CN109701021B - Blocking agent for inhibiting porcine reproductive and respiratory syndrome virus infection - Google Patents

Abstract

The invention discloses a blocker for inhibiting Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) infection, finds a novel PRRSV cell target protein, namely SRCAP protein, and finds an inhibition target of the receptor. The interference of SRCAP genes at the inhibition target points or the gamma-secretase inhibitor of the Notch signal pathway which plays a key role in SRCAP protein can obviously reduce the PRRSV infection, and the inhibition target points and the gamma-secretase inhibitor can be developed into a medicament for preventing and treating the PRRSV infection, so that a brand new thought is provided for the research and the prevention of PRRS, the research range is expanded, and the important significance is realized on the actual production.

Description

Blocking agent for inhibiting porcine reproductive and respiratory syndrome virus infection

Technical Field

The invention relates to the technical field of biology, in particular to a blocking agent for inhibiting porcine reproductive and respiratory syndrome virus infection.

Background

Porcine Reproductive and Respiratory Syndrome (PRRS), also known as Porcine reproductive and respiratory syndrome, is an acute infectious disease caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). The disease is mainly characterized by sow breeding disorder and piglet dyspnea, which causes huge economic loss to the pig industry. The PRRSV has high variability, the virus is firstly isolated in 1996 in China, highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) appears after 10 years, and NADC 30-like PRRSV appears in 2013. Since the appearance of the NADC 30-like PRRSV, a new variant strain formed by recombining the strain and the HP-PRRSV continuously appears, the variant strain not only changes on a genome, but also changes in the aspects of virulence, induced immune response of organisms and the like, so that the immune protection of the existing vaccine on the variant strain is weakened, and the PRRS is continuously outbreak and epidemic, therefore, a medicament or an effective vaccine with treatment effect on both the HP-PRRSV and the LP-PRRSV is urgently needed to be found.

Disclosure of Invention

The invention discovers for the first time that PRRSV infection can activate a Notch signal pathway and promote virus infection. The cellular protein SNF2related CBP activator protein (SRCAP) can participate in the life cycle process of PRRSV, and after the SRCAP is knocked down, activation of a Notch signal pathway can be inhibited, and infection of the PRRSV can be obviously reduced. The invention also discovers that the inhibitor gamma-secretase inhibitor of the Notch signal pathway can obviously reduce PRRSV infection. Based on this, the invention proposes the following solutions:

in a first aspect of the invention, there is provided the use of SRCAP protein as a target protein of PRRSV in the preparation of a blocking agent for inhibiting highly and lowly pathogenic porcine reproductive and respiratory syndrome viral infection.

In particular, the SRCAP protein is a target protein that affects PRRSV replication.

In a second aspect of the present invention, there is provided the use of a gene encoding an SRCAP protein as a target in the preparation of a blocking agent for inhibiting high-and low-pathogenicity porcine reproductive and respiratory syndrome viral infection.

Preferably, the sequence of the gene coding the SRCAP protein is shown as SEQ ID NO.1, and specifically comprises the following steps: AAGGGGAGGTGGATGGAAACGATTGAAGTTGAATTTTGGCTCGAGAAGGTGAGCTTTCCATGGAGGAGCTATTGCAGCAGTATGCAGGAGCCTATGCC...AGATGAAGAGGAGGAAGATGATGATTTTGGGGTGGAGTACTTGCTTGCCAGGGATGAAGAGCAGAGTGAGGCAGGCTCGAGAAGGTGAGCTTTTTCTCCAGGGCCCACTACTCTAGGTCCAAAGAAAGAAATTACTGACATTGCTGCAGCAGCTGAAAGTCTCCAGCCCAAGGGT...AACTGGGAGATGGAGTTGAAACGGTGGTGCCCCAGCTTTAAAATCCTCACTTACTATGGAGCCCAGACCCACTACTCTAGGTC CAATTAGGGCTGGACCAAGCCCAATGCCTTTCATGTGTGTATCACATCTTACAAGCTGGTGCTGCAGGACCACCAGGCCT...TCCTGCGCAGCAGCGCCCCTCCCTCCCTGGCTGGCCCTGCTGTTAGTCACAGAGGCCGCAAGGCCAAGACGTGA。(SEQ ID NO.1)。

In a third aspect of the invention, there is provided the use of a Notch signaling pathway inhibitor in the preparation of a blocker for inhibiting high and low pathogenicity porcine reproductive and respiratory syndrome viral infection.

In the Notch signaling pathway, SRCAP protein plays a key role and can regulate and control the transcription of related genes in the Notch signaling pathway.

Preferably, the Notch signaling pathway inhibitor is a gamma-secretase inhibitor.

In a fourth aspect of the present invention, there is provided a use of a substance according to any one of the following (a) to (c) for preparing a blocking agent for inhibiting high-and low-pathogenic porcine reproductive and respiratory syndrome virus infection:

(a) an inhibitor of SRCAP protein activity;

(b) the transcription product of the DNA segment can reduce the expression of the gene shown in SEQ ID NO. 1;

(c) a DNA fragment, the translation product of which can down-regulate the expression of the gene shown in SEQ ID NO. 1.

In a fifth aspect of the present invention, there is provided an siRNA, which is any one of the following (1) to (3):

(1) siRNA, wherein a sense strand is shown as SEQ ID NO.2, and an antisense strand is shown as SEQ ID NO. 3;

(2) siRNA, wherein a sense strand is shown as SEQ ID NO.4, and an antisense strand is shown as SEQ ID NO. 5;

(3) the sense strand of the siRNA is shown as SEQ ID NO.6, and the antisense strand is shown as SEQ ID NO. 7.

In a sixth aspect of the invention, the siRNA is used for reducing the transcription of the gene coding the SRCAP protein and/or reducing the expression of the SRCAP protein.

The seventh aspect of the invention provides the application of the siRNA in preparing a blocking agent for inhibiting high-pathogenicity and low-pathogenicity porcine reproductive and respiratory syndrome virus infection.

According to an eighth aspect of the present invention, there is provided a blocking agent for inhibiting high-pathogenicity and low-pathogenicity porcine reproductive and respiratory syndrome virus infection, wherein the blocking agent comprises the above Notch signaling pathway inhibitor and/or siRNA.

The ninth aspect of the invention provides the application of the blocking agent in preparing the medicine for preventing and treating the high-pathogenicity and low-pathogenicity porcine reproductive and respiratory syndrome virus infection.

The invention has the beneficial effects that:

the invention discovers a new PRRSV cell target protein, namely SRCAP protein, finds an inhibition target of the receptor, and the SRCAP protein can participate in the infection of the PRRSV, so that the SRCAP protein can interfere the SRCAP gene or protein expression, or a Notch signal pathway inhibitor gamma-secretase inhibitor playing a key role by utilizing the SRCAP protein can obviously reduce the PRRSV infected cells, has obvious inhibition activity on HP-PRRSV and LP-PRRSV, and can be developed into a medicament for preventing and treating the high-pathogenicity and low-pathogenicity porcine reproductive and respiratory syndrome virus infection, thereby providing a brand new thought for the research and control of the PRRS, expanding the research range and having very important significance for the actual production.

Drawings

FIG. 1: western blot (A) of interaction of NSP4 protein and SRCAP protein on 293T cells and laser confocal (B) detection results of co-localization relationship of NSP4 protein and SRCAP protein on 293T cells and Marc-145 cells.

FIG. 2: the SRCAP siRNA silencing effect is detected by Real-time PCR on Marc-145 cells and PAM (A), and the influence on PRRSV infection is detected after SRCAP silencing is detected by Real-time PCR and Western blot (B).

FIG. 3: real-time PCR on PAM cells detects SRCAP siRNA silencing effect (A) and its effect on PRRSV infection (B).

FIG. 4: effect of gamma-secretase inhibitors on Marc-145 cell and PAM toxicity (A, C) and on PRRSV infection real-time PCR (B, D) results.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As introduced in the background art, PRRSV has high variability, and variant strains not only change on genome, but also change in aspects of virulence and induced immune response of organisms, so that the cross immune protection of highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) and low pathogenic porcine reproductive and respiratory syndrome virus (LP-PRRSV) is low, the existing vaccines and medicaments are difficult to realize the simultaneous blocking of HP-PRRSV and LP-PRRSV infection, and great difficulty is brought to the prevention and treatment of epidemic situation mainly caused by HP-PRRSV and LP-PRRSV epidemic behaviors clinically at present.

NSP4 of PRRSV is a 3C-like serine protease, which can cleave virus-encoded polyprotein into 10 nonstructural proteins NSP3 to NSP12, and participate in the proliferation of PRRSV. NSP4 is relatively conserved among different strains, with approximately 100% homology at the amino acid level of NSP4 for HP-PRRSV and LP-PPRSV, and 96.1% homology at the amino acid level of NSP4 for NADC 30-like viruses. Based on the role and relative conservation of NSP4 in PRRSV infection, the proteomics of NSP4 is researched by using a mass spectrometry analysis technology, and the fact that the SNF2related CBP activator protein (SRCAP) of the cellular protein SNF2 can interact with NSP4 is found. However, NSP4 specifically binds to which partial domain of SRCAP and a specific binding site; the specific action and mechanism of the combination of SRCAP and NSP4 in the PRRSV infection process, and the problem of how the SRCAP affects PRRSV virus infection are not clear.

While the SRCAP protein contains 3230 amino acids, and the large molecular weight protein with the molecular weight of about 350KDa has very complex structural domains, and the current situation that commercial effector proteins with good quality for resisting SRCAP and Notch signal pathways are lacked is shown as follows: antibodies against proteins such as HES and hey, it is difficult to identify the specific site of interaction between NSP4 and SRCAP in a short time. Although the mRNA level changes of these target genes can be detected, the mRNA level changes can only reflect the regulation situation laterally, so that the research on the regulation effect of SRCAP on the pathway has certain difficulty. SRCAP is a transcriptional activator and is also a member of the ATP-dependent INO80 chromatin remodeling family, belonging to the SNF2 family of atpase 2. Representative SNF2 chromatin remodelling family members include INO80, SWI/SNF, ISWI (SWI-mimicking) and CHD (chromosomal domain helicase DNA binding). The inventor of the application discovers for the first time that the SRCAP protein can be used as a target protein influencing the replication of the PRRSV, and the siRNA of the cell protein SRCAP and a Notch signal pathway blocker which plays an important role in the SRCAP can block the infection of the PRRSV.

The above virus receptor (target protein) and Notch signal pathway blocker are directed against HP-PRRSV (representing strain TA-12, GenBank accession number HQ416720) and LP-PRRSV (representing strain CH-1a, GenBank accession number AY 032626.1). The inhibitor mainly inhibits PRRSV infected cells. Experiments prove that SRCAP siRNA and a gamma-secretase inhibitor (purchased from MCE company, the cargo number: HY-50752) which is a Notch signal pathway blocker playing an important role in SRCAP can be stably used as a blocking agent of PRRSV infected cells, and the application of the inhibitor has not been seen in previous researches.

The specific separation and identification process of the virus target cell protein SRCAP protein is as follows:

according to the SRCAP (GenBank accession numbers: NM-006662.3 and XM-005653006.3) gene sequences published by NCBI, the siRNA gene silencing site sequences at 1285, 1694 and 2108 of SRCAP (monkey) are designed, and the siRNA gene silencing site sequences at 1736 and 7756 of SRCAP (Swine) and a negative control sequence (see table 1; the sites are the initial sites of sense sequences). In Marc-145 and PAM transfected by mixed synthetic siRNA, the expression of the mRNA can be obviously reduced after SRCAP gene silencing, and the result of fluorescence quantification shows that the SRCAP (monkey) siRNA knockdown efficiency and the SRCAP (Swine) siRNA knockdown efficiency are 72% and 53% respectively (see figure 2A). In order to further verify the important role of the SRCAP protein in the HP-PRRSV and LP-PRRSV infection process, HP-PRRSV and LP-PRRSV viruses are inoculated after the SRCAP gene is silenced, samples are collected at different time points, and the virus copy number is detected by using real-time PCR, so that the HP-PRRSV and LP-PRRSV infection can be obviously reduced after the SRCAP gene is silenced. The virus copy number of the HP-PRRSV control group is respectively 62 times, 714 times, 4308 times and 517 times of that of the silencing group at 6h, 12h, 24h and 36h after infection; the virus copy number of the LP-PRRSV control group was 5.4, 4.8, 13.3, 2.9 fold higher than that of the silent group, respectively (see fig. 2B). Western blot analysis also found that the silencing of SRCAP gene significantly reduced the infection of HP-PRRSV and LP-PRRSV (see FIG. 2B).

To further verify the role of SRCAP in the infection process of HP-PRRSV and LP-PRRSV, siRNA transfection in porcine lung macrophage (PAM) reduced the expression of SRCAP, and as a result, it was found that the infection of HP-PRRSV and LP-PRRSV was also significantly reduced (see FIG. 3A, B)

SRCAP is an important transcription activator in a Notch signaling pathway and plays an important role in the process of activating the Notch signaling pathway, a gamma-secretase inhibitor is a Notch signaling pathway specific inhibitor, the toxicity effect of the gamma-secretase inhibitor on Marc-145 cells and PAM is determined by a CCK-8 method, and the result shows that the inhibitor has small toxicity on the Marc-145 cells and the PAM (see figure 4A, C). The gamma-secretase inhibitor is added to the inoculated Marc-145 cells and PAM to influence PRRSV infection, and the Real-time PCR detection result shows that 24 mu g/ml of the gamma-secretase inhibitor can obviously reduce the copy number of PRRSV on the Marc-145 cells and PAM (see figures 4B and 4D).

Through the research, a new PRRSV cell target protein is discovered, and an inhibitory target of PRRSV is found. The site of SRCAP gene is interfered, or a Notch signal pathway inhibitor gamma-secretase inhibitor which plays a key role in SRCAP protein can have obvious inhibitory activity to PRRSV infected cells, and can be developed into a medicament for preventing and treating PRRSV infection, thereby providing a brand new thought for PRRS research and prevention, enlarging the research range and having very important significance for practical production.

RNA interference is a gene silencing phenomenon caused by double-stranded RNA, and is widely applied to the aspects of researching gene functions, screening drug targets, treating diseases and the like. siRNA design is an effective way for realizing RNA interference, and the quality of siRNA design directly influences the effect of RNA interference. The existing siRNA design method is mainly based on sequence characteristics, and the influence of a target structure on the siRNA interference efficiency is not considered, so that the designed siRNA sequence has low interference efficiency; moreover, the accuracy of predicting the interference efficiency of the candidate siRNA is not high, so that the number of the candidate siRNA is excessive, and great difficulty is brought to biological experiments; in addition, siRNA has off-target effect, so the design of siRNA is difficult. The invention is based on the sequence characteristics of SRCAP gene and comprehensively considers the structural characteristics of SRCAP protein; when the siRNA interference efficiency is predicted, the siRNA self characteristics are considered, the mRNA global characteristics and the local characteristics near a target point are also considered, and further, the SRCAP 1285 th, 1694 th and 2108 th siRNA gene silencing site sequences are designed, and the specific details are as follows:

SRCAP-1285：

sense sequence: GGAAACGAUUGAAGUUGAATT, respectively; (SEQ ID NO.2)

Antisense sequence: UUCAACUUCAAUCGUUUCCTT are provided. (SEQ ID NO.3)

SRCAP-1694:

Sense sequence: GCUCGAGAAGGUGAGCUUUTT, respectively; (SEQ ID NO.4)

Antisense sequence: AAAGCUCACCUUCUCGAGCTT are provided. (SEQ ID NO.5)

SRCAP-2108:

Sense sequence: CCCACUACUCUAGGUCCAATT, respectively; (SEQ ID NO.6)

Antisense sequence: UUGGACCUAGAGUAGUGGGTT are provided. (SEQ ID NO.7)

The siRNA obtained by the design has excellent interference effect and has obvious effect of inhibiting HP-PRRSV and LP-PRRSV infection.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention are all conventional in the art and commercially available. The experimental procedures, for which no detailed conditions are indicated, were carried out according to the usual experimental procedures or according to the instructions recommended by the supplier.

Example 1: determination of SRCAP protein interacting with PRRSV nonstructural protein NSP4

SRCAP is a transcription activating factor of a Notch signal pathway, can regulate and control the transcription of a Notch signal pathway effector gene, and also belongs to ATP-dependent chromatin remodeling enzyme of IN080 family, the PRRSV non-structural protein NSP4 gene is connected to a eukaryotic expression vector at the early stage and is expressed IN 293T cells, cell proteins possibly interacting with NSP4 are collected through GFP-Trap agarose beads, the interaction between the cell proteins SRCAP and NSP4 is found through mass spectrometry and Western blot verification (see figure 1A), and the co-localization phenomenon between the cell proteins SRCAP and NSP4 is also observed through a confocal microscope (see figure 1B).

Example 2: identification of Marc-145 cells involved in PRRSV infection of SRCAP

To further study the involvement of SRCAP in PRRSV infection, siRNA to SRCAP was designed based on mass spectrometry results and, after reducing its expression, the effect on HP-PRRSV and LP-PRRSV infection was analyzed.

According to the SRCAP gene sequence (GenBank accession number: NM-006662.3) published by NCBI, the siRNA gene silencing site sequences at 1285, 1694 and 2108 of SRCAP (monkey) and siRNA gene silencing site sequences at 1736 and 7756 of SRCAP (Swine) and a negative control sequence (see Table 1) are designed by using the primer design software of premier 6.0. After sequence design, the DNA fragment was sent to Shanghai Jima pharmaceutical technology Co., Ltd for synthesis, the synthetic sequence was diluted to 1. mu.M with DEPC water and dispensed into a 1.5mL centrifuge tube without RNase, and the tube was stored at-20 ℃.

Marc-145 cells in good condition were selected at 1.5X 10⁵The cells were plated in 6-well plates at a density of one/mL, and transfected with siRNA at a cell density of about 70%. According to

RNAIMAX Reagent instructions, 25. mu.M of siRNA per well were transfected separately, mixed and incubated at 37 ℃ in a 5% CO2 incubator for 24 h. Discard the old cell culture medium, wash the cells with pre-cooled PBS, blow all cells down with a pipette gun, transfer to a new centrifuge tube, centrifuge at 2000rpm for 3min, discard the supernatant, leave the precipitate. Western blot analysis was performed by lysing cells with cell lysate to collect proteins, and simultaneously, cellular RNA was extracted and reverse transcribed for fluorescent quantitative PCR analysis (primers used in fluorescent quantitative PCR are shown in Table 1).

The results of fluorescence quantification showed 72% and 53% for SRCAP (monkey) siRNA and SRCAP (Swine) siRNA knockdown efficiency, respectively (see FIG. 2A). In order to further verify that the SRCAP protein plays an important role in the infection process of the HP-PRRSV and the LP-PRRSV, the HP-PRRSV and the LP-PRRSV are inoculated after the SRCAP gene is silenced, samples are collected at different time points, the copy number of the PRRSV is detected by using real-time PCR, and the result shows that the HP-PRRSV infection can be obviously reduced after the SRCAP gene is silenced. The virus copy number of the HP-PRRSV control group is respectively 62 times, 714 times, 4308 times and 517 times of that of the silencing group at 6h, 12h, 24h and 36h after infection; the virus copy number of the LP-PRRSV control group was 5.4, 4.8, 13.3, 2.9 fold higher than that of the silent group, respectively (see fig. 2B). Western blot analysis also found that the HP-PRRSV infection was significantly reduced after SRCAP gene silencing (see FIG. 2B).

Table 1:

note: in Table 1, N.C represents a negative control sequence. The invention uses Marc-145 cell line and PAM, Marc-145 cell line is PRRSV susceptible cell line, which comes from monkey kidney epithelial cell, PAM is primary pig lung macrophage, the two cell lines are used for detecting GAPDH primer sequences are different, respectively listed. The SRCAP gene sequence is found to be a common conserved sequence of the pig and the monkey, and is the same primer sequence.

Example 3: knockdown of SRCAP on PAM and its effect on HP-PRRSV and LP-PRRSV infection

To further validate the results, primary porcine lung macrophages (PAMs) were taken for validation. Bloodletting a 50-day-old SPF piglet, ligating trachea, aseptically picking lung, washing outer surface with autoclaved PBS (1640 culture medium containing 1/25 volumes of PBS and 5 Xdouble antibody), pouring 30.0-50 ml of PBS (pH7.2) into lung from trachea, lightly tapping lung surface, recovering lavage liquid after 1-2min, and repeating the steps until the lavage liquid is clear. And (3) lightly blowing and beating the recovered bronchoalveolar lavage fluid by using a straw, scattering cell masses, filtering by using a single-layer sterile 100-mesh stainless steel sieve, collecting all the lavage fluid, centrifuging at 1500r/min for 5-10min, and collecting precipitates. Washed twice with PBS containing 5 × double antibody, gently mixed each time, and centrifuged. Then adding a proper amount of 1 XRPMI 1640 (containing 2 Xdouble antibody) nutrient solution containing 10% fetal calf serum to blow off cells, placing the cells in a culture bottle or a culture dish to culture at 37 ℃ in a 5% CO2 culture box, removing supernatant and non-adhesive cells after the cells adhere to the wall, and continuing culturing the cells by using the 1 XRPMI 1640 culture solution containing 10% fetal calf serum for later use. Mixed sirnas (i.e., a mixture of SRCAP-1285, SRCAP-1694, and SRCAP-2108) silenced SRCAP (fig. 3A) were transfected into PAM cells, and the effect on HP-PRRSV and LP-PRRSV infection was detected by real-time PCR, which resulted in the finding that the copy number of HP-PRRSV in the control group was 3.0, 8.0, 6.1, 13.8 fold at 6h, 12h, 24h, and 36h post-infection, respectively; the copy number of the control group LP-PRRSV was 18.2, 5.0, 26.3, 5.5 times greater, respectively (FIG. 3B).

Example 4: blocking experiment of Notch signaling pathway inhibitor gamma-secretase inhibitor on HP-PRRSV and LP-PRRSV infection

Notch signaling affects many processes of normal morphogenesis of cells, including differentiation of pluripotent progenitor cells, apoptosis, cell proliferation, and formation of cell boundaries. Meanwhile, the cellular protein SRCAP plays an important role in the Notch signaling pathway as a transcription activator important in the Notch signaling pathway. In a Notch signal pathway, the gamma-secretase inhibitor can effectively inhibit the gamma-secretase from cutting a Notch ligand receptor complex, and inhibit the activity of SRCAP as a transcriptional activator of the Notch signal pathway, thereby inhibiting the replication of PRRSV in cells.

The toxicity of gamma-secretase inhibitors on Marc-145 and PAM was first verified by the CCK-8 method, and it was found that the optimal dosage for Marc-145 cells was 24. mu.g/ml and 36. mu.g/ml for PAM (see A, C in FIG. 4).

Adding 24 mu g/ml and 36 mu g/ml gamma-secretase inhibitor into a culture medium on a single layer of Marc-145 and PAM cells for culturing for 24h, then, inducing HP-PRRSV and LP-PRRSV with 0.1MOI for 1h, changing the HP-PRRSV and LP-PRRSV into a cell maintenance solution containing 5%, collecting the cells after 24h, and extracting RNA for Real-time PCR analysis. The result shows that the infection of HP-PRRSV and LP-PRRSV can be obviously reduced under the action of 50um/ml gamma-secretase inhibitor. (FIG. 4B) the effect of gamma-secretase inhibitors on PAM also significantly reduced infection by HP-PRRSV and LP-PRRSV (FIG. 4D).

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong university of agriculture

<120> a blocker for inhibiting porcine reproductive and respiratory syndrome virus infection

<130> 2019

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 530

<212> DNA

<213> Gene encoding SRCAP protein

<400> 1

atgcagagca gcccctcccc aaggggaggt ggatggaaac gattgaagtt gaattttggc 60

tcgagaaggt gagctttcca tggaggagct attgcagcag tatgcaggag cctatgccag 120

atgaagagga ggaagatgat gattttgggg tggagtactt gcttgccagg gatgaagagc 180

agagtgaggc aggctcgaga aggtgagctt tttctccagg gcccactact ctaggtccaa 240

agaaagaaat tactgacatt gctgcagcag ctgaaagtct ccagcccaag ggtaactggg 300

agatggagtt gaaacggtgg tgccccagct ttaaaatcct cacttactat ggagcccaga 360

cccactactc taggtccaat tagggctgga ccaagcccaa tgcctttcat gtgtgtatca 420

catcttacaa gctggtgctg caggaccacc aggccttcct gcgcagcagc gcccctccct 480

ccctggctgg ccctgctgtt agtcacagag gccgcaaggc caagacgtga 530

<210> 2

<211> 21

<212> SiRNA

<213> SRCAP-1285

<400> 2

ggaaacgauu gaaguugaat t 21

<210> 3

<211> 21

<212> SiRNA

<213> SRCAP-1285

<400> 3

uucaacuuca aucguuucct t 21

<210> 4

<211> 21

<212> SiRNA

<213> SRCAP-1694

<400> 4

gcucgagaag gugagcuuut t 21

<210> 5

<211> 21

<212> SiRNA

<213> SRCAP-1694

<400> 5

aaagcucacc uucucgagct t 21

<210> 6

<211> 21

<212> SiRNA

<213> SRCAP-2108

<400> 6

cccacuacuc uagguccaat t 21

<210> 7

<211> 21

<212> SiRNA

<213> SRCAP-2108

<400> 7

uuggaccuag aguagugggt t 21

<210> 8

<211> 21

<212> SiRNA

<213> SRCAP-1736(swine)

<400> 8

ccaccacucu agguccuaat t 21

<210> 9

<211> 21

<212> SiRNA

<213> SRCAP-1736(swine)

<400> 9

uuaggaccua gagugguggt t 21

<210> 10

<211> 21

<212> SiRNA

<213> SRCAP-7756(swine)

<400> 10

gcuguugaga uccugccuat t 21

<210> 11

<211> 21

<212> SiRNA

<213> SRCAP-7756(swine)

<400> 11

uaggcaggau cucaacagct t 21

<210> 12

<211> 21

<212> SiRNA

<213> N.C

<400> 12

uucuccgaac gugucacgut t 21

<210> 13

<211> 21

<212> SiRNA

<213> N.C

<400> 13

acgugacacg uucggagaat t 21

<210> 14

<211> 20

<212> DNA

<213> SRCAP

<400> 14

acttcatggc acaaaccaca 20

<210> 15

<211> 20

<212> DNA

<213> SRCAP

<400> 15

gagggtcgaa cagatttgga 20

<210> 16

<211> 20

<212> DNA

<213> PRRSV N gene

<400> 16

agatcatcgc ccaacaaaac 20

<210> 17

<211> 20

<212> DNA

<213> PRRSV N gene

<400> 17

gacacaattg ccgctcacta 20

<210> 18

<211> 24

<212> DNA

<213> GAPDH(swine)

<400> 18

actcactctt ccacttttga tgct 24

<210> 19

<211> 20

<212> DNA

<213> GAPDH(swine)

<400> 19

tgttgctgta gccaaattca 20

<210> 20

<211> 24

<212> DNA

<213> GAPDH(monkey)

<400> 20

acccactctt ccaccttcga cgct 24

<210> 21

<211> 20

<212> DNA

<213> GAPDH(monkey)

<400> 21

tgttgctgta gccaaattcg 20

Claims (1)

1. Use of a substance according to any one of the following (a) to (c) for the preparation of a blocking agent for inhibiting high-and low-pathogenic porcine reproductive and respiratory syndrome virus infection:

(a) siRNA, wherein a sense strand is shown as SEQ ID NO.2, and an antisense strand is shown as SEQ ID NO. 3;

(b) siRNA, wherein a sense strand is shown as SEQ ID NO.4, and an antisense strand is shown as SEQ ID NO. 5;

(c) the sense strand of the siRNA is shown as SEQ ID NO.6, and the antisense strand is shown as SEQ ID NO. 7.

Images