CN109694395B

CN109694395B - Compound for ischemia reperfusion injury and preparation method thereof

Info

Publication number: CN109694395B
Application number: CN201710993484.8A
Authority: CN
Inventors: 李红良; 张晓晶
Original assignee: Wuhan Huikangda Technology Co ltd
Current assignee: Wuhan huikangda Technology Co.,Ltd.
Priority date: 2017-10-23
Filing date: 2017-10-23
Publication date: 2020-08-28
Anticipated expiration: 2037-10-23
Also published as: WO2019080842A1; CN109694395A

Abstract

The present invention provides a compound of formula (I) or a pharmaceutically acceptable salt, solvate, or metabolite thereof, useful for the treatment and/or prevention of ischemia reperfusion injury and related disorders, acute respiratory distress syndrome and related disorders, acute lung injury and related disorders, pathological myocardial hypertrophy and related disorders, and/or fatty liver disease and related disorders.

Description

Compound for ischemia reperfusion injury and preparation method thereof

Technical Field

The invention belongs to the technical field of medicinal chemistry, and particularly relates to a compound shown in a formula (I) or a pharmaceutically acceptable salt, solvate or metabolite thereof, and a preparation method and application thereof.

Background

Ischemia-Reperfusion Injury (IRI) is the first concept proposed by Jennings in 1960, and refers to Reperfusion of blood after Ischemia of tissue and organ, which can not only restore the function of tissue and organ, but also aggravate dysfunction and structural damage of tissue and organ. Ischemia reperfusion injury can occur in many vital organs including the heart, liver, lung, kidney, gastrointestinal tract, and the like. Research has shown that inflammation outbreaks and cell death are the main pathological mechanisms leading to organ damage caused by ischemia-reperfusion. How to reduce and eliminate ischemia-reperfusion injury and elucidate the mechanism of the injury has important clinical practical value. Several mechanisms are currently thought to be involved in ischemia reperfusion injury of organs: such as inflammatory cytokines, oxygen radicals, calcium overload, microcirculatory disturbance, energy metabolism disorder, etc., and also by factors such as the time of ischemia, the tissue's demand for oxygen, the establishment of collateral circulation, and electrolyte concentration.

Liver Ischemia Reperfusion Injury (HIRI) is a common pathological process in liver surgery, and is often seen in the pathophysiological processes such as shock, liver surgery requiring blocking of liver blood flow, and liver transplantation. In recent years, with the development of clinical treatment technologies, operations such as liver transplantation, thrombolytic therapy, and hepatic portal block surgery are more and more developed, and despite the continuous improvement of liver protection, surgical skills, and intraoperative monitoring, liver injury caused by ischemia-reperfusion still is a main cause of postoperative organ nonfunctionality, transplantation failure, and even death of patients. After the liver undergoes ischemia reperfusion, liver histiocytes generate a series of metabolic, structural and functional injuries, and are easy to induce liver failure, which is one of the main reasons influencing disease prognosis, operation success rate and patient survival rate. Therefore, the search for the medicine capable of effectively inhibiting the liver ischemia-reperfusion injury has important clinical significance.

Acute Respiratory Distress Syndrome (ARDS) and Acute Lung Injury (ALI) are both important causes of acute respiratory failure. To date, there has been no effective drug therapy for ARDS and ALI other than respiratory assisted by a ventilator and limited liquid intake.

Myocardial hypertrophy is the increase in volume and weight of cardiomyocytes produced by the heart to adapt to various stimuli. The pathological changes include myocardial cell hypertrophy, myocardial interstitial cell proliferation, reconstruction of extracellular matrix of heart and other changes, namely myocardial remodeling. There are many diseases causing myocardial hypertrophy clinically, such as primary or secondary hypertension, myocardial infarction, valvular disease, congenital heart disease, etc. Although early myocardial hypertrophy is beneficial for maintaining normal cardiac function, since myocardial hypertrophy itself can also increase myocardial oxygen consumption and decrease myocardial compliance, it can lead to heart failure over time and increase the incidence of sudden death. In recent years, a great deal of research is carried out on the occurrence and development mechanism of myocardial hypertrophy by a plurality of scholars all over the world, a plurality of key genes and important signal conduction paths which are involved in the pathophysiological process of myocardial hypertrophy are discovered, and the interventional factors of the key genes and the important signal conduction paths are deeply researched. However, the mechanism of development of myocardial hypertrophy is still not completely clear, and the existing research and discovery still have certain limitations in clinical practice, and a truly effective prevention and treatment measure for myocardial hypertrophy cannot be formed.

Liver plays an important role in fat metabolism, and participates in a plurality of important links in the process of lipid metabolism, including the intake and synthesis of fatty acid, the processing, storage, oxidative decomposition and output of lipid. When the amount of fatty acid obtained by the liver exceeds its processing capacity, lipid is deposited in the liver cells in the form of triglyceride, which results in steatosis of liver cells, becoming simple steatosis of liver, and further developing into non-alcoholic steatohepatitis, and some patients can progress into hepatic fibrosis, liver cirrhosis, and even liver cancer (such as liver cancer, the pathogenesis of non-alcoholic fatty liver disease caused by lipid metabolism disorder, the clinical journal of liver and gall disease, volume 31, stage 7 in 2015, 1050-. Meanwhile, the non-alcoholic fatty liver disease is closely related to the occurrence of cardiovascular diseases, type 2 diabetes and metabolic syndrome, and seriously threatens the health of people. Therefore, the treatment of non-alcoholic fatty liver disease is increasingly gaining attention.

Disclosure of Invention

According to one aspect of the present invention, there is provided a compound of formula (I) or a pharmaceutically acceptable salt, solvate, or metabolite thereof:

the compound is named as N- (1, 3-benzothiazol-2-yl) -4- [ (2-glucuronyl-3-methoxy) benzylamine ] benzenesulfonamide, or IMA-1.

The term "pharmaceutically acceptable salts" as used herein refers to derivatives of a pharmaceutically active compound wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues (e.g., amines), basic or organic salts of acidic residues (e.g., carboxylic acids), and the like. Pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, and the like; and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, lactic acid, malic acid, tartaric acid, citric acid, fumaric acid, methanesulfonic acid, toluenesulfonic acid, salicylic acid, sulfanilic acid, and the like.

According to another aspect of the present invention there is provided a process for the preparation of a compound of formula (I), or a pharmaceutically acceptable salt thereof, which process comprises:

(1) reacting compound 5 with (Boc)₂O reaction to obtain a compound 6;

the preferred reaction conditions are those in which the reaction is carried out in a tetrahydrofuran solvent in the presence of triethylamine.

(2) Reacting the compound 12 with the compound 6 prepared in the step (1) to prepare a compound 13;

preferably, the compound 12 is reacted in a dichloromethane solvent under the action of a 4A molecular sieve. More preferably, the reaction is carried out under an inert gas (e.g., nitrogen) blanket. Also preferably, TMSOTf and solid sodium bicarbonate are added to the reaction to obtain compound 13.

(3) And carrying out deprotection and decarboxylation reaction on the compound 13 to obtain IMA-1.

Preferably, the step (3) comprises the following specific steps:

(3.1) deprotection of Compound 13 in the presence of a catalyst affords Compound 14.

Preferably, the catalyst is tetraphenylphosphine; the reaction condition is that the solvent is acetonitrile (preferably anhydrous acetonitrile), and pyrrolidine is added into the system.

(3.2) decarboxylating the compound 14 to obtain a compound 15;

preferably, the decarboxylation reaction may be carried out in the presence of sodium carbonate and methanol, and acidification with acetic acid.

(3.3) deamination of the protecting group of Compound 15 to obtain IMA-1.

According to the present invention, said compound 6 can be prepared by the following scheme:

according to the present invention, compound 12 is prepared by the following scheme:

according to the invention, said compound IMA-1 is obtained in particular by the following steps:

the pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound, which contains a basic or acidic moiety, by conventional chemical methods. In general, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent or a mixture of the two.

According to another aspect of the present invention, there is provided a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, solvate, or metabolite thereof.

According to the present invention, it is preferred that the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

The pharmaceutically acceptable excipients are various excipients commonly used or known in the pharmaceutical field, including but not limited to: diluents, binders, antioxidants, pH adjusters, preservatives, lubricants, disintegrants, and the like.

Such diluents are for example: lactose, starch, cellulose derivatives, inorganic calcium salts, sorbitol, and the like. The binder is, for example: starch, gelatin, sodium carboxymethylcellulose, polyvinylpyrrolidone, and the like. The antioxidant is, for example: vitamin E, sodium bisulfite, sodium sulfite, butylated hydroxyanisole, etc. The pH adjusting agent is, for example: hydrochloric acid, sodium hydroxide, citric acid, tartaric acid, Tris, acetic acid, sodium dihydrogen phosphate, disodium hydrogen phosphate, and the like. Such preservatives are, for example: methyl paraben, ethyl paraben, m-cresol, benzalkonium chloride, and the like. The lubricant is, for example: magnesium stearate, aerosil, talc powder and the like. The disintegrant is, for example: starch, methyl cellulose, xanthan gum, croscarmellose sodium, and the like.

The dosage form of the medicament of the invention can be in the form of oral preparations, such as tablets, capsules, pills, powders, granules, suspensions, syrups and the like; it can also be made into injection, such as injection solution, powder for injection, etc., by intravenous, intraperitoneal, subcutaneous or intramuscular route; or orally administered, such as orally disintegrating tablets, buccal tablets; it may also be polar for topical administration, e.g., vaginal, rectal, dermal, intranasal, etc. All dosage forms used are well known to those of ordinary skill in the pharmaceutical arts.

According to another aspect of the present invention there is provided the use of a compound of formula (I) or a pharmaceutically acceptable salt, solvate or metabolite thereof in the manufacture of a medicament for the treatment and/or prophylaxis of ischemia reperfusion injury and related disorders, acute respiratory distress syndrome and related disorders, acute lung injury and related disorders, pathological myocardial hypertrophy and related disorders, and/or fatty liver disease and related disorders.

According to the present invention, the ischemia-reperfusion injury and related disease is preferably liver ischemia-reperfusion injury and related disease, heart ischemia-reperfusion injury and related disease, kidney ischemia-reperfusion injury and related disease, and/or brain ischemia-reperfusion injury and related disease; more preferably, the liver ischemia reperfusion injury and related diseases. The ischemia reperfusion injury can be caused by organ transplantation, partial or complete tissue excision, tissue ischemia caused by vascular embolism and other reasons.

Factors that trigger ischemia reperfusion injury of the liver and related diseases include, but are not limited to: liver cyst, liver transplantation, thrombolytic therapy, hepatic portal block surgery, hepatic coma, liver failure, liver inflammatory diseases, etc.

Factors that contribute to cardiac ischemia reperfusion injury and related diseases include, but are not limited to: myocardial infarction, myocardial infarction recanalization injury, heart transplantation, coronary thrombolysis, percutaneous coronary angioplasty, intracoronary dilatation, coronary artery bypass.

Causes of renal ischemia reperfusion injury and related diseases include, but are not limited to: kidney transplantation, kidney cyst, renal vascular surgery.

Factors that contribute to cerebral ischemia reperfusion injury and related diseases include, but are not limited to: cerebral apoplexy, cerebrovascular surgery, etc.

According to the present invention, the acute respiratory distress syndrome and related diseases, or the causative factors of acute lung injury and related diseases, include, but are not limited to: direct lung injury factors such as severe lung infection, aspiration pneumonia, pulmonary or thoracic contusion, aspiration of toxic gases, etc.; indirect lung injury factors such as sepsis, severe pancreatitis, amniotic fluid embolism, massive blood transfusion, etc.

According to the present invention, the causative factors of pathological myocardial hypertrophy and related diseases include, but are not limited to: cardiac remodeling such as ventricular remodeling, myocardial infarction, heart failure, arrhythmia, hypertension, coronary heart disease, arterial embolism, angina, cardiac conduction block, and the like.

According to the present invention, the causative factors of fatty liver disease and related diseases include, but are not limited to: simple steatosis, non-alcoholic steatohepatitis, alcoholic fatty liver disease, hepatic fibrosis, liver cirrhosis, hepatocarcinoma, obesity, hyperlipidemia, hyperglycemia, insulin resistance, diabetes, etc.

The medicament of the present invention may be administered to any animal that may or may not have the above-mentioned disease. These animals include both human and non-human animals, such as pets or livestock, and the like.

The agents of the invention may be administered to a subject by routes known in the art, including, but not limited to, oral, parenteral, subcutaneous, intramuscular, intravenous, intraperitoneal, intrahepatic, intramyocardial, intrarenal, vaginal, rectal, buccal, sublingual, intranasal, transdermal and the like.

The dosage administered will depend on the age, health and weight of the recipient, the type of drug combination, the frequency of treatment, the route of administration, etc. The drug may be administered in a single daily dose, or the total daily dose may be administered in divided doses of two, three or four times daily. The medicament can be administered before, during or after surgery. The dose may be administered one or more times, and the administration time may range from a single day to several months or longer. The single dose of the drug may vary over a wide range of about 0.0001 to about 10000mg per patient per day. This range may more particularly be about 0.001mg/kg to 100mg/kg body weight per day for an adult (about 60 kg).

According to the invention, the medicament can also be administered in combination with other medicaments for the treatment of the above-mentioned diseases.

Drawings

Fig. 1A and 1B: in liver ischemia-reperfusion injury, after different treatments, the detection results of ALT and AST in mouse serum (p is less than 0.05) are obtained.

FIG. 2: HE staining microscopy of mouse liver after different treatments in liver ischemia reperfusion injury.

FIG. 3: in the liver ischemia-reperfusion injury, after different treatments, the content of inflammation-related factor mRNA in mouse liver tissue was measured (p is p < 0.05).

FIG. 4: in acute lung injury, after different treatments, HE stained microscopic images of mouse lung.

FIG. 5: in acute lung injury, after different treatments, the content of inflammation-associated factor mRNA in mouse lung tissue was measured (× represents p < 0.05).

FIG. 6: in myocardial hypertrophy, mice were tested for heart-to-weight ratio (HW/BW) after different treatments (. + -. denotes p < 0.05).

Fig. 7A, 7B, and 7C: in myocardial hypertrophy, mouse heart HE and PSR staining microscopic picture, myocardial cell cross-sectional area statistics and left ventricle collagen area statistics (p is represented by <0.05) after different treatments.

Fig. 8A, 8B, and 8C: in myocardial hypertrophy, after different treatments, the content of mRNA of myocardial hypertrophy marker genes Anp and Myh7 and fibrosis related gene Col1 in heart tissues of mice is detected (p is represented by < 0.05).

FIG. 9: IMA-1 administered L02 cells were stimulated with PA + OA and stained for oil red O staining.

FIG. 10: after L02 cells administered IMA-1 were stimulated with PA + OA, the amount of mRNA, an inflammation-related factor, was measured in the cells (p < 0.05).

FIGS. 11A and 11B are primary whole scan mass spectra and product ion scan mass spectra of IMA-1.

Detailed Description

The present invention is further described below with reference to examples. It should be noted that the examples are not intended to limit the scope of the present invention, and those skilled in the art will appreciate that any modifications and variations based on the present invention are within the scope of the present invention.

The chemical reagents used in the following examples are conventional and are commercially available. The experimental methods not specifically described are all the conventional ones known in the art.

Synthetic examples

EXAMPLE 1 preparation of Compound 3

Dissolving compound 1(50g,332.89mmol,1eq) in 500mL of anhydrous tetrahydrofuran, adding pyridine (52.92g,669.03mmol,54mL,2.01eq) and 4-dimethylaminopyridine (814mg,6.66mmol,0.02eq), slowly adding 4-nitrobenzenesulfonyl chloride (89g,401.59mmol,1.21eq) at 0 ℃, stirring the obtained mixture at 25 ℃ for 6 hours, LC-MS (EW9132-1-P1A) showing a main peak as a target signal peak, filtering the reaction solution, pulping the filter cake in 300mL of ethyl acetate, and drying the obtained solid to obtain compound 3(100g,255.25mmol, 76.68% yield, 85.6% purity), which is characterized by LC-MS (9132-1-P1B) and nuclear magnetic EW (EW 9132-1-PA).

EXAMPLE 2 preparation of Compound 4

Compound 3(5.00g,14.91mmol,1.00eq), zinc powder (4.00g,61.17mmol,4.10eq) and glacial acetic acid (3.68g,61.20mmol,4.10eq) were added to 75mL of methanol, stirred at 60 ℃ for 2 hours, thin layer chromatography (volume ratio: petroleum ether/ethyl acetate 1:1, main point Rf value 0.4) showed the starting material was consumed, the reaction solution was filtered, the filter cake was washed with 100mL of hot methanol, the filtrate was concentrated and purified by silica gel column chromatography (petroleum ether ethyl acetate system, 10:1 to 2:1) to give compound 4(3.00g,9.82mmol, 65.86% yield) as a yellow solid.

EXAMPLE 3 preparation of Compound 5

Compound 4(0.10g,0.33mmol) and 2-hydroxy-3-methoxybenzaldehyde (0.075g,0.491mmol) are heated under reflux in 1.5ml of ethanol for 18 hours, cooled to room temperature, sodium borohydride (0.04g,0.98mmol) is added and stirring is continued for 6 hours, then quenched with 1ml of methanol and 1ml of water and stirring is continued for 20 minutes, the mixture is filtered through celite, the filtrate is concentrated to dryness and purified by preparative HPLC to give Compound 5.

EXAMPLE 4 preparation of Compound 6

Compound 5(20g,45.3mmol) and triethylamine (9.17g,90.66mmol) were dissolved in 100ml tetrahydrofuran and slowly added (Boc) at 0 deg.C₂O (12.85g,58.89mmol), stirring the resulting mixture at 25 deg.C for 6 hours, concentrating and purifying the crude product by silica gel column chromatography (petroleum ether ethyl acetate system, pure petroleum ether to 1:1 vol.) to give compound 6.

EXAMPLE 5 preparation of Compound 8

Compound 7(80g,412.08mmol,1eq) was dissolved in acetic anhydride (763.00g,7.47mol,700.00mL,18.14eq) and elemental iodine (5.60g,22.06mmol,4.44mL,5.35e-2eq) was added at 0 ℃ and the resulting mixture was stirred at 25 ℃ for 12 hours, then the reaction was concentrated to remove most of the acetic anhydride and the resulting concentrate was slurried with 30mL dichloromethane and 120 mL petroleum ether to give compound 8(70g,173.13mmol, 42.01% yield) as a white powder.

EXAMPLE 6 preparation of Compound 9

Compound 8(70g,173.13mmol,1eq) was dissolved in tetrahydrofuran (180mL) and water (60mL) and stirred at 25 ℃ for 12 h. The solvent was concentrated to give the crude product, which was slurried with dichloromethane (50mL) and petroleum ether (300mL) to give compound 9(45g,124.21mmol, 71.74% yield) as a white solid.

EXAMPLE 7 preparation of Compound 10

Compound 9(1.8g,4.97mmol,1eq) and DMF (36.32mg,496.85umol,38.23uL,0.1eq) were dissolved in dichloromethane (10mL), oxalyl chloride (693.69mg,5.47mmol,478.41uL,1.1eq) was added under nitrogen protection at 0 deg.C, and stirred at this temperature for 30 minutes. Subsequently, a solution of allyl alcohol (317.42mg,5.47mmol,371.68uL,1.1eq) and pyridine (786.01mg,9.94mmol,802.05uL,2eq) in dichloromethane (3mL) was added dropwise. The temperature was raised to 25 ℃ and stirred at this temperature for 12 hours. Upon completion of the reaction, LCMS checked and saturated sodium bicarbonate (30mL) was added to quench the reaction, the organic phase was separated, dried over sodium sulfate, filtered and concentrated to give the crude product. Directly used for the next reaction. Compound 10(0.6g,1.49mmol, 30.01% yield) is a bright yellow solid.

EXAMPLE 8 preparation of Compound 11

Compound 10(5g,12.4mmol) was dissolved in tetrahydrofuran (35mL), and benzylamine (2.71mL,24.8mmol) was added. The resulting mixture was stirred at 25 ℃ for 12 hours. The solvent is concentrated and the column chromatography is carried out to obtain the compound 11.

EXAMPLE 9 preparation of Compound 12

Compound 11(1g,2.78mmol) was dissolved in dry dichloromethane (20mL), trichloroacetonitrile (1.4mL,13.9mmol) was added at 0 deg.C under nitrogen, and stirring was continued at 0 deg.C for 15 min. The base DBU (. about.0.2 mL) was then added and stirring was continued for 4 hours. Concentrating the solvent, and purifying the crude product by column chromatography to obtain the compound 12.

EXAMPLE 10 preparation of Compound 13

Compound 12(1.0g,1.99mmol) and previously dried 4A molecular sieve were added to dry dichloromethane (30mL), stirred under nitrogen for 1 hour, compound 6(1.33g,2.46mmol) was added, and stirring was continued for 1 hour. TMSOTf (36mL,0.199mmol) was then added and stirred at 25 ℃ for 40 min. Solid sodium bicarbonate (400mg) was added, stirred for 20min and filtered. The filtrate is concentrated and purified by column chromatography to obtain the compound 13.

EXAMPLE 11 preparation of Compound 14

Compound 13(0.510g,1.33mmol) was dissolved in anhydrous acetonitrile (7mL), cooled to 0 deg.C, then the catalyst tetrakistriphenylphosphine palladium (0.155g,0.132mmol) was added, and pyrrolidine (0.12mL,1.34mmol) was slowly added after nitrogen substitution. The reaction was warmed to room temperature, filtered after one hour, and the filtrate was concentrated to dryness to give the crude product, which was then dissolved in ethyl acetate (20mL) and water (20 mL). The aqueous phase was acidified to pH 2 with acidic resin and extracted with ethyl acetate (20 mL). The organic phase was concentrated to give compound 14.

EXAMPLE 12 preparation of Compound 15

Compound 14(1.4g,1.84mmol) and sodium carbonate (0.59g,5.52mmol) and methanol (40mL) were added to the reaction flask and the resulting suspension was stirred at 25 ℃ for 8 hours. The reaction mixture was cooled to 0-5 ℃ and acidified with acetic acid (0.53 mL). Heating to 25 deg.C, and concentrating. And (3) separating the crude product, and freeze-drying to obtain the compound 15.

Example 13 preparation of IMA-1

Compound 15(5g,6.97mmol) was dissolved in dichloromethane (30mL) and trifluoromethanesulfonic acid (5mL) was added dropwise at 0 ℃. The temperature was raised to 25 ℃ and then stirred for 5 hours. Concentrating to obtain crude product, and purifying to obtain compound IMA-1 with molecular formula component C₂₇H₂₇N₃O₁₀S₂. Through detection: the molecular weight is 617.65.

Obtaining the excimer ions ([ M + H ] of M/z 618.1184 in the first-order full-scanning mass spectrum]⁺) The major fragment ions were obtained as m/z 468.0953, 442.0876 (neutral loss glucuronic acid), 420.1284, 306.0368, 292.0641, 244.0977, 228.1027, 156.0124 and 137.0605.

Active examples

The animal models and methods of measurement of various research indices used in the following examples:

experimental animals: wild type mice (purchased from Beijing Huafukang Biotech GmbH) of 8-10 weeks old, 24-27 g in body weight and male strain C57BL/6 in background were selected.

Animal feeding, all experimental mice are fed in SPF grade experimental animal center of Wuhan university. The SRF-grade mouse feed was purchased from Beijing Huafukang Biotech GmbH. Feeding conditions are as follows: the room temperature is 22-24 ℃, the humidity is 40-70%, the illumination time is 12h with alternating light and shade, and the drinking water can be freely taken.

L02, human liver cell line, purchased from cell banks of Chinese academy of sciences, catalog number GNHu 6. Cells were cultured in DMEM high-glucose medium (containing 10% FBS, 1% penicillin-streptomycin). And (3) culture environment: 37 ℃ and 5% CO₂。

1. Mouse liver ischemia reperfusion (I/R) damage model construction and material drawing detection:

mice were fasted 12h before surgery and had free access to water. After the mice were anesthetized with 3% sodium pentobarbital before surgery, they were stood flat to immobilize the limbs, the abdominal region of the mice was shaved with a shaver, and the region was sterilized with 10% iodine tincture and 75% ethanol.

An incision is made in the middle of the abdomen to expose the hepatic pedicle of the left and middle lobes of the liver. The portal vein and hepatic artery of the middle and left lobes were clamped with non-invasive vascular clamps to ischemia about 70% of the liver to prevent severe mesenteric venous congestion. After 0.5min, the blocked leaves were seen to turn white compared to the non-blocked right leaves, indicating successful blocking. The ischemia onset time was recorded and maintained for 60 minutes, and the Sham group (Sham group) mice did not undergo liver blood flow blockage.

Removing the vascular clamp after 60min of ischemia, recovering the blood flow of the ischemic liver, closing the abdominal cavity, suturing, and separately feeding the mice after the operation in a clean cage for observation.

Material taking: mice in a Sham operation group (Sham group) and an ischemia reperfusion group were anesthetized with 3% pentobarbital sodium at 6h after operation, 1mL of blood was taken from the orbital venous plexus, and serum was isolated. Meanwhile, the left lobe tissue of the liver in the ischemic area is uniformly taken and placed in liquid nitrogen for quick freezing or fixed in 10% neutral formalin for 24 hours, and then dehydrated, embedded and made into paraffin sections.

Separating serum: the EP tube from which the blood was collected was allowed to stand at room temperature for 1-2 hours to allow the blood to coagulate naturally. Centrifuging at 4 deg.C and 4000rpm/min for 30min, separating serum, and storing in refrigerator at-80 deg.C.

The evaluation indexes of the severity of the liver ischemia-reperfusion injury mainly comprise liver necrosis area, liver function indexes (AST and ALT), inflammatory reaction, cell death and the like, and are positively correlated with the severity of the liver ischemia-reperfusion injury.

(1) The ALT and AST content of the mouse serum is measured by a full-automatic biochemical analyzer (Sysmex, Chemix 180i), and the steps are as follows:

1) taking a serum sample out of a refrigerator at the temperature of-80 ℃, quickly placing the serum sample on ice, and waiting for the sample to melt at room temperature;

2) serum from the EP tube wall was allowed to accumulate to the bottom of the tube by centrifugation at 4000rpm for 1 minute at room temperature.

3) According to the operation procedure, the fully automatic biochemical analyzer (Sysmex, Chemix 180i) was turned on and the sample injector was cleaned.

4) And (4) putting the EP tubes to be detected one by one according to the marking sequence of the sample plates of the full-automatic biochemical analyzer.

5) Accurately installing a reagent detection disc, and starting to detect the ALT and AST levels by using a full-automatic biochemical analyzer.

(2) Preparation of paraffin section and HE staining

Preparing a paraffin specimen section: the main operation procedures comprise: embedding frame treatment → flowing water washing → dehydration → transparence → wax soaking → embedding → slicing → spreading piece → airing or baking for standby. Cut 5 μm paraffin sections using the standard procedure of a paraffin slicer.

The HE dyeing method mainly comprises the following steps: baking at 55 ℃ for 30min → xylene for 5min, 3 times → 100% alcohol for 1min → 95% alcohol for 1min → 70% alcohol for 1min → double distilled water for 1min → hematoxylin solution for 5min → water washing for 1min → 1% alcohol hydrochloride for 1s → water washing for 1min → Scott solution (sodium bicarbonate for 0.35g, magnesium sulfate for 2g, distilled water for 100mL) for 1min → water washing for 1min → eosin solution for 3-5min → distilled water for washing away floating color → 70% alcohol for 1s → 95% alcohol for 1s → 100% alcohol for 30s, 3 times → xylene for 2min, 3 times → xylene for 3 times → immediate sealing piece before xylene drying → ventilation for drying, and taking a picture by microscope.

(3) RT-PCR detection of content of inflammation-related factor mRNA

Extraction of RNA from tissue

Firstly, taking 100mg of tissue, putting the tissue into a 1ml glass homogenizer, adding 1ml of TRizol, grinding in an ice bath, transferring the suspension into a 1.5ml centrifuge tube, and standing for 5min at room temperature to completely dissociate the nucleoprotein from the nucleic acid;

② centrifuging at 12000r/min at 4 ℃ for 5min, taking supernatant, adding 200 mul chloroform, shaking by a vortex mixer for 30s, and standing on an ice box for 10 min;

③ centrifuging at 12000r/min at 4 ℃ for 15min, taking supernatant, adding 0.5ml of isopropanol, fully and uniformly mixing, standing on an ice box for 10min to ensure that RNA is fully precipitated;

fourthly, centrifuging the mixture for 15min at the temperature of 4 ℃ and the speed of 12000r/min, removing supernatant, adding 1ml of precooled 75% ethanol, and shaking the mixture by a vortex mixer for 30s to wash RNA sediment;

fifthly, centrifuging at 12000r/min at 4 ℃ for 5min, removing supernatant, and quickly air-drying the precipitate. The extracted RNA is dissolved by adding a proper amount of DEPC deionized water.

Extraction of RNA from cells

The cells were collected and washed 2 times with PBS buffer, after which 1ml TRizol was added, pipetted evenly with a sample applicator, sucked into a 1.5ml centrifuge tube, shaken for 30s with a vortex mixer, and left to stand at room temperature for 5min to completely dissociate the nucleoprotein from the nucleic acid. The rest operation steps are the same as the RNA extraction in the tissue II-V.

Reverse transcription

Reverse transcription experiments were performed using the Transcriptor First Strand cDNA Synthesis Kit (04896866001, Roche, Basel, Switzerland) reverse transcription Kit according to the Kit instructions.

2. Mouse acute Lung Injury (Actue Lung Injury, ALI) model construction and material drawing detection:

anesthetizing a mouse with isoflurane by using an anesthesia machine, after the mouse breathes uniformly, injecting 200 mu L of LPS (Escherichia coli 055: B5, 10mg/kg) by using an aerosol micro-injector (Penn-Century) through the lung, keeping the body position of the mouse for 5 minutes after administration, preventing liquid backflow, carefully observing whether the liquid overflows or not, making a corresponding record, and if the overflow is obvious, adding a corresponding dose. The mice were then placed supine in a 28 ℃ incubator until the mice recovered from anesthesia. Sham group mice were given equal volumes of saline.

After stimulation for 6h, pentobarbital sodium (50mg/kg) is injected into the abdominal cavity of an anesthetized mouse, the left lung is taken for HE staining, and the right lung is used for detecting the content of inflammation-related factor mRNA.

3. Constructing a mouse myocardial hypertrophy model and detecting the obtained material:

an aortic arch constriction (AB) operation is adopted to construct a cardiac hypertrophy model, a mouse is anesthetized with 3% sodium pentobarbital before an operation, the next operation is carried out after a trachea cannula is successfully connected with a breathing machine, and the body temperature of the mouse is maintained at about 37 ℃ by a heating pad in the whole operation process.

The right lateral position was taken, the surgical area of the mice was shaved with a shaver, and the skin of the surgical area was disinfected with iodine and 75% alcohol by volume. Opening the chest cavity at the level of the 2 nd to 3 rd ribs, poking the left lung slightly with a cotton swab, dissociating the aortic arch to descend, passing 7 to 0 surgical suture through the blood vessel, parallelly placing a section of 26G (25.0 to 27.5G mice) or 27G (23.5 to 25.0G) syringe needle above the blood vessel, tying the blood vessel and the needle together, and then drawing out the needle to achieve the corresponding degree of blood vessel constriction. After the ligation was completed, the thoracic cavity was sutured in order, closed, and 1cc of air was withdrawn from the sutured opening by using a syringe to recover the negative pressure in the thoracic cavity. The Sham group (Sham) was threaded only after the aortic descending branch was released and not ligated, and the rest of the procedure was the same as the AB model group for cardiac hypertrophy.

And 4 weeks after operation, weighing the mouse heart, pathologically staining the mouse heart, and detecting the mRNA content of mouse cardiac hypertrophy markers Anp, Myh7 and fibrosis related gene ColI.

Sirius Red (PSR) staining:

the method mainly comprises the following steps: baking at 55 ℃ for 30min → xylene for 2min, 3 times → 100% alcohol for 1min → 95% alcohol for 1min → 70% alcohol for 1min → flowing water for 10min → double distilled water for 1min → 0.2% phosphomolybdic acid for 2min → 0.1% scarlet pennisetum picric acid solution is dropped on the tissue, staining in a wet box for 90min → removing the residue → 0.01N hydrochloric acid for 4s → 70% alcohol for 1 time → 90% alcohol for 1 time → 100% alcohol for 30s, 3 times → xylene for 2min, 3 times → immediately coverslipping the slide while xylene is not dry, and taking a picture by a microscope.

4. Staining with cell oil red O:

1) adherent L02 cells were washed 2 times with 1 XPBS and fixed for 20min with 300. mu.l of 3% paraformaldehyde;

2) washing with 1 × PBS for 2 times, adding 60% isopropanol, and rinsing for 10 s;

3) washing with 1 × PBS for 2 times, and drying in a fume hood;

4) adding oil red O into 500 mul of each hole for dyeing for 1 h;

5) washing with 1 × PBS for 2 times, sorting with 60% isopropanol, and washing with 1 × PBS for 2 times; and (6) microscopic examination and photographing.

Activity example 1IMA-1 is effective in reducing liver function impairment due to ischemia-reperfusion

To investigate the protective effect of IMA-1 on post-ischemic liver reperfusion, C57 mice were randomly divided into 4 groups (Vehiclesham, IMA-1Sham, Vehicle I/R, IMA-1I/R) of 8 mice each. Mice in IMA-1Sham group and IMA-1I/R group were administered 3mg/kg of Vehicle-1, Vehicle Sham group and Vehicle I/R group dissolved in Vehicle (DMSO: Solutol: PEG400: water: 5:10:20:65(v: v: v: v), the same volume of Vehicle solvent by tail vein injection, and after completion of administration, Sham surgery or I/R surgery, respectively, was performed. And 6h later, taking serum of each group of mice, carrying out ALT and AST detection, taking liver tissues, and carrying out HE staining and mRNA content detection of inflammation related factors so as to evaluate the liver injury condition and the inflammation condition in the liver tissues.

The RT-PCR primers used were as follows:

ALT and AST detection results are shown in FIGS. 1A and 1B, the ALT and AST contents of the two Sham groups are lower, and no significant difference exists between the two groups. After I/R operation, ALT and AST contents of the IMA-1I/R group and the Vehicle I/R group are obviously increased, but the elevation degree of the IMA-1I/R group is obviously lower than that of the Vehicle I/R group.

The HE staining results are shown in FIG. 2, and it can be seen by microscope that the liver tissues of the two Sham groups are basically normal, the structures of the liver tissues are neat, and no obvious fibrous tissue proliferation exists. The two I/R groups have fuzzy liver tissue structures and disordered arrangement, necrotic foci with different sizes and irregular shapes exist in the I/R groups, the structures of liver cells in the necrotic foci are fuzzy, the arrangement is disordered, and typical necrotic changes of liver cell nuclei occur, so that the nucleus consolidation can be seen. Compared with the Vehicle I/R group, the area of the necrotic foci in the IMA-1I/R group is obviously reduced, and the integrity of the hepatocyte structure and the phenomenon of the fixation and shrinkage of hepatocyte nuclei are effectively relieved.

The result of detecting the content of the inflammation-related factor mRNA in the liver tissue is shown in figure 3, and compared with the Vehicle I/R group, the expression of I/R-induced inflammatory factors and chemokines can be effectively inhibited after IMA-1 administration.

The results show that IMA-1 can obviously inhibit liver injury caused by ischemia reperfusion, relieve hepatocyte apoptosis, inhibit inflammatory cell infiltration and protect liver function.

Activity example 2IMA-1 inhibits LPS-induced acute Lung injury

The C57 mice were randomly divided into 4 groups (Vehicle Sham group, IMA-1Sham group, Vehicle LPS group, IMA-1LPS group) of 8 mice each. Mice in IMA-1Sham group and IMA-1LPS group were given 3mg/kg of IMA-1 dissolved in Vehicle by tail vein injection, and the Vehicle Sham group and the Vehicle LPS group were given equal volumes of Vehicle solvent. After completion of administration, physiological saline or LPS stimulation was given, respectively. And taking lung tissues of the mice after 6h, and respectively carrying out HE staining and mRNA content detection of inflammation related factors.

The RT-PCR primers used were as follows:

the HE staining results are shown in FIG. 4, the two Sham groups stimulated by normal saline have complete alveolar tissue structures, no exudates exist in alveolar cavities, a large number of neutrophils and erythrocytes are exuded into alveoli after being stimulated by LPS, and the alveolar walls form transparent membranes, and meanwhile, obvious bleeding points are visible, which indicates that the LPS stimulation can induce remarkable lung injury. Compared with the Vehicle LPS group, the infiltration amount of inflammatory cells and the area of bleeding points of the IMA-1LPS group are remarkably reduced.

The result of detecting the inflammation-related factor mRNA in the lung tissue is shown in FIG. 5, the content of the inflammation-related factor mRNA in the lung tissue is obviously increased after LPS stimulation, but the increase degree of the IMA-1LPS group is obviously lower than that of the Vehicle LPS group.

The above results indicate that IMA-1 significantly inhibited LPS-induced acute lung injury.

Activity example 3IMA-1 inhibits the development of myocardial hypertrophy

C57 mice were randomly divided into 4 groups (Vehicle Sham group, IMA-1Sham group, Vehicle AB group, IMA-1AB group) of 8 mice each. Mice in IMA-1Sham and IMA-1AB groups were given 3mg/kg of Vehicle-1 dissolved in Vehicle by tail vein injection, and the Vehicle Sham and IMA-1Sham groups were given equal volumes of Vehicle solvent. After the administration, a sham or AB surgery was performed, respectively. After 4W, the weight of each group of mice was weighed. After the completion, heart tissues of all groups of mice are taken and weighed, and the heart-weight-to-body weight ratio (HW/BW) is calculated; embedding the heart tissue, performing HE and PSR staining, and detecting the contents of cardiac hypertrophy marker Anp, Myh7 and mRNA of fibrosis related gene ColI in the heart tissue to evaluate the severity of cardiac hypertrophy and fibrosis of mice.

The RT-PCR primers used were as follows:

HW/BW detection results are shown in FIG. 6, the HW/BW of mice in the Vehicle Sham group and the IMA-1Sham group are not significantly different, the HW/BW is significantly increased after AB operation, and the degree of increase of mice in the IMA-1AB group is significantly lower than that of mice in the Vehicle AB group, which indicates that IMA-1 can significantly inhibit the increase of heart weight caused by AB operation.

Further HE staining and PSR staining results indicated that after IMA-1 administration, both cardiomyocyte hypertrophy and cardiac fibrosis induced by AB surgery were inhibited, and both cardiomyocyte cross-sectional area and left ventricular collagen area were significantly reduced (fig. 7A, 7B and 7C).

The mRNA content detection results are shown in FIGS. 8A, 8B and 8C, and the mRNA content of the mouse myocardial hypertrophy marker Anp, Myh7 and fibrosis related gene ColI in the IMA-1AB group is obviously lower than that in the Vehicle AB group.

The results show that IMA-1 can obviously inhibit the occurrence and development of myocardial hypertrophy and fibrosis.

Activity example 4IMA-1 inhibits hepatocyte lipid deposition

Adherent L02 cells were divided into 2 groups: the Vehicle stimulation group and the IMA-1 stimulation group. IMA-1(10 mu m) is added into an IMA-1 stimulation group, a Vehicle solvent with the same volume is added into a Vehicle stimulation group, Palmitate (PA) and Oleic Acid (OA) (PA 0.5mM + OA 1mM) are added into the two groups after 24h, and oil red O staining and inflammation-related factor mRNA content detection are carried out after 12 h.

The RT-PCR primers used were as follows:

gene	Forward primer	Reverse primer
			Il6	TCTGGATTCAATGAGGAGACTTG	GTTGGGTCAGGGGTGGTTAT
Tnf	TACTCCCAGGTCCTCTTCAAGG	TTGATGGCAGAGAGGAGGTTG
			Ccl2	GTCTCTGCCGCCCTTCTG	ACTTGCTGCTGGTGATTCTTCT
Cxcl10	GTGGCATTCAAGGAGTACCTC	TGATGGCCTTCGATTCTGGATT

The results of oil red O staining are shown in FIG. 9, and after the PA + OA stimulation was added, the IMA-1 stimulation group had red cells stained with oil red O and the stained area was smaller than that of the Vehicle stimulation group.

The results of the detection of the content of the inflammation-related factor mRNA are shown in FIG. 10, and compared with the Vehicle stimulation group, the expression levels of the mRNA of the genes Il6, Tnf, Ccl2 and Cxcl10 of the inflammation-related factor in the IMA-1 stimulation group are all obviously reduced.

The results show that IMA-1 can inhibit lipid deposition and inflammatory reaction of L02 cells stimulated by PA + OA, and can be used for treating nonalcoholic fatty liver disease and steatohepatitis.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A compound of formula (I) or a pharmaceutically acceptable salt thereof:

2. a process for the preparation of a compound of formula (I), a pharmaceutically acceptable salt thereof, as claimed in claim 1, which comprises:

(1) reacting compound 5 with (Boc)₂O reaction to obtain compound 6

(2) Reacting compound 12 with compound 6 prepared in step (1) to obtain compound 13

(3) Carrying out deprotection and decarboxylation reaction on the compound 13 to obtain IMA-1

3. The process according to claim 2, wherein in the step (1), the reaction is carried out in a tetrahydrofuran solvent in the presence of triethylamine.

4. The method of claim 2, wherein in step (2), compound 12 is reacted in a dichloromethane solvent under the action of a 4A molecular sieve.

5. The method of claim 4, wherein the reaction is carried out under an inert gas blanket.

6. The method of claim 5, wherein the reaction is conducted under a nitrogen blanket.

7. The process of claim 4, wherein TMSOTf and solid sodium bicarbonate are added to the reaction to obtain Compound 13.

8. The method according to claim 2, wherein the step (3) comprises the following specific steps:

(3.1) deprotection of Compound 13 in the presence of a catalyst to obtain Compound 14

(3.2) decarboxylation of Compound 14 to give Compound 15

(3.3) deamination of Compound 15 to obtain IMA-1

9. The process according to claim 8, wherein in step (3.1), the catalyst is tetraphenylphosphine.

10. The process of claim 8, wherein in step (3.1), the reaction condition is that the solvent is acetonitrile.

11. The method of claim 10, wherein the solvent is anhydrous acetonitrile.

12. The method according to claim 8, wherein in step (3.1), pyrrolidine is added to the system.

13. The process according to claim 8, characterized in that in step (3.2), the decarboxylation is carried out in the presence of sodium carbonate and methanol and is acidified with acetic acid.

14. The method of claim 2, wherein compound 6 is prepared by the following scheme:

15. the method of claim 2, wherein compound 12 is prepared by the following scheme:

16. the method according to claim 2, characterized in that said compound IMA-1 is obtained in particular by:

17. the method of claim 2, wherein the pharmaceutically acceptable salt is synthesized from the parent compound comprising a basic or acidic moiety.

18. The process according to claim 17, characterized in that the pharmaceutically acceptable salts are prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent or a mixture of both.

19. A pharmaceutical composition comprising a compound of formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof.

20. The pharmaceutical composition of claim 19, further comprising a pharmaceutically acceptable excipient.

21. The pharmaceutical composition of claim 19, wherein the pharmaceutical composition is in the form of an oral formulation or an injectable formulation.

22. The pharmaceutical composition of claim 21, wherein the pharmaceutical composition is a tablet, capsule, pill, powder, granule, suspension, syrup, injection, or powder injection.

23. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof according to claim 1 for the manufacture of a medicament for the treatment and/or prevention of ischemia reperfusion injury and related diseases, acute respiratory distress syndrome and related diseases, acute lung injury and related diseases, pathological myocardial hypertrophy and related diseases and/or fatty liver disease and related diseases.

24. The use according to claim 23, wherein the medicament is in the form of an oral or injectable formulation.

25. The use according to claim 24, wherein the medicament is a tablet, capsule, pill, powder, granule, suspension, syrup, injection or powder injection.

26. The use according to claim 23, wherein the ischemia-reperfusion injury and related disease is liver ischemia-reperfusion injury and related disease, cardiac ischemia-reperfusion injury and related disease, renal ischemia-reperfusion injury and related disease, and/or brain ischemia-reperfusion injury and related disease.

27. The use according to claim 26, wherein the causative agent of hepatic ischemia-reperfusion injury and related disease is selected from: liver cyst, liver transplantation, thrombolytic therapy, hepatic portal block surgery, hepatic coma, liver failure, and liver inflammatory diseases.

28. The use according to claim 26, wherein the causative agent of cardiac ischemia-reperfusion injury and related disease is selected from: myocardial infarction, myocardial infarction recanalization injury, heart transplantation, coronary thrombolysis, percutaneous coronary angioplasty, intracoronary dilatation, coronary bypass.

29. The use of claim 26, wherein the causative agent of renal ischemia-reperfusion injury and related disease is selected from the group consisting of: kidney transplantation, kidney cyst, renal vascular surgery.

30. The use according to claim 26, wherein the causative factor of cerebral ischemia-reperfusion injury and related diseases is selected from the group consisting of: apoplexy and cerebrovascular operation.

31. The use according to claim 23, wherein said acute respiratory distress syndrome and related disorders, or the causative factor of acute lung injury and related disorders, is selected from the group consisting of: direct lung injury factors, indirect lung injury factors.

32. The use according to claim 31, wherein the direct lung injury factor is selected from the group consisting of: severe lung infection, aspiration pneumonia, pulmonary or thoracic contusion, aspiration of toxic gases.

33. The use of claim 31, wherein the indirect lung injury factor is selected from the group consisting of: sepsis, severe pancreatitis, amniotic fluid embolism, mass blood transfusion.

34. The use according to claim 23, wherein the causative agent of pathological myocardial hypertrophy and associated disease is selected from the group consisting of: cardiac remodeling, myocardial infarction, heart failure, arrhythmia, hypertension, coronary heart disease, arterial embolism, angina pectoris, and cardiac conduction block.

35. The use of claim 34, wherein the cardiac remodeling is ventricular remodeling.

36. The use of claim 23, wherein the causative agent of fatty liver disease and related disorders is selected from the group consisting of: simple steatosis, non-alcoholic steatohepatitis, alcoholic fatty liver disease, hepatic fibrosis, liver cirrhosis, hepatocarcinoma, obesity, hyperlipidemia, hyperglycemia, insulin resistance, and diabetes.