420
tatctgcaag ccgaggcggc ggaagccatc gaaagcctcg atacactgct cctggatccc 480
gatcgagggt ttcttcagag cggtaccagt gttgaggacc tggtacttgg cgagcgtttg 540
ttggcgcagg cgctggacca tctcgatgag cgcgagcgtt tggtgctgac gctgtactac 600
cagcatgaac tgaatcttaa agaaattggc ctggtgctga acgtcagtga cgcccgggtc 660
tgtcagttga gtaagcaggc catcgaaaag gcttgtgctt gtctaaccaa gagtaactga 720
<210> 2
<211> 59
<212> DNA
<213>artificial sequence
<400> 2
tggtcaagcg cattgtcaat cattcaagag atgattgaca atgcgcttga ccttttttt 59
<210> 3
<211> 67
<212> DNA
<213>artificial sequence
<400> 3
gtacaaaaaa aggtcaagcg cattgtcaat catctcttga atgattgaca atgcgcttga 60
ccatgca 67
<210> 4
<211> 23
<212> DNA
<213>artificial sequence
<400> 4
cgagggtttc ttcagagcgg tac 23
<210> 5
<211> 24
<212> DNA
<213>artificial sequence
<400> 5
gcaccaggcc aatttcttta agat 24
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
tgctgaagga cgagcgttcg 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
atcatcttgc cgacaacagc 20
Claims (4)
1. one plant of deformation pseudomonadfliAGene silencing bacterial strain, it is characterised in that: the bacterial strain isPseudomonas plecoglossicida fliA- RNAi, on November 12nd, 2018 in China typical culture collection center preservation, preservation
Number be CCTCC NO:M 2018770.
2. one plant of deformation pseudomonad as described in claim 1fliAThe construction method of gene silencing bacterial strain, it is characterised in that:
(1): by comparing analysis deformation pseudomonas infection host interaction transcript profile data, screening expression quantity in course of infection
It improvesfliAGene；
(2): synthesis shRNA is connected into pCM130/tac carrier after annealing, turn technological sourcing by electricity and deform pseudomonad competence
Cell, building deformation pseudomonadfliAGene silencing mutant strain；It using QPCR technology, tests to silencing efficiency, finally
Obtain building deformation pseudomonadfliAGene silencing mutant strain.
3. one plant of deformation pseudomonad according to claim 1fliAThe construction method of gene silencing bacterial strain, feature exist
In: it is describedfliAGene order is as shown in SEQ ID NO.1.
4. one plant of deformation pseudomonad as described in claim 1fliAGene silencing bacterial strain prevents and treats fish in preparation
Application in internal organ ichthyophthirius preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910013458.3A CN109706105B (en) | 2019-01-07 | 2019-01-07 | Pseudomonas proteorum fliA gene silencing strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910013458.3A CN109706105B (en) | 2019-01-07 | 2019-01-07 | Pseudomonas proteorum fliA gene silencing strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706105A true CN109706105A (en) | 2019-05-03 |
| CN109706105B CN109706105B (en) | 2020-11-06 |
Family
ID=66260893
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910013458.3A Expired - Fee Related CN109706105B (en) | 2019-01-07 | 2019-01-07 | Pseudomonas proteorum fliA gene silencing strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706105B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112625996A (en) * | 2021-02-04 | 2021-04-09 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN112662608A (en) * | 2021-02-04 | 2021-04-16 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN113151134A (en) * | 2021-05-12 | 2021-07-23 | 集美大学 | Pseudomonas proteorum fliG gene silencing strain and application thereof |
| CN113528407A (en) * | 2021-05-31 | 2021-10-22 | 集美大学 | Pseudomonas proteorutonB gene silencing strain and application thereof |
| CN114703115A (en) * | 2022-04-22 | 2022-07-05 | 集美大学 | Pseudomonas proteus fliS gene silencing strain and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753998A (en) * | 2018-05-23 | 2018-11-06 | 浙江大学 | The application of flagellum two level controlling gene fliA or its expression product as target spot in antibacterials exploitation |
-
2019
- 2019-01-07 CN CN201910013458.3A patent/CN109706105B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753998A (en) * | 2018-05-23 | 2018-11-06 | 浙江大学 | The application of flagellum two level controlling gene fliA or its expression product as target spot in antibacterials exploitation |
Non-Patent Citations (6)
| Title |
|---|
| HUANG L等: "Genome Sequence of Pseudomonas plecoglossicida Strain NZBD9.", 《恶》 * |
| LO YL等: "Characterization of the role of global regulator FliA in the pathophysiology of Pseudomonas aeruginosa infection.", 《RES MICROBIOL.》 * |
| RODRÍGUEZ-HERVA JJ等: "Physiological and transcriptomic characterization of a fliA mutant of Pseudomonas putida KT2440.", 《ENVIRON MICROBIOL REP.》 * |
| YUJIA SUN等: "Dual RNA-Seq Unveils the Role of the Pseudomonas plecoglossicida fliA Gene in Pathogen-Host Interaction with Larimichthys crocea", 《MICROORGANISMS. 》 * |
| 王雨舟: "恶臭假单胞菌KT2442鞭毛关键调控基因对菌株生物学特性的影响", 《中国优秀硕士学位论文全文数据库》 * |
| 胡娇等: "大黄鱼(Pseudosciaena crocea)内脏白点病病原分离鉴定及致病性研究", 《海洋与湖沼》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112625996A (en) * | 2021-02-04 | 2021-04-09 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN112662608A (en) * | 2021-02-04 | 2021-04-16 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN112662608B (en) * | 2021-02-04 | 2022-06-10 | 集美大学 | Pseudomonas proteorexabB gene stable silencing strain and application thereof |
| CN112625996B (en) * | 2021-02-04 | 2022-06-10 | 集美大学 | Pseudomonas proteorum znuA gene stable silencing strain and application thereof |
| CN113151134A (en) * | 2021-05-12 | 2021-07-23 | 集美大学 | Pseudomonas proteorum fliG gene silencing strain and application thereof |
| CN113151134B (en) * | 2021-05-12 | 2023-09-12 | 集美大学 | Pseudomonas proteus fliG gene silencing strain and application thereof |
| CN113528407A (en) * | 2021-05-31 | 2021-10-22 | 集美大学 | Pseudomonas proteorutonB gene silencing strain and application thereof |
| CN113528407B (en) * | 2021-05-31 | 2023-01-10 | 集美大学 | Pseudomonas proteorutonB gene silencing strain and application thereof |
| CN114703115A (en) * | 2022-04-22 | 2022-07-05 | 集美大学 | Pseudomonas proteus fliS gene silencing strain and application |
| CN114703115B (en) * | 2022-04-22 | 2023-09-29 | 集美大学 | Pseudomonas proteus fliS gene silencing strain and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706105B (en) | 2020-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109706105A (en) | One plant of deformation pseudomonad fliA gene silencing bacterial strain | |
| Vélez et al. | Functional analysis of D-alanylation of lipoteichoic acid in the probiotic strain Lactobacillus rhamnosus GG | |
| Li et al. | Comparative genomics of 84 Pectobacterium genomes reveals the variations related to a pathogenic lifestyle | |
| Bécavin et al. | Comparison of widely used Listeria monocytogenes strains EGD, 10403S, and EGD-e highlights genomic differences underlying variations in pathogenicity | |
| Pretzer et al. | Biodiversity-based identification and functional characterization of the mannose-specific adhesin of Lactobacillus plantarum | |
| Ferrari et al. | Loss of mitochondrial functions associated with azole resistance in Candida glabrata results in enhanced virulence in mice | |
| Bobik et al. | FixJ: a major regulator of the oxygen limitation response and late symbiotic functions of Sinorhizobium meliloti | |
| Alexandraki et al. | Comparative genomics of Streptococcus thermophilus support important traits concerning the evolution, biology and technological properties of the species | |
| McAllister et al. | Ruminant nutrition symposium: use of genomics and transcriptomics to identify strategies to lower ruminal methanogenesis | |
| Chiang et al. | Phenotypic diversity caused by differential RpoS activity among environmental Escherichia coli isolates | |
| Liu et al. | In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing | |
| Dai et al. | Regulation of Francisella tularensis virulence | |
| CN108026536A (en) | Use the method for CRISPR nucleic acid screening bacterium, archeobacteria, algae and yeast | |
| Boccazzi et al. | Generation of dominant selectable markers for resistance to pseudomonic acid by cloning and mutagenesis of the ileS gene from the archaeon Methanosarcina barkeri Fusaro | |
| CN110055200B (en) | Pseudomonas proteorclpV gene silencing strain | |
| Patil et al. | Complete genome sequence of Lactobacillus plantarum strain JDARSH, isolated from sheep milk | |
| Yu et al. | The thiG gene is required for full virulence of Xanthomonas oryzae pv. oryzae by preventing cell aggregation | |
| Di Ciccio et al. | Biofilm formation and genomic features of Listeria monocytogenes strains isolated from meat and dairy industries located in Piedmont (Italy) | |
| Jeon | The large, free‐living amoebae: wonderful cells for biological studies | |
| Park et al. | Comparison of pH and bile resistance of Lactobacillus acidophilus strains isolated from rat, pig, chicken, and human sources | |
| Guan et al. | The mitochondrial protein Mcu1 plays important roles in carbon source utilization, filamentation, and virulence in Candida albicans | |
| Farlow et al. | Comparative whole genome analysis of six diagnostic brucellaphages | |
| Peng et al. | Whole genome and acid stress comparative transcriptome analysis of Lactiplantibacillus plantarum ZDY2013 | |
| Moisi et al. | Characterizing the hexose-6-phosphate transport system of Vibrio cholerae, a utilization system for carbon and phosphate sources | |
| Takemura et al. | The transcription regulator ChpA affects the global transcriptome including quorum sensing‐dependent genes in Ralstonia pseudosolanacearum strain OE1‐1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201106 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |