CN109680074B

CN109680074B - Method for judging success or failure of cow artificial fertilization based on integrin expression

Info

Publication number: CN109680074B
Application number: CN201811585965.6A
Authority: CN
Inventors: 麻柱; 郭勇; 王彦平; 王相国; 刘林; 李艳华; 吕小青
Original assignee: BEIJING DAIRY CATTLE CENTER; Beijing University of Agriculture
Current assignee: BEIJING DAIRY CATTLE CENTER; Beijing University of Agriculture
Priority date: 2018-12-24
Filing date: 2018-12-24
Publication date: 2022-03-22
Anticipated expiration: 2038-12-24
Also published as: CN109680074A

Abstract

The invention relates to a method for judging success or failure of cow artificial fertilization based on integrin expression, which researches the integrin alpha v beta 3 expression change rule before and after conception of cows, explores the relation between the integrin alpha v beta 3 expression change rule and early pregnancy of cows, screens factors influencing the early pregnancy, and further develops a detection kit for early pregnancy detection of cows. The method for judging whether the artificial fertilization of the dairy cow is successful or not based on the expression of the integrin, which is provided by the invention, advances the pregnancy detection window of the dairy cow to the 16 th day after insemination, and advances the pregnancy detection window by 12 days compared with the current common method, thereby effectively reducing the breeding cost of the dairy cow breeding industry, improving the utilization efficiency of cows in the dairy cow industry and increasing the economic income.

Description

Method for judging success or failure of cow artificial fertilization based on integrin expression

Technical Field

The invention relates to the technical field of molecular biology and genetic breeding, in particular to a method for judging success or failure of cow artificial fertilization based on integrin expression.

Background

The breeding efficiency has direct influence on the production of dairy cows in a pasture, the early pregnancy diagnosis is carried out on the dairy cows after a period of insemination, if related technologies exist, the earlier the period is, the more the early the period is, the more the dairy cows can be distinguished whether the dairy cows are pregnant, thereby necessary fetus protection measures can be carried out on the pregnant dairy cows in advance, secondary insemination is carried out on the non-pregnant dairy cows, and the frequently-bred non-pregnant dairy cows are eliminated. At present, the cost of the cows in the pregnancy mainly comprises feed and manpower, each cow is 25 yuan per day, and the unnecessary expenditure of 25 yuan in the farm is avoided when the failure of pregnancy of one cow is detected every day in advance, so that the economic income of the cow farm is increased.

The common methods for pregnancy detection include rectal palpation, ultrasonography and other clinical diagnosis methods, and progesterone, early pregnancy factor and other immunodiagnosis methods. The above detection methods are different in terms of detection objects, detection cost, operation difficulty, damage to the detection objects, and the like, but the earliest is 28 days after insemination in terms of the time of the detection window. During the implantation of the bovine embryo, the establishment of uterine receptivity occurs from 10 th to 20 th days after insemination, and the integrin alphavbeta 3 is likely to change the expression level of mRNA in the period. If the conception rate is related to the expression level of the integrin alpha v beta 3 at the mRNA level, the relationship is probably the theoretical basis for advancing the detection window of early pregnancy of the cow to 10-18 days.

Integrin alphavbeta 3 is a heterodimer transmembrane glycoprotein, has a main function of combining ligand-mediated interaction between cells and extracellular matrix, and has an important role in early pregnancy of cows through research and discovery. The study related to the embryo implantation process proves that the integrin alpha v beta 3 participates in the establishment of endometrial receptivity. It is currently proposed in human clinics that the detection of integrin α v β 3 and its ligand discriminate between receptive and non-receptive states of the uterus. The establishment of uterine receptivity is an important factor in the success of pregnancy, and pregnancy failure is most likely to occur at this stage. Therefore, successful pregnancy detection at this stage is significant and many pregnancy failures can be detected.

Disclosure of Invention

In order to advance the pregnancy detection time of the dairy cow and reduce the cost of a cattle farm, the invention provides a method for judging whether the artificial fertilization of the dairy cow is successful or not based on the expression of integrin, which comprises the following steps:

step S1: periodically extracting blood of the cow after artificial insemination every day within 20 days after artificial insemination of the cow, or extracting only blood of 10 th, 13 th, 16 th and 19 th days after insemination;

step S2: extracting DNA from the blood;

step S3: designing an alpha v gene primer and a beta 3 gene primer;

step S4: performing PCR amplification on the DNA extracted in step S2 by using the primers designed in step S3;

step S5: measuring the relative expression quantity of the alpha v gene and the beta 3 gene of the amplified DNA and the expression level of the alpha v gene and the beta 3 gene protein, and judging whether the dairy cow is successfully fertilized according to the measurement result; the judgment principle of step S5 includes:

if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on day 13 is obviously improved compared with that of the amplified DNA corresponding to the cow blood on day 10, the cow is successfully fertilized, and if the relative expression quantity of the alpha v gene is not greatly changed, the cow is not successfully fertilized.

Wherein, the judgment principle in the step S5 further includes:

if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on the 16 th day is not obviously changed compared with the amplified DNA corresponding to the cow blood on the 13 th day, the cow is successfully fertilized, and if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on the 16 th day is almost not changed compared with the amplified DNA corresponding to the cow blood on the 13 th day, the cow is not successfully fertilized;

if the relative expression quantity of the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is obviously improved compared with that of the amplified DNA corresponding to the cow blood on the 13 th day, the cow is successfully fertilized, and if the relative expression quantity of the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is almost not existed compared with that of the amplified DNA corresponding to the cow blood on the 13 th day, the cow is not successfully fertilized;

if the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is obviously improved compared with the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 10 th day, the cow is successfully fertilized; if the protein expression level of the α v gene or β 3 gene of the amplified DNA corresponding to the cow blood on day 16 is almost zero compared to the protein expression level of the α v gene or β 3 gene of the amplified DNA corresponding to the cow blood on day 10, the cow is not successfully fertilized.

Wherein, in the step S2, the method for extracting DNA comprises:

step S21, homogenization: taking 1mL of frozen bovine whole blood, adding 3mL of erythrocyte lysate, mixing, standing at room temperature for 10 minutes, centrifuging at 10000rpm for 1 minute, sucking and removing supernatant, and collecting erythrocyte precipitate;

step S22, layering: adding 500uL Trizol solution into the collected erythrocyte sediment, standing for 5 minutes at room temperature to fully dissolve the erythrocyte sediment, adding 200uL chloroform, shaking uniformly, and standing for 3 minutes at room temperature;

step S23, precipitating RNA: centrifuging the sample finally obtained in the step S22 at 12000rpm for 10 minutes to obtain a sample divided into three layers, transferring the uppermost layer of water phase, adding 400uL of glacial ethanol into the transferred uppermost layer of water phase, standing at room temperature for 10 minutes, centrifuging at 12000rpm at 4 ℃ for 10 minutes, and taking a tube bottom precipitate, namely RNA;

step S24, rinsing RNA pellet: adding 75% ethanol solution into the RNA precipitate obtained in the step S23, oscillating and suspending, centrifuging at 6000rpm at 4 ℃ for 1 minute, removing supernatant, and air-drying the precipitate at room temperature;

step S25: adding 50uL of enzyme-free sterile aqueous solution into the RNA precipitate obtained in the step S24 to dissolve the RNA precipitate;

step S26: the dissolved RNA is subjected to reverse transcription to synthesize DNA.

Wherein, in step S26, the reverse transcription system for synthesizing DNA by reverse transcription of RNA comprises: 1ug volume of RNA, 1uL nucleotide chain primer, 4uL reverse transcriptase buffer solution, 2uL deoxynucleotide mixture, 1uL reverse transcriptase, 1uL recombinant RNA inhibitor and the balance of nuclease-free treated water, wherein the total volume of the reverse transcription system is 20 uL.

Wherein, in the step S3, the designed α v gene primer includes: the upstream primer of the alpha v gene is alpha v-F: 15859 caagagcagcgaggactttg, and downstream primer of α v gene α v-R: gccgataaacacatatgcgt, respectively; the designed beta 3 gene primer comprises: beta 3 gene upstream primer beta 3-F: tggggctgatgactgagagaag and a downstream primer beta 3-R of the beta 3 gene: acgcacttccagctctat are provided.

Wherein, in the step S4, the PCR amplification conditions include:

step S41: pre-denaturation at 95 ℃ for 10 minutes;

step S42: deformation at 95 ℃ for 10 seconds, annealing at 59 ℃ for 30 seconds, and extension at 72 ℃ for 32 seconds, for a total of 40 cycles;

step S43: extension at 95 degrees celsius for 15 seconds, 60 degrees celsius for 1 minute, 95 degrees celsius for 15 seconds, 60 degrees celsius for 15 seconds.

The method for judging whether the artificial fertilization of the dairy cow is successful or not based on the expression of the integrin, which is provided by the invention, advances the pregnancy detection window of the dairy cow to the 16 th day after insemination, and advances the pregnancy detection window by 12 days compared with the current common method, thereby effectively reducing the breeding cost of the dairy cow breeding industry, improving the utilization efficiency of cows in the dairy cow industry and increasing the economic income.

Drawings

FIG. 1: the relative expression quantity of the alpha v gene of the pregnant cow at different time.

FIG. 2: the relative expression quantity of the alpha v gene of the non-pregnant cow at different time.

FIG. 3: the relative expression quantity of the beta 3 gene of the pregnant cow at different time.

FIG. 4: the relative expression quantity of the beta 3 gene of the non-pregnant cow at different time.

FIG. 5: the protein expression level of the alpha v gene and the beta 3 gene of the pregnant cow and the non-pregnant cow at different time.

Detailed Description

In order to further understand the technical scheme and the advantages of the present invention, the following detailed description of the technical scheme and the advantages thereof is provided in conjunction with the accompanying drawings.

The invention researches the expression change rule of the integrin alpha v beta 3 of the dairy cattle before and after conception, explores the relation between the integrin alpha v beta 3 and the early pregnancy of the dairy cattle, screens factors influencing the early pregnancy, and further develops a detection kit for detecting the early pregnancy of the dairy cattle.

Sample selection and blood collection method

Selecting a standard dairy farm, selecting 10 female cows, and requiring that: in 2015, the birth is carried out, the weight is similar, the infertility and other diseases are caused, the conception is the second fetus, the estrus is in the same period, the insemination date is the same day, and the observation and the record are continued after the insemination to determine whether the conception is carried out.

Prepare 10 syringes of 5mL and replace 9 gauge needle, several alcohol cotton balls, 10 violet heads and 10mL anticoagulation tubes. Filling, clamping and fixing the head of the cow, holding the middle part of the cow tail by a left hand, lifting, disinfecting a sunken part which is 10cm away from the root of the cow tail by using an alcohol cotton ball, then puncturing 0.5-1 cm by using a 5mL syringe with a 9-gauge needle head for blood drawing, pressing for hemostasis after the blood drawing is finished, and injecting the collected blood into an anticoagulation tube.

Second, primer design and treatment

The CDs sequence of the relevant gene is searched by using NCBI, a primer sequence is designed through primer 3.0, and then the primer sequence is input into BLAST for specificity detection, and a primer is determined. The specific information of the designed primer sequences after determination is as follows: the upstream primer of the alpha v gene is alpha v-F: 158

59caagagcagcgaggactttg, downstream primer alpha v-R of alpha v gene: gccgataaacacatatgcgt, upstream primer beta 3-F of beta 3 gene: tggggctgatgactgagagaag and a downstream primer beta 3-R of the beta 3 gene: acgcacttccagctctatt are provided. The original primer was centrifuged at 3000r/min for 1 min, and ddH was added as described₂And O is added until the molar concentration is 25 mu mol/mL, and the mixture is uniformly mixed by shaking and then subpackaged, and is usually stored at 4 ℃ for later use and at-20 ℃.

Three, Trizol method for extracting RNA and reverse transcription

1. And (3) homogenizing treatment: 1mL of frozen bovine whole blood is taken, 3mL of erythrocyte lysate is added, mixed evenly and stood for 10 minutes at room temperature, 10000rmp is used for centrifugation for 1 minute, supernatant is removed by suction, and erythrocyte sediment is collected.

2. Layering: 500uL Trizol solution is added into the collected erythrocyte sediment, the sample is fully cracked (can be stored at 70 ℃ below zero) after standing for 5 minutes, 200 mu L chloroform is added, shaking is carried out vigorously, and then the mixture is kept standing for 3 minutes at room temperature.

3. RNA precipitation: after centrifugation at 12000rpm for 10 minutes at 4 ℃ the sample was divided into three layers with RNA mainly in the upper aqueous phase, 400. mu.L of the aqueous phase was transferred to a new centrifuge tube (carefully pipetted to avoid contamination) and 400. mu.L of glacial ethanol was added for 10 minutes at room temperature, after which centrifugation at 12000rpm for 10 minutes at 4 ℃ the supernatant was discarded and RNA was precipitated at the bottom of the tube.

4. RNA rinsing: adding 75% ethanol into the RNA precipitate, and suspending the precipitate by mild shaking; centrifuge at 6000rpm for 1 min at 4 ℃ and remove the supernatant by aspiration and air dry at room temperature.

5. RNA dissolution: add 50. mu.L of RNase-free water to flick the tube wall and dissolve the RNA well.

6. Determination of RNA concentration: the OD ratio of the micro ultraviolet spectroscopic detection system is set to be 260/280, and the concentration is measured in the unit of mu g/mu L.

7. cDNA was synthesized by reverse transcription, and the reverse transcription system is shown in Table 1.

Table 1: reverse transcription system

Fourth, fluorescent quantitative PCR

The fluorescent quantitative PCR instrument needs to be turned on for preheating 15 minutes before fluorescent quantitative PCR.

1. The primer stock solution was treated with ddH₂And O, diluting.

2. The upstream and downstream primers are added at different positions of the tube wall, cDNA is added to the bottom of the tube, and fluorescent dye and ddH are added₂O is added in suspension. After the sample is added, a palm centrifuge is used for centrifuging for 15s to ensure that no liquid drop exists on the tube wall and no bubble exists below the liquid level. All the tests are carried out on an ice box, fluorescent dye is added to avoid light, and the EP gloves are replaced when the eight connecting tubes are contacted.

In the present invention, the PCR amplification system and the PCR amplification conditions are shown in tables 2 and 3, respectively.

Table 2: PCR amplification system

Table 3: PCR amplification conditions

Fifth, experimental results

1. Relative expression amount of alpha v Gene

Fig. 1 and fig. 2 show the relative expression level of the α v gene of the pregnant cow and the non-pregnant cow at different time, respectively, as shown in fig. 1 and fig. 2, the α v gene of the successfully pregnant cow is obviously increased on the 13 th day and the 16 th day after insemination, the expression level is higher on the 16 th day, and the expression level is obviously reduced on the 19 th day, but still expressed on the day 13 and the 16 th day. The relative expression of the alpha v gene of the non-pregnant cow has no increasing trend in the 10 th and 13 th days after insemination, and the relative expression of the alpha v gene of the non-pregnant cow is obviously reduced and hardly expressed in the 16 th and 19 th days compared with the 10 th days.

2. Relative expression level of beta 3 Gene

Fig. 3 and 4 show the relative expression level of the beta 3 gene of the pregnant cow and the non-pregnant cow at different time, as shown in fig. 3 and 4, the beta 3 gene of the successfully pregnant cow is obviously increased on the 13 th day, the 16 th day and the 19 th day after the insemination, the beta 3 gene reaches the highest level on the 16 th day, and the beta 3 gene is still higher than the beta 3 gene on the 10 th day after the insemination although the beta 3 gene is in a descending trend on the 19 th day. On the other hand, on the 13 th day after insemination, the beta 3 gene relative expression quantity of the non-pregnant cow is obviously increased compared with the 10 th day, the expression quantity is rapidly reduced on the 16 th day and is obviously lower than the 10 th day, and although the beta 3 gene is increased again on the 19 th day, the beta 3 gene relative expression quantity is still lower than the 10 th day after insemination.

3. Protein expression level of alpha v gene and beta 3 gene

Fig. 5 shows the protein expression levels of the α v gene and β 3 gene of the pregnant cow and the non-pregnant cow at different times, as shown in fig. 5, the protein expression levels of the α v gene and β 3 gene of the pregnant cow are significantly increased at the 16 th day after insemination, while the protein expression levels of the α v gene and β 3 gene of the non-pregnant cow are significantly lower at the 16 th and 19 th days after insemination than at the 10 th and 13 th days.

After analyzing the test results, the expression quantity of the alpha v gene and the beta 3 gene is found to have obvious difference at the 16 th day after insemination, and the difference has certain regularity and can be linked with whether the dairy cow is pregnant or not, namely, the dairy cow with high expression quantity is shown as a pregnant dairy cow in later statistics, and the dairy cow with low expression quantity is an un-pregnant dairy cow in later statistics. In the observation of the relative expression changes of the alpha v gene and the beta 3 gene of the pregnant cow, the pregnant cow shows an ascending trend on the 10 th, 13 th and 16 th days after insemination, the alpha v gene is relatively mild, the beta 3 gene ascends faster, and the expression of the alpha v gene and the beta 3 gene both decline rapidly on the 19 th day. In the change of the relative expression quantity of the alpha v gene and the beta 3 gene of the non-pregnant cow, the expression quantity of the alpha v gene and the beta 3 gene of the pregnant cow is slowly increased or not increased on the 13 th day after insemination, the expression quantity is obviously reduced far lower than the 10 th day on the 16 th day, and the expression quantity is slightly increased but is not obviously increased on the 19 th day. The expression of the alphav and the beta 3 at the protein level is basically consistent with the expression of the alphav and the beta 3 on mRNA by a western blotting method.

In summary, based on the determination method provided by the present invention, the relative gene expression level and protein expression level of the DNA after reverse transcription and amplification can be determined whether the cow is pregnant based on any one of the following principles:

1. if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on day 13 is obviously improved compared with that of the amplified DNA corresponding to the cow blood on day 10, the cow is successfully fertilized, and if the relative expression quantity of the alpha v gene is not greatly changed, the cow is not successfully fertilized. "significantly increased" as used herein means that the relative expression level is increased by more than one time.

2. If the relative expression level of the α v gene of the amplified DNA corresponding to the cow blood on day 16 is not significantly changed from that of the amplified DNA corresponding to the cow blood on day 13, the cow is successfully fertilized, and if the relative expression level of the α v gene of the amplified DNA corresponding to the cow blood on day 16 is almost not changed from that of the amplified DNA corresponding to the cow blood on day 13, the cow is not successfully fertilized. Here, "almost none" means that the relative expression level at day 16 is 5% or less of the relative expression level at day 13.

3. If the relative expression level of the beta 3 gene of the amplified DNA corresponding to the cow blood on day 16 is significantly improved compared with that of the amplified DNA corresponding to the cow blood on day 13, the cow is successfully fertilized, and if the relative expression level of the beta 3 gene of the amplified DNA corresponding to the cow blood on day 16 is almost absent compared with that of the amplified DNA corresponding to the cow blood on day 13, the cow is not successfully fertilized. "significantly increased" as used herein means that the relative expression level is increased by more than one time. Here, "almost none" means that the relative expression level at day 16 is 5% or less of the relative expression level at day 13.

4. If the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is obviously improved compared with the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 10 th day, the cow is successfully fertilized; if the protein expression level of the α v gene or β 3 gene of the amplified DNA corresponding to the cow blood on day 16 is almost zero compared to the protein expression level of the α v gene or β 3 gene of the amplified DNA corresponding to the cow blood on day 10, the cow is not successfully fertilized. "significantly increased" here is to be understood as an increase in the expression level by more than one time. Here, "almost none" means that the expression level at day 16 is 5% or less of the expression level value at day 10.

The invention has the following beneficial effects:

1. according to the method for judging the pregnancy of the dairy cow, the sample collected by detection is a blood sample, so that the method is easy to obtain and has small damage to the body of the dairy cow.

2. The invention adopts a molecular biological detection method, can detect the early pregnancy of the dairy cow when the blood hormone and antibody levels do not reach a certain concentration, and obtains more economic value before the detection time is advanced.

3. The pregnancy detection window of the cow is advanced to 16 days after insemination, which is 12 days earlier than the current common method, so that the breeding cost of the cow breeding industry can be effectively reduced, the utilization efficiency of cows in the cow industry is improved, and the economic income is increased.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that the scope of the present invention is not limited thereto, and those skilled in the art will appreciate that various changes and modifications can be made without departing from the spirit and scope of the present invention.

Claims

1. A method for judging success or failure of cow artificial fertilization based on integrin expression is characterized by comprising the following steps:

step S1: periodically extracting blood of the cow after artificial insemination every day within 20 days after artificial insemination of the cow, or extracting only blood of 10 th, 13 th, 16 th and 19 th days after insemination; step S2: extracting DNA from the blood;

step S3: designing an alpha v gene primer and a beta 3 gene primer;

step S5: measuring the relative expression quantity of the alpha v gene and the beta 3 gene of the amplified DNA and the expression level of the alpha v gene and the beta 3 gene protein, and judging whether the dairy cow is successfully fertilized according to the measurement result; wherein the conception is the second pregnancy of the dairy cow;

the judgment principle of step S5 includes:

if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on day 13 is improved by more than one time compared with the amplified DNA corresponding to the cow blood on day 10, the cow is successfully fertilized, and if the relative expression quantity of the alpha v gene is not changed greatly, the cow is not successfully fertilized;

in step S3, the designed α v gene primer includes: the upstream primer of the alpha v gene is alpha v-F: caagagcagcgaggactttg, and an alpha v gene downstream primer alpha v-R: gccgataaacacatatgcgt, respectively; the designed beta 3 gene primer comprises: beta 3 gene upstream primer beta 3-F: tggggctgatgactgagagaag and a downstream primer beta 3-R of the beta 3 gene: acgcacttccagctctat are provided.

2. The method for determining the success or failure of cow artificial insemination based on integrin expression according to claim 1, wherein the determination rule in step S5 further comprises:

if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on the 16 th day is not obviously changed compared with the amplified DNA corresponding to the cow blood on the 13 th day, the cow is successfully fertilized, and if the relative expression quantity of the alpha v gene of the amplified DNA corresponding to the cow blood on the 16 th day is less than 5% of the relative expression quantity value of the 13 th day compared with the amplified DNA corresponding to the cow blood on the 13 th day, the cow is not successfully fertilized;

if the relative expression quantity of the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is improved by more than one time compared with the amplified DNA corresponding to the cow blood on the 13 th day, the cow is successfully fertilized, and if the relative expression quantity of the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is less than 5 percent of the relative expression quantity of the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day on the 13 th day, the cow is not successfully fertilized;

if the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 16 th day is improved by more than one time compared with the protein expression level of the alpha v gene or the beta 3 gene of the amplified DNA corresponding to the cow blood on the 10 th day, the cow is successfully pregnant; if the protein expression level of the α v gene or β 3 gene in the amplified DNA corresponding to the cow blood on day 16 is less than 5% of the expression level value on day 10 in the α v gene or β 3 gene on day 16 compared to the amplified DNA corresponding to the cow blood on day 10, the cow is not successfully fertilized.

3. The method for determining the success or failure of cow artificial insemination based on integrin expression according to claim 1, wherein: in step S2, the method for extracting DNA includes:

4. The method for determining the success or failure of cow artificial insemination based on integrin expression according to claim 3, wherein: in step S26, the reverse transcription system for synthesizing DNA by reverse transcription of RNA comprises: 1ug volume of RNA, 1uL nucleotide chain primer, 4uL reverse transcriptase buffer solution, 2uL deoxynucleotide mixture, 1uL reverse transcriptase, 1uL recombinant RNA inhibitor and the balance of nuclease-free treated water, wherein the total volume of the reverse transcription system is 20 uL.

5. The method for determining the success or failure of cow artificial insemination based on integrin expression according to claim 1, wherein: in step S4, the PCR amplification conditions include:

step S41: pre-denaturation at 95 ℃ for 10 minutes;