CN109694855B - Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology - Google Patents
Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology Download PDFInfo
- Publication number
- CN109694855B CN109694855B CN201811467833.3A CN201811467833A CN109694855B CN 109694855 B CN109694855 B CN 109694855B CN 201811467833 A CN201811467833 A CN 201811467833A CN 109694855 B CN109694855 B CN 109694855B
- Authority
- CN
- China
- Prior art keywords
- cells
- cell
- stem cells
- corneal epithelial
- corneal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0625—Epidermal cells, skin cells; Cells of the oral mucosa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/02—Compounds of the arachidonic acid pathway, e.g. prostaglandins, leukotrienes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/30—Hormones
- C12N2501/33—Insulin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/80—Neurotransmitters; Neurohormones
- C12N2501/81—Adrenaline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Dermatology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for improving the efficiency of inducing human epidermal stem cells into corneal epithelial cells by utilizing a transgenic technology. The method comprises the steps of successfully constructing an EEFSEC overexpression vector and transferring the EEFSEC overexpression vector into stem cells. The EEFSEC overexpression vector can safely and effectively modify EEFSEC genes of stem cells, not only can increase the activity of the stem cells, but also can improve the differentiation efficiency of corneal epithelial cells, and has extremely high application value.
Description
Technical Field
The invention relates to a method for improving the efficiency of inducing human epidermal stem cells into corneal epithelial cells by utilizing a transgenic technology.
Background
Stem cells, the cells of origin, are cells with proliferative and differentiative potential, have the ability to self-renew and replicate, and are capable of producing highly differentiated functional cells. Briefly, it is a group of primitive undifferentiated cells having multipotentiality and self-replication ability, which are primitive cells forming tissues and organs of mammals. In addition, stem cells have the potential function of regenerating various tissues and organs, and thus, they are also called "universal cells" in the medical field. Due to the characteristics of stem cells, the stem cells become the basis of 21 st century regenerative medicine, and become the leading edge and hot spot of current technologies.
Stem cell research is one of the most viable, influential and promising areas of life science research following large-scale sequencing of the human genome. At the end of 1999, stem cell research was rated by the journal of science, usa, as the crown of ten sciences in the world in 1999; in 2000, stem cell research was again rated by the journal of science as one of the ten scientific achievements in the world of that year.
Tissue engineering was developed based on stem cell research with the ultimate goal of studying the mechanisms of stem cell proliferation and differentiation, i.e., the use of stem cells to treat diseases. Theoretically, stem cells can be used for the treatment of various diseases, such as diabetes, myocardial infarction, liver failure, and the like. It is this potential value of stem cells that has attracted the interest of research and exploration of various researchers.
Stem cells can be roughly classified into three types according to the size of differentiation potential: a totipotent stem cell: the totipotent stem cell has the differentiation potential for forming complete individual, and can be directly cloned into human body, such as fertilized egg, embryonic stem cell, etc. Pluripotent stem cells: the multipotent stem cell has the potential of differentiating various tissue cells, but loses the capability of developing into an integral individual, can directly replicate various organs and repair tissues, such as bone marrow multipotent hematopoietic stem cells, and can differentiate at least twelve blood cells. Pluripotent stem cells: unipotent stem cells, also known as multipotent stem cells, can only differentiate into one type or two closely related types of cells, such as epithelial tissue basal layer stem cells, myoblasts in muscle, etc.
In 2012, a scientific research team in China successfully utilizes nuclear transplantation and a stem cell technology to establish a mouse androgenesis haploid embryonic stem cell line, and the haploid embryonic stem cells not only have typical characteristics and development potential of mouse embryonic stem cells, but also can replace sperms to finish fertilization and generate healthy and fertile mice.
The fruit not only provides a new means for obtaining the animal model of genetic operation; meanwhile, a new system is provided for the research of the reproductive, genetic and developmental regulation mechanism of mammals. The method for establishing and obtaining the androgenesis haploid embryonic stem cell and the semi-cloned mouse.
With the development of stem cells, it is expected that the isolation and in vitro culture of stem cells will be used to propagate tissues or organs in vitro and to treat clinical diseases by tissue or organ transplantation. Furthermore, with the continuous progress of the scientific and technical level and the continuous and deep research of stem cells, the science fiction capabilities of broken arm regeneration and the like are believed to be possible.
Corneal epithelial damage refers to a pathological condition in which the barrier function and integrity of corneal epithelium are destroyed due to various factors, resulting in partial or full loss of corneal epithelial cell layers, which may seriously affect visual function. The causes of corneal epithelial injury can be divided into congenital and acquired types, and can be caused by local factors or systemic factors, such as trauma, infectious injury, tear film dysfunction, corneal nerve dysfunction, ocular surface inflammatory reaction, eyelid or eyelid margin lesion, corneal degeneration and endothelial injury, medicines and other patients wearing corneal contact lenses and systemic metabolic diseases (such as diabetes) and the like. Severe corneal diseases require surgical procedures to remove the turbid portion of the cornea and replace the diseased or damaged cornea with a healthy transparent cornea of the same shape for the purpose of restoring vision or treating corneal diseases.
In the prior art, there are three main ways of corneal transplantation, including traditional corneal transplantation, autologous limbus transplantation and allogenic limbus transplantation, and the main characteristics are as follows: 1. the traditional cornea transplantation is mainly used for treating central corneal opacity caused by various reasons, has the advantages that the optical area of the cornea after operation is transparent, has the defects that the transplantation is only performed on the optical area with the central phi of 6-7mm, is ineffective for stem cell deletion patients, the cornea is quickly re-opacified, and in addition, long-term immunosuppressive treatment is required.
The advantages of autologous limbal transplantation are that no immunosuppressive treatment is needed, but the healthy eye has the risk of stem cell loss, and 360-degree annular transplantation cannot be performed, and the effect is limited to a certain extent.
Allogenic limbic transplantation is a relatively mature surgical method for treating stem cell loss at present, but donor materials are extremely limited, and treatment opportunities are very few; there is immunological rejection, and the postoperative administration is for at least one year, and the cost is very high.
With the development of stem cell technology, in recent years, methods of transplantation using cultured stem cell CORNEAs have been proposed, such as CORNEA 2000; 19(4): 421-42, Schwab IR et al disclose a method of using bioengineered tissues to replace diseased cornea, wherein the corneal epithelial membrane is cultured by using autologous or parental corneal epithelial membrane, preserving Human Amniotic Membrane (HAM) as a carrier, and culturing cells on HAM in a differentiation manner after passage, wherein the feeder cells are 3T3, and KGM medium is used for serum-free culture. The disadvantage of this method is that although the cultured cells on 3T3 feeder cells can proliferate in large quantities, there is a risk of heterogeneous contamination due to the use of murine cells as feeder cells; in addition, the number of stem cells is reduced by differentiation culture on the amnion, and long-term effectiveness cannot be guaranteed.
In the prior art, there are many methods for treating corneal damage, and particularly there are many forms of corneal treatment using stem cells. For example, CN102952779A discloses a culture method for inducing the directional differentiation of human embryonic stem cells into limbal stem cells, which comprises the following steps: firstly, culturing a primary limbal stem cell by adopting a DMEM/F12 conditioned medium to prepare a limbal stem cell conditioned medium; then, the limbal stem cell conditioned medium is combined with type IV collagen in vitro culture to induce the directional differentiation of human embryonic stem cells into limbal stem cells. The limbal stem cells obtained by the method are verified to have the similar morphology and phenotype of the induced cells as normal limbal stem cells by in vitro optical microscope observation, electron microscope observation, real-time quantitative polymerase chain reaction, immunofluorescence, flow cytometry analysis, clone formation rate measurement and the like, show good in vitro differentiation and proliferation capacity, can be subjected to in vitro passage for more than 4 generations and can be used as seed cells for preparing corneal transplants.
Regenerating a surface cornea by using one stem cell of CN1398644A, taking embryo corneal epithelium or adult corneal limbus epithelium, shearing, digesting with digestive juice containing enzyme, stopping digestion, centrifuging to prepare a single cell suspension, and culturing; placing the single cell suspension in a culture dish or a culture bottle, adding a culture medium, and culturing at 37 ℃ under the condition of 5% CO 2; the culture of the cells is changed every 2-3 days, when the cells are gathered to reach 80-90%, the cells are passed, the 2 nd-6 th generation of cells are directly passed on the treated amnion, and the stem cells which can be used as the material for transplanting and treating the corneal disease can be obtained after the culture under the same culture condition is carried out for 8-20 days in a non-differential way.
CN106167790A provides a method for the directional induced differentiation of human embryonic stem cells into corneal endothelial cells, which comprises the steps of inducing the human embryonic stem cells into human neural crest stem cells and inducing the human neural crest stem cells into human corneal endothelial cells. The invention utilizes primary human corneal stromal cell culture supernatant, human corneal endothelial cell culture supernatant and human crystalline lens cell culture supernatant as conditioned medium, adds retinoic acid and various recombinant proteins into the culture medium, combines three-dimensional culture and two-dimensional culture methods, simulates the development process of corneal endothelial cells to induce human embryonic stem cells to directionally induce and differentiate into human corneal endothelial cells, can obtain human corneal endothelial cells with morphological structure similar to normal human corneal endothelial cells, and the in vitro subculture result shows that the proliferation capacity of the human corneal endothelial cells is consistent with that of normal human corneal endothelial cells.
CN102952777A discloses an induction method for directional differentiation of human embryonic stem cells into corneal endothelial cells: culturing human embryonic stem cells on a mouse embryonic fibroblast feeder layer, sorting a human embryonic stem cell clone group in a good state, inoculating the human embryonic stem cell clone group on a mitomycin C-treated human corneal stroma fibroblast layer, culturing for 7 days, differentiating the human embryonic stem cells into a chrysanthemum-shaped group, separating and transferring the chrysanthemum-shaped group from the human corneal stroma fibroblast layer into a culture bottle, continuously culturing for 7 days by adopting a neural crest stem cell culture medium, sorting the human neural crest stem cells by a flow cytometer, adding the human neural crest stem cells into the culture bottle, placing the human corneal endothelial cell conditioned medium into a 37-DEG C5% CO2 incubator for incubation and culture, changing liquid every other day, culturing for about 10 days to obtain the corneal endothelial cells, wherein the proliferation capacity of the corneal endothelial cells is similar to that of normal corneal endothelial cells, the corneal endothelial cells can be transferred to 1-2 generations in vitro, and the corneal endothelial cells can be used as seed cells for tissue engineering cornea construction and transplantation.
Although all of the above methods can be converted into corneal cells, the conversion speed and the conversion success rate are still to be improved.
Disclosure of Invention
The invention aims to provide a method for constructing a transgenic epidermal stem cell. The transgenic epidermal stem cell can promote the differentiation of genes in the epidermal stem cell and the differentiation to corneal epithelial cells.
The specific construction method of the transgenic epidermal stem cell is that an EEFSEC overexpression vector is successfully constructed by using a gene engineering technology, and the gene engineered stem cell EEFSEC is obtained after stem cells (NSCs) are transfected. The EEFSEC overexpression vector can safely and effectively carry out gene modification on the stem cells, and the obtained genetically engineered stem cells EEFSEC not only improve the anti-apoptosis and survival capability of the stem cells through overexpression of the EEFSEC, but also increase the number of the effectively survived stem cells and improve the effect of the differentiation efficiency of the stem cells to the cornea;
one technical scheme of the invention is to provide a preparation method of a genetically engineered stem cell, which comprises the following steps:
s1, synthesizing a gene EEFSEC, wherein the nucleotide sequence of the gene EEFSEC is shown as SEQ ID NO: 1 is shown in the specification;
s2, inserting the gene EEFSEC into an expression vector to obtain a recombinant plasmid;
and S3, transfecting the stem cells with the recombinant plasmids to obtain the genetically engineered stem cells.
Preferably, the expression vector is pIRESneo3 vector.
Most preferably, the preparation method comprises the following steps:
s1, synthesizing a gene EEFSEC by a chemical synthesis method, wherein the nucleotide sequence of the gene EEFSEC is shown as SEQ ID NO: 1 is shown in the specification;
s2, taking the gene EEFSEC synthesized in the step S1 as a template, and taking the gene EEFSEC of SEQ ID NO: 2-3 as a primer, carrying out PCR amplification, recovering and purifying the amplified fragment, carrying out a connection reaction with a linearized expression vector pIRESneo3, and transfecting the vector into a stem cell to obtain the genetically engineered stem cell EEFSEC-stem cell.
The technical scheme of the invention is that the genetically engineered stem cells are induced to differentiate into corneal epithelium-like cells in vitro.
In particular, the method for inducing the differentiation of the transgenic human epidermal stem cells into the corneal epithelium-like cells in vitro comprises the steps of taking the stem cells, carrying out cell slide in a 6-well plate, and carrying out cell slideThe planting density is controlled at 5-9X 104Per cm2Zero-supplemented DMEM/F12 medium was fed statically at 30 ℃ for 3 days. And replacing with corneal epithelial cell culture solution, cooling in an incubator at 25 ℃, culturing and incubating, changing the culture solution half every 2 days, inducing at low temperature, and culturing for 5 days.
The corneal epithelial cell culture solution comprises the following components: every 100mL keratinocyte Cell culture solution (ScienCell) is added with 1mL 100X CEPicGs (Corneal Epithelial Cell Growth Supplement) Corneal Epithelial Cell Growth Supplement 5mL (ScienCell), 5pg/mL BSA, 1pg/mL insulin, 25ng/mL FGF, 500ng/mL epinephrine, 0.5. mu.g/mL hydrocortisone, 0.5nmo1/L prostaglandin E2 and 30nmol/L triiodothyronine, preferably, 0.5. mu.g/mL keratolytic peptide. The corneal promoting peptide sequence may be QVYSRADSRNRAYWPPWHITPFVLPCY or RTQWWTKIAVWSMQRNHHHHALCWDWM or TTHGECWHWDYFMRRHHYMYMNKQKQT.
One technical scheme of the invention is to provide a cornea promoting peptide, and the sequence of the cornea promoting peptide is QVYSRADSRNRAYWPPWHITPFVLPCY or RTQWWTKIAVWSMQRNHHHHALCWDWM or TTHGECWHWDYFMRRHHYMYMNKQKQT.
One technical scheme of the invention is the application of the cornea promoting peptide in promoting the differentiation of the human epidermal stem cells from in vitro induction to corneal epithelial-like cells.
Compared with the prior art, the invention has the following beneficial effects:
differentiation of human epidermal stem cells into corneal epithelial cells has not been studied in the prior art, or the background is weak even if it is studied. The invention provides a method for inducing epidermal stem cells to corneal epithelial cells, which does not need more complicated culture conditions like cell differentiation in the prior art, only needs one-step induction, can realize high-efficiency induction effect and has remarkable improvement. In addition, the inventors isolated EEFSEC genes capable of promoting differentiation of epidermal stem cells into corneal epithelial cells by big data analysis and gene library induction screening. By successfully constructing the EEFSEC overexpression vector and transferring the EEFSEC overexpression vector into stem cells. The EEFSEC overexpression vector can safely and effectively modify EEFSEC genes of stem cells, not only can increase the activity of the stem cells, but also can improve the differentiation efficiency of corneal epithelial cells, and has extremely high application value. In addition, the invention also screens and obtains 3 cornea promoting peptides which have good promoting effect on differentiation, and the differentiation efficiency of corneal epithelial cells can be improved by adding the cornea promoting peptides into the culture medium.
Drawings
FIG. 1 is a diagram showing the results of PCR of transgenic positive cell clones, wherein the size of EEFSEC gene is around 1791bp indicated by an arrow.
Detailed Description
The present invention will be further described with reference to the following examples.
Example 1 isolation of human epidermal stem cells
The isolation can be carried out by using the conventional epidermal stem cell isolation method in the field, or can be directly cultured by using commercially available epidermal stem cells.
Specifically, the invention shows one of the methods for obtaining epidermal stem cells as follows:
the skin of the healthy male after circumcision is taken to prepare epidermal cells and fibroblasts.
1. Separation of epidermal cells: washing skin 2cm long and 2mm wide with PBS containing antibiotics for 3 times; digesting in protease solution at 4 deg.c for 16 hr; taking out the skin, and stripping the epidermis and the dermis; collecting epidermal skin pieces, placing in mixture of 0.25% pancreatin and 0.02% EDTA (1: 1), digesting at 37 deg.C for 15 min, stopping digestion, slightly blowing, filtering, collecting cell suspension, centrifuging, removing supernatant, adding fresh culture solution, resuspending cells, adjusting cell concentration to 1 × 103/ml。
2. Preparation of trophoblast cells: collecting the dermis skin sheet after the epidermis and the dermis layer are peeled off, placing the dermis skin sheet in 625U/ml collagenase solution, collecting fibroblast suspension after digestion, culturing the fibroblasts until the fibroblasts are spread to about 80 percent, adding mitomycin C until the final concentration is 10-6mol/L, incubating for 12 hours at 37 ℃, taking out, digesting for 5 minutes at 37 ℃ by using 0.25 percent pancreatin, stopping digestion, centrifuging for 5 minutes (1000 r/minute), discarding supernatant, and re-suspending cells for later use.
3. Preparation of extracellular matrix covering plates: culturing the epidermal cells in a dish until the cells are confluent for 13 days; after the epidermal cells are converged, the culture solution is aspirated and washed with sterile PBS; adding a mixed solution of ethylenediamine tetraacetic acid (10mmol/L), tris (hydroxymethyl) aminomethane hydrochloric acid (25mmol/L) and triton (1% (w/v)), and incubating at 37 ℃ (30 minutes) until cell lysis can be seen under a lens; washing with PBS; then 0.5mg/ml denatured bovine serum albumin was added and incubated at 37 ℃ for 1 hour to block non-specific adhesion; washing with PBS, adding serum-free culture solution, and incubating at 37 deg.C.
4. Screening and culturing of epidermal stem cells: and (3) adding 2ml of epidermal cell suspension into a prepared plate covered with extracellular matrix, culturing at 37 ℃ for 10 minutes, taking out, sucking liquid, washing with PBS until cell-free suspension is achieved, wherein the adherent cells are epidermal stem cells. Adding trophoblast cells (4 × 10)3/cm2) The cells were cultured in KSC medium, and the medium was changed every 2 days and every 3 days thereafter. Wherein the KSC culture medium contains 5% fetal calf serum and 1ng/ml basic fibroblast growth factor.
5. Subculturing: the epidermal stem cells were grown to confluence, and digested with a mixture of 0.25% pancreatin/0.02% EDTA (1: 1) at 37 ℃ for 6 minutes, to terminate the digestion; collecting cell suspension, centrifuging for 5min, discarding supernatant, adding fresh culture solution, resuspending cells, inoculating at a density of 2 × 105/ml in a culture flask pre-paved with trophoblast cells, culturing at 37 deg.C in 5% CO2 incubator, and performing immunohistochemical detection: the cell beta 1 integrin is expressed by 100 percent, the keratin 19 is expressed by 98.5 percent, the keratin 10 and the anti-vimentin are negative, and the epidermal stem cell is determined to be obtained.
Example 2 transgenic preparation of human epidermal stem cells
Firstly, according to the EEFSEC gene, an upstream primer and a downstream primer are designed, wherein the specific primers are as follows (Ncol and Hindll are respectively added at the upstream and downstream of the primers): f1: atggcagggcggcgggtgaa (SEQ ID NO: 2); r1: tcagggagactgaaccatgc (SEQ ID NO: 3). Human genome DNA template and F1 and R1 as primers are used for PCR amplification, and the amplification system and conditions are respectively as follows:
and (3) PCR reaction system: dNTP at a final concentration of 250. mu.M, 10mM Tris-Cl, pH8.0, 50mM KCl, 1.5mM MgCl2,2pM upstream primer, 2pM downstream primer, 2. mu.l DNA, IU Taq DNA polymerase, made up to 20. mu.l with ddH 20;
and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, renaturation at 62.5 ℃ for 35s, extension at 72 ℃ for 35s, 40 cycles, extension at 72 ℃ for 10min, and final heat preservation at 4 ℃.
After the amplification, 5. mu.1 of the amplified product was analyzed by agarose gel analysis. As a result, it was found that the PCR product was evident at about 1800bp in the electrophoretic analysis, and the target gene was obtained by gel recovery.
The double digestion was carried out with Ncol and Hindll, and the desired DNA was recovered by 1% agarose gel purification. Meanwhile, p IRESNeo3 plasmid fragment is double digested by Ncol and Hindll, large fragment is recovered by 1% agarose gel purification, and finally target DNA and p IRESNeo3 fragment are connected by T4DNA ligase to construct recombinant expression plasmid p IRESNeo-EEFSEC, DH5 alpha competence is transformed, positive clone is picked, and double digestion analysis and DNA sequencing are carried out after a large amount of DNA is prepared. The sequence of the target gene is found to be consistent through sequencing. The vector construction was successful.
Cell transfection: according to 3X 102Cell/well quantity epidermal cells were seeded in 6-well plates, 37 ℃, 5% CO2The incubator was incubated overnight to a cell density of about 60% for cell transfection. The amount of the transfection plasmid p IRES2neo-EEFSEC DNA was 4. mu.g, and 48 hours after transfection, the transfected cells were inoculated in a G418-concentrated DMEM/F12 culture solution at 400,600,800,1000 (. mu.g/ml) with G418-modified DMEM/F12 culture solution every 3d, and resistant clones were observed to appear after 2 weeks. The selection of clones was carried out after further 2 weeks of culture with half the amount of G418. The selected clones were further cultured in a serum-free medium and expressed, and the culture supernatant was collected after 72 hours and stored at-80 ℃ for further use.
The positive clone is detected by using a PCR method, and the result is shown in figure 1, so that the target gene of about 1791bp can be amplified, and the success of transfection is shown.
Example 3 Induction of human epidermal Stem cells into corneal epithelial cells
The stem cells of human epidermis and the transgenes obtained in example 2 were taken separatelyBecause the human epidermal stem cells are respectively subjected to cell climbing in a 6-well plate, the cell planting density is controlled to be 6X 104Per cm2The culture solution of DMEM/F12 was statically fed for 3 days at 30 ℃. And replacing with corneal epithelial cell culture solution, cooling in an incubator at 25 ℃, culturing and incubating, changing the culture solution half every 2 days, inducing at low temperature, and culturing for 5 days. The corneal epithelial cell culture solution (without cornea promoting peptide) comprises the following components: every 100mL keratinocyte Cell culture solution (ScienCell) is added with 1mL 100X CEPicGs (Corneal Epithelial Cell Growth Supplement) Corneal Epithelial Cell Growth Supplement 5mL (ScienCell), 5pg/mL BSA, 1pg/mL insulin, 25ng/mL FGF, 500ng/mL epinephrine, 0.5. mu.g/mL hydrocortisone, 0.5nmo1/L prostaglandin E2 and 30nmol/L triiodothyronine. The corneal epithelial cell culture solution (containing corneal promoting peptide) comprises the following components: every 100mL keratinocyte Cell culture solution (ScienCell) is added with 1mL 100X CEPicGs (Corneal Epithelial Cell Growth Supplement) Corneal Epithelial Cell Growth Supplement 5mL (ScienCell), 5pg/mL BSA, 1pg/mL insulin, 25ng/mL FGF, 500ng/mL epinephrine, 0.5 μ g/mL hydrocortisone, 0.5nmo1/L prostaglandin E2 and 30nmol/L triiodothyronine, 0.5 μ g/mL Corneal promoting peptide, and the Corneal promoting peptide is QVYSRADSRNRAYWPPWHITPFVLPCY or RTQWWTKIAVWSMQRNHHHHALCWDWM or TTHGECWHWDYFMRRHHYMYMNKQKQT. The method comprises the steps of inducing transgenic stem cells and non-transgenic stem cells under inducing conditions containing 3 promoting peptides and no promoting peptides respectively, and accordingly obtaining the induced corneal epithelial cells. Human mesenchymal stem cells were used as a control.
Example 4 results testing
FACS was performed on the induced corneal epithelial cells using CD200, SSEA4 and ITG β 4 as cell surface markers. CD200 positive cells can be removed by a gating technology, and SSEA4 positive and ITG beta 4 positive cells are separated from CD200 negative cells separately and K12, p63 and PAX6 are expressed, namely corneal epithelial cells. The results of the differentiation-positive cell rate (the proportion of cells having corneal epithelial cell markers among the final cells analyzed by FACS) for each method were as follows:
from the above results, it can be seen that the method for inducing differentiation of epidermal stem cells into corneal epithelial cells of the present invention has a high transformation rate, wherein the transformation rate can be improved well by adding 3 kinds of promoting peptides, and the differentiation of stem cells can be accelerated and improved well by using the epidermal stem cells into which genes are introduced.
Example 5 monitoring of growth of differentiated corneal epithelial cells
Several differentiated cells from example 4 were treated with 2x 102And inoculating the cells per mL into a 6-well plate for adherent culture for 2d, centrifuging, removing supernatant, washing to obtain cells, and counting the cells. The results are as follows:
from the above results, it can be seen that the corneal epithelial cells induced by the present invention have a faster growth rate than the corneal epithelial cells of the prior art. Can meet the requirement of batch use as a cell model and the like. Has better medical application prospect.
Example 6 Soft agar colony formation assay for corneal epithelial cells
(1) Preparing two low-melting point agar sugar solutions with the concentration of 1.2 percent and 0.8 percent respectively by using distilled water, and maintaining the solutions in a water bath at 40 ℃ after autoclaving to ensure that the solutions are not solidified.
(2) 1.2% agarose and 2X DMEM or 2X HL medium (containing 2X antibiotics and 20% calf serum) are mixed uniformly in a sterile centrifuge tube according to the proportion of 1:1, 3mL of mixed solution is injected into a 6-well plate, the mixed solution is cooled and solidified, the mixed solution is used as bottom agar and placed in a 37 ℃ and 5% C02 incubator for later use, and each cell is subjected to three multiple wells.
The third step is1:1 ratio of 0.8% agarose and 2X DMEM or 2X HL medium in a sterile centrifuge tube, then adding 2mL cell suspension into the tube (agarose and 2X DMEM mixed solution containing HeLa cells, agarose and 2XHL medium containing the cell suspension of corneal epithelial cells prepared under the above conditions), adding 3X 10 to each well of a six-well plate4The cells were mixed well and poured into a dish with a 1.2% agarose base to form a layer of diagarose. After the upper agar is solidified, the mixture is placed at 37 ℃ and 5% CO2Culturing in an incubator for 30 days.
The plate was placed under an inverted microscope, and the morphology of the cell clone and the tumorigenicity of the cell were observed.
The growth state of HeLa cells and corneal epithelial cells in soft agar shows that HeLa cells can form larger cell clones in soft agar, whereas human normal corneal epithelial cells cannot form clones in soft agar. The corneal epithelial cells prepared by the method have no abnormal proliferation and tumorigenicity in vitro and are normal cells.
Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Sequence listing
<110> Luoyang Xuan Zhi Biotech Co., Ltd
<120> method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1791
<212> DNA
<213> human (Homo sapiens)
<400> 1
atggcagggc ggcgggtgaa cgtgaacgtg ggcgtgctgg gccacatcga cagcggcaag 60
acggcgctgg cgcgggcgct aagcaccaca gcctccaccg ccgcctttga caagcagccg 120
cagagccgcg agcgcggcat cacgctcgat ctgggcttct cgtgcttctc ggtgccgctg 180
cccgcgcgcc tgcggtcgtc tttgcccgag ttccaggcag cgcccgaggc cgagcccgag 240
cccggcgagc cactgcttca ggtcacgctg gtcgactgcc ccgggcacgc ctccctcatc 300
cggaccatca tcggcggggc ccagatcatt gatctgatga tgctggtcat cgatgtgacc 360
aaggggatgc agacccagtc agcggaatgc cttgtgatcg gccagattgc ctgccagaag 420
ctggtcgtgg tgctgaacaa aatagacctc ttacctgaag gaaagagaca ggcagcaatt 480
gataaaatga ccaagaaaat gcagaagacc ctagagaaca ccaagttccg aggtgcaccg 540
attatacccg tggcggccaa gccgggggga ccagaggccc ccgaaactga agctccacag 600
ggcattccag agctcattga gctcctgacg tcccagattt ccatcccaac gagagatccc 660
tcgggaccgt tcctcatgtc tgtggaccac tgtttctcca tcaaaggcca aggcactgtg 720
atgacaggga ccatcctttc aggctccatc agcctcggtg acagtgtgga gatccctgcc 780
ctcaaggtgg tgaagaaggt gaagtccatg cagatgttcc acatgcccat cacttcagcc 840
atgcaaggag accggctggg catctgcgtc acccagtttg accctaagct gctggagcgc 900
gggttggtgt gtgcccccga gtccctgcac actgtccatg cggccctcat ctctgtggaa 960
aagataccgt atttccgggg gcccctgcaa accaaggcca agttccacat tacagtgggc 1020
catgaaacag tcatgggccg gttgatgttc ttcagtcctg ctccagataa ctttgaccag 1080
gagcctatac tggactcttt caacttctct caagaatacc ttttccagga gcagtacctg 1140
tccaaggatt tgacaccagc agtgacagac aatgatgagg ccgacaagaa ggccggccag 1200
gccacagagg gccattgtcc tcggcagcag tgggccctgg tggagtttga gaagcccgtc 1260
acctgccctc ggctgtgcct ggtgattggc tccaggctag atgcggacat tcacaccaac 1320
acgtgccggc tagccttcca tggcatcctg ctccacgggc tagaggacag gaactacgcc 1380
gacagcttcc tgcccaggct gaaggtgtac aagctgaagc acaagcatgg ccttgtggag 1440
cgggcgatgg atgactacag tgtgatcggc cgctccctgt tcaaaaagga aaccaacatc 1500
cagctcttcg tggggctcaa ggtgcacttg tccactgggg aactgggcat catcgacagt 1560
gccttcggcc agagcggcaa gttcaagatc cacatcccag gtggcctcag ccccgagtcc 1620
aagaagatcc tgacacccgc cctcaagaag cgggcccggg ctggccgtgg ggaggccacc 1680
aggcaggagg agagcgccga gcggagcgag ccctcacagc atgtggtgct cagcctgact 1740
ttcaagcgtt atgtcttcga cacccacaag cgcatggttc agtctccctg a 1791
<210> 2
<211> 20
<212> DNA
<213> human (Homo sapiens)
<400> 2
atggcagggc ggcgggtgaa 20
<210> 3
<211> 20
<212> DNA
<213> human (Homo sapiens)
<400> 3
tcagggagac tgaaccatgc 20
<210> 4
<211> 27
<212> PRT
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 4
Gln Val Tyr Ser Arg Ala Asp Ser Arg Asn Arg Ala Tyr Trp Pro Pro
1 5 10 15
Trp His Ile Thr Pro Phe Val Leu Pro Cys Tyr
20 25
<210> 5
<211> 27
<212> PRT
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 5
Arg Thr Gln Trp Trp Thr Lys Ile Ala Val Trp Ser Met Gln Arg Asn
1 5 10 15
His His His His Ala Leu Cys Trp Asp Trp Met
20 25
<210> 6
<211> 27
<212> PRT
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 6
Thr Thr His Gly Glu Cys Trp His Trp Asp Tyr Phe Met Arg Arg His
1 5 10 15
His Tyr Met Tyr Met Asn Lys Gln Lys Gln Thr
20 25
Claims (4)
1. A method for preparing a genetically engineered stem cell of non-therapeutic interest, comprising the steps of:
s1, synthesizing a gene EEFSEC, wherein the nucleotide sequence of the gene EEFSEC is shown as SEQ ID NO: 1 is shown in the specification;
s2, inserting the gene EEFSEC into an expression vector to obtain a recombinant plasmid;
s3, transfecting the recombinant plasmid into the human epidermal stem cell to obtain a genetically engineered stem cell; the expression vector is pIRESneo3 vector.
2. The engineered human epidermal stem cell prepared by the method of claim 1.
3. A method for inducing differentiation of human epidermal stem cells to corneal epithelial-like cells in vitro, which is characterized in that: performing cell slide on the engineered human epidermal stem cell of claim 2 in a 6-well plate, wherein the cell planting density is controlled to be (5-9) X104Per cm2The method comprises the following steps of (1) statically feeding a zero-addition DMEM/F12 culture solution at 30 ℃ for 3 days, replacing the culture solution with a corneal epithelial cell culture solution, carrying out cooling culture incubation at 25 ℃ in an incubator, changing the solution half every 2 days, carrying out low-temperature induction, and carrying out culture for 5 days, wherein the corneal epithelial cell culture solution comprises the following components: for each 100mL keratinocyte cell culture solution, 5mL of 100 XCEPicGS corneal epithelial cell growth additive, 5pg/mL BSA, 1pg/mL insulin, 25ng/mL FGF, 500ng/mL epinephrine, 0.5. mu.g/mL hydrocortisone, 0.5nmo1/L prostaglandin E2 and 30nmol/L triiodothyronine were added.
4. The method of claim 3, wherein: the corneal epithelial cell culture solution also comprises 0.5 mu g/mL of corneal promoting peptide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811467833.3A CN109694855B (en) | 2018-12-03 | 2018-12-03 | Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811467833.3A CN109694855B (en) | 2018-12-03 | 2018-12-03 | Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109694855A CN109694855A (en) | 2019-04-30 |
| CN109694855B true CN109694855B (en) | 2020-12-29 |
Family
ID=66230282
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811467833.3A Active CN109694855B (en) | 2018-12-03 | 2018-12-03 | Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109694855B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184187A (en) * | 2011-12-28 | 2013-07-03 | 连祺周 | Method for directional differentiation of human induced pluripotent stem cells into corneal epithelioid cells |
| EP3246397A1 (en) * | 2015-01-13 | 2017-11-22 | Osaka University | Corneal epithelioid cells derived from surface ectodermal cells |
-
2018
- 2018-12-03 CN CN201811467833.3A patent/CN109694855B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184187A (en) * | 2011-12-28 | 2013-07-03 | 连祺周 | Method for directional differentiation of human induced pluripotent stem cells into corneal epithelioid cells |
| EP3246397A1 (en) * | 2015-01-13 | 2017-11-22 | Osaka University | Corneal epithelioid cells derived from surface ectodermal cells |
Non-Patent Citations (4)
| Title |
|---|
| homo sapiens eukaryotic elongation factor, selenocysteine-trna specific (EEFSEC),mRNA;ncbi;《NCBI》;20180630;cds * |
| selective inhibition of selenocysteine trna maturation and selenoproteinsynthesis in transgenic mice expressing isopentenyladenosine-deficient selenocysteine trna;mohamed e.et al.;《molecelar and cellular biology》;20010630;第21卷(第11期);3840-3852 * |
| 半合成-酶连法克隆EFsec基因及其初步表达分析;李丽等;《中国老年学杂志》;20120531;第32卷;摘要、第1870页最后一段 * |
| 表皮干细胞研究新进展;耿松梅等;《中国皮肤性病学杂志》;20020531;第16卷(第3期);第194页3部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109694855A (en) | 2019-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100554411C (en) | Undifferentiated stem cell tissue system from corneal limbus | |
| CN103409368B (en) | The cardiac muscle cell of stem cell and embryonic origin and the cardiac muscle cell's who infers purification process | |
| CN104726406B (en) | It is a kind of to induce the method that dental pulp Derived from Mesenchymal Stem Cells is nerve cell | |
| CN102952777B (en) | Inducing method for directionally differentiating human embryonic stem cells to corneal endothelial cells | |
| CN106636210B (en) | Transcription factor combines the method that induced fibroblast transdifferentiation is class interstitial glands | |
| CN101040042A (en) | Isolation of stem/progenitor cells from amniotic membrane of umbilical cord | |
| WO2006078034A1 (en) | Cells capable of differentiating into cardiac muscle cells | |
| CN107022521A (en) | Decidua vera tissue freezing, the method recovered and be separately cultured mescenchymal stem cell | |
| CN112292447B (en) | Umbilical cord mesenchymal stem cell and preparation method of cell membrane thereof | |
| CN105543164A (en) | Primary isolated culture method for dairy cow mammary epithelial cells | |
| CN113549596B (en) | Induction medium and use method and application thereof | |
| CN109280636A (en) | A method of suspend domestication 293T cell | |
| Edwards | [6] Culture of mammalian retinal pigment epithelium and neural retina | |
| CN106282121A (en) | A kind of recombinant slow virus modified human umbilical cord mesenchymal stem cells carrying pigment epidermal derived factors gene and preparation method thereof | |
| CN110684737B (en) | Induced pluripotent stem cell of RPE65 gene mutation patient | |
| CN109694855B (en) | Method for improving efficiency of inducing human epidermal stem cells into corneal epithelial cells by using transgenic technology | |
| CN109517051B (en) | Method for inducing human epidermal stem cells into corneal epithelial cells | |
| JPWO2008091013A1 (en) | Chondrocyte preparation method | |
| US20090047738A1 (en) | Feeder cell derived from tissue stem cell | |
| CN112608947B (en) | Construction method and application of immortalized human sebaceous gland cell line | |
| CN107384862A (en) | The preparation method and kit of the schwann cell in MSCs sources | |
| CN104195100A (en) | In-vitro culture method of mammary gland epithelial cells | |
| CN106635990A (en) | Primary culturing method for dorsal root ganglion satellite glial cells | |
| CN114107181A (en) | Sturgeon embryonic cell line, culture medium and preparation method thereof | |
| CN112210528A (en) | Method for improving proliferation capacity and performance of endothelial cells of cord blood |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Haoyi Inventor after: Kong Huanyu Inventor after: Du Xiaoming Inventor after: Yang Jun Inventor after: Yu Bingsheng Inventor before: Yang Jun Inventor before: Yu Bingsheng |
|
| CB03 | Change of inventor or designer information | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20201211 Address after: 102600 201-10, 2 / F, building 6, No.38 Yongda Road, Zhongguancun Science and Technology Park, Daxing District, Beijing Applicant after: Beijing Renyuan Xinsheng Biotechnology Co.,Ltd. Address before: 471000 Luoyang economic and Technological Development Zone, Henan Province, south of Qianmen Street, south of Qianjiang street, 1 units 1-1404 of Yuejiang Road, 1 buildings. Applicant before: LUOYANG XUANZHI BIOLOGICAL TECHNOLOGY Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |