CN109679995A - The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier - Google Patents

The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier Download PDF

Info

Publication number
CN109679995A
CN109679995A CN201811547741.6A CN201811547741A CN109679995A CN 109679995 A CN109679995 A CN 109679995A CN 201811547741 A CN201811547741 A CN 201811547741A CN 109679995 A CN109679995 A CN 109679995A
Authority
CN
China
Prior art keywords
plin2
carrier
bimolecular fluorescence
protein
fluorescence complementary
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811547741.6A
Other languages
Chinese (zh)
Inventor
李佩韦
张薇依
昝林森
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN201811547741.6A priority Critical patent/CN109679995A/en
Publication of CN109679995A publication Critical patent/CN109679995A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of construction methods of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier, with the area the CDs full length amino acid sequence of ox PLIN2, pass through primer of the design PLIN2 on bimolecular fluorescence complementary VN-173 carrier, it is recombinated with pBiFC-VN173 carrier to construct destination protein expression vector, restriction enzyme site selects EcoRI and XbaI enzyme cutting, reaction temperature is 37 DEG C, and increase a base A behind the site EcoRI, frameshift mutation is prevented, ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier pBiFC-VN173-PLIN2 is finally obtained.It, can the more efficient presence expressed and avoid false negative result compared with existing research interactions between protein method.Meanwhile certain verification experimental verification means also are provided further to study and constructing interactions between protein network and improve the integrality of interactions between protein theory.

Description

The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier
Technical field
The invention belongs to molecular biology, cell engineering field, and it is white mutually to be related to a kind of lipocyte differentiation associated protein Make the screening of albumen, specifically, being a kind of construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier.
Background technique
Fat drips (lipid droplets) are the storage places for the neutral fats being wrapped in by imitated vesicle structure, are widely present in machine In all organs of body, it is related with many cell functions, such as energy metabolism balance, the self-protection to Fatty toxicity, signal transduction Deng.The structure of fat drips periphery film is mainly single layer phospholipid molecule layer, has special albumen anchoring structure, neutral fats is (predominantly ATGL, cholesteryl ester) constitute hydrophobic core.Perilipin (perilipin), the lipocyte differentiation associated protein being currently known White (adipophilin), tail interaction protein (TIP47) three form PAT family and are anchored on fat drips surface, with fat drips knot Structure is formed and is metabolized related.
PAT protein family is widely present in different plant species, in addition to occurring in fat cell, also in other types cell Occur in (such as myocyte, epithelial cell etc.) fat drips cumulative process.Studies have shown that perilipin there are 5 seed types, ordered respectively Entitled PLIN1~PLIN5.PLIN2 is originally found in the cell of fat and Steroidgenesis, is a kind of Adipocyte Factor, Mainly in the early expression of Adipocyte Differentiation, play an important role to the formation for promoting intracellular fat drips, it is also referred to as fatty Break up GAP-associated protein GAP (adipocytes differentiation-related protein, ADRP), it can be by hydrophobic Effect connect with neutral fat drips core and combines fat drips, aggregation phosphatide, makes to form monolayer around each fat drips.In addition, In the egg mother cell of preovulatory phase mouse, PLIN2 expression quantity will appear up-regulation trend, this, which may participate in energetic supersession with PLIN2, has It closes.
Prokesch etc. in mouse galactophore epithelial cell the study found that turn in Adipocyte Differentiation test, in epidermal growth factor 5 (ELF5) of son stimulate PLIN2 expression quantity in lower galactophore epithelial cell to increase, and the marker protein of fat cell can be detected, because This, PLIN2 also can be used as one and study the marker protein whether other cells successfully turn rouge differentiation.In vitro in test, grind Study carefully first albumen for proposing occur when PLIN2 is Adipocyte Differentiation, can be used as preadipocyte differentiation is fat cell Marker gene in the process.Therefore, PLIN2 has important physiological significance to Adipocyte Differentiation process.
Summary of the invention
The object of the present invention is to provide a kind of construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier, The obtained carrier finds the interaction protein classes functioned with it, for study certain particular biological phenomenons provide theory according to According to.
In order to realize that above-mentioned task, the present invention take following technical solution:
A kind of construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier, which is characterized in that this method is with ox The area the CDs full length amino acid sequence of PLIN2, by designing primer of the PLIN2 on bimolecular fluorescence complementary VN-173 carrier, with PBiFC-VN173 carrier recombinates to construct destination protein expression vector, and restriction enzyme site selects EcoRI and XbaI enzyme cutting, reaction temperature Degree is 37 DEG C, and increases a base A behind the site EcoRI, prevents frameshift mutation, and it is double to finally obtain ox PLIN2 interaction albumen Molecular fluorescence complementing vector pBiFC-VN173-PLIN2.
According to the present invention, the area the CDs full length amino acid sequence of the ox PLIN2 are as follows:
atggcatctgttgcagttgaaccacaactgagtgtggtgaccagggtggccaacctccccttggtgag ctccacgtatgatctggtctcctcggcttacatcagtagaaaggatcagtatccttacttgaagtctctgtgtgag atggcagagaagggcatgaagaccatcacttctgtggctgtgaccagcgcgctgccaatcatccaaaagttagagc cacaaattgctgttgccaatacctatgcgtgtaaggggctagacaggattgaggagaagctgcctattctgaatca gccaacaaaccaggttgtggccaatgccaaaggggctatgactggggcaaaagatgctgtgacgactactgtgacc ggggccaaggattctgtggccagcacaatcacgggggtggtggacaggaccaagggagctgtgactggtagtgtgg agaagaccaagtccgtggtcagtggcagcattaacacagtcctacgaagtcgggtgatgcagctgatgagcagtgg agtagaaaatgcactcaccaaatcagagctgctggtagaccagtacctccctcttaccaaggatgaactagaaaaa gaagccaaaaaagtggaaggattcgatatggttcagaagccgagttactatgttagactgggatctctgtccacca agctgcgctcacgggcctaccagcaggccctttgtagggttgaagaagctaagcgaaaaggccaggagaccatttc tcagctccattccgccttcaacctgagtgaacttgccaggaagaatgtgcataatgccaaccagaaaattcaggat gctcaggataagctctatctgtcctggctggagtggaagagaagcatcggctacgatgatacagatgaatcccact gtgctgagcacattgagtcacgtactcttgctattgcccggaacctgactcagcagctccagaccatgtgccacac cctcctgtccaacatccaggggttaccacagaacattcaagatcgggccaaccacttgggggtgatggctggtgac atctactctgtgtttcgcaatgctgcctcctttaaagaagtgtctgatggcctcctcgcttccagcaaggggcagc tgcagaaaatgaaggagtctttagatgatgtgatggattatcttgttaacaacacacccctcaactggctggtagg tcccttttatccccaggtgaccgagtctgagagtgctcaggccccaggtacaaccaggaggcctggcaggtggagt agaaaacaccctaaacccgtccctgtcagcaatgcagagggcagccagccagatgacagctcctcttga;
The primer sequence are as follows:
VN173-Plin2-F:
caagcttgcggccgcgaattcAGCATCTGTTGCAGTTGAACCA
VN173-Plin2-R:
ggtggcgatggatcttctagaAGAGGAGCTGTCATCTGGCTGG
Show the carrier ox PLIN2 interaction albumen bimolecular fluorescence complementary of above method building according to the experiment of applicant Carrier pBiFC-VN173-PLIN2 into ox Primary adipocyte and can carry out follow-up study with Successful transfection.
The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier of the invention, it is mutual with existing research albumen It is compared as method, it can the more efficient presence expressed and avoid false negative result.Meanwhile also further to study and construct albumen Interaction network and the integrality for improving interactions between protein theory provide certain verification experimental verification means.
Detailed description of the invention
Fig. 1 is the area the CDs augmentation detection figure of PLIN2;
Fig. 2 is progress bacterium solution PCR race glue figure after homologous recombination;
Fig. 3 is 18 hours detection luciferase expression situations after plasmid corotation.
The present invention is described in further detail with example with reference to the accompanying drawing.
Specific embodiment
Mentality of designing of the invention is, the recombination of ox PLIN2 interaction carrier and its is deposited with destination protein in screening with verifying Other albumen spatially to interact, the interactions between protein Study of Support is by by encoding amino acid sequence and pBiFC- VN173 (bimolecular fluorescence complementary carrier N-terminal) carrier recombinates to construct destination protein expression vector.The pBiFC-VN173- of building PLIN2 has the area the CDs overall length of complete ox PLIN2, and agarose gel electrophoresis detection PLIN2 target sequence is reassembled into carrier A function pacing sequence testing goal carrier of going forward side by side recombinates successfully.Ox PLIN2 interactions between protein carrier is reassembled as the egg of in vitro study from now on White interaction protein type provides the vector modality for stablizing expression.It efficiently solves in conventional authentication interactions between protein model The condition of the difficult expression of ox PLIN2 (fat drips memebrane protein) in the common double miscellaneous experiments of yeast, it is strong to transfect observation fluorescence using ordinary cells The method of degree can verify that other albumen for generating interaction with ox PLIN2 albumen, while can also save other experimental proteins The complex steps such as extraction purification interact between ox PLIN2 albumen interaction target protein and following protein to find from now on Functional experiment provides new reliable research method.
Carrier that following embodiment is related to, bacterial strain, cell, reagent source are as follows:
(1) DH5 α is purchased from Tiangeng biochemical technology Co., Ltd;
(2) primer synthesis is completed in Takara company and Invitrogen company;
(3) bimolecular fluorescence complementary carrier is purchased from BD biotechnology company;
(4) plasmid extraction kit is purchased from OMEGA Reagent Company;
(5) seamless Cloning Kit is purchased from Vazyme Reagent Company;
(6) the conventional molecular biologicals laboratory operating procedures such as digestion, connection, recycling, conversion, recombination, PCR amplification are detailed in " molecular cloning (third edition) ".
(7) fetal calf serum be purchased from Invitrogen company, DMEM culture medium, it is dual anti-be purchased from Hyclone company, transfection reagent Purchased from Roche company.
The present embodiment provides a kind of construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier, with ox PLIN2 The area CDs full length amino acid sequence, by homologous recombination strategy design PLIN2 on bimolecular fluorescence complementary VN-173 carrier Primer is recombinated the area CDs of PLIN2 by primer and pBiFC-VN173 carrier using KOD enzyme to construct destination protein expression and carry Body, restriction enzyme site select EcoRI and XbaI enzyme cutting, and reaction temperature is 37 DEG C, and increases a base A behind the site EcoRI, is prevented Only frameshift mutation finally obtains ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier pBiFC-VN173-PLIN2.
The area the CDs full length amino acid sequence of the ox PLIN2 are as follows:
atggcatctgttgcagttgaaccacaactgagtgtggtgaccagggtggccaacctccccttggtgag ctccacgtatgatctggtctcctcggcttacatcagtagaaaggatcagtatccttacttgaagtctctgtgtgag atggcagagaagggcatgaagaccatcacttctgtggctgtgaccagcgcgctgccaatcatccaaaagttagagc cacaaattgctgttgccaatacctatgcgtgtaaggggctagacaggattgaggagaagctgcctattctgaatca gccaacaaaccaggttgtggccaatgccaaaggggctatgactggggcaaaagatgctgtgacgactactgtgacc ggggccaaggattctgtggccagcacaatcacgggggtggtggacaggaccaagggagctgtgactggtagtgtgg agaagaccaagtccgtggtcagtggcagcattaacacagtcctacgaagtcgggtgatgcagctgatgagcagtgg agtagaaaatgcactcaccaaatcagagctgctggtagaccagtacctccctcttaccaaggatgaactagaaaaa gaagccaaaaaagtggaaggattcgatatggttcagaagccgagttactatgttagactgggatctctgtccacca agctgcgctcacgggcctaccagcaggccctttgtagggttgaagaagctaagcgaaaaggccaggagaccatttc tcagctccattccgccttcaacctgagtgaacttgccaggaagaatgtgcataatgccaaccagaaaattcaggat gctcaggataagctctatctgtcctggctggagtggaagagaagcatcggctacgatgatacagatgaatcccact gtgctgagcacattgagtcacgtactcttgctattgcccggaacctgactcagcagctccagaccatgtgccacac cctcctgtccaacatccaggggttaccacagaacattcaagatcgggccaaccacttgggggtgatggctggtgac atctactctgtgtttcgcaatgctgcctcctttaaagaagtgtctgatggcctcctcgcttccagcaaggggcagc tgcagaaaatgaaggagtctttagatgatgtgatggattatcttgttaacaacacacccctcaactggctggtagg tcccttttatccccaggtgaccgagtctgagagtgctcaggccccaggtacaaccaggaggcctggcaggtggagt agaaaacaccctaaacccgtccctgtcagcaatgcagagggcagccagccagatgacagctcctcttga。
The step of specific implementation, is:
1, ox PLIN2 gene order is inquired in ncbi database, design includes the primer including restriction enzyme site, passes through Pcr clone ox PLIN2 gene C DS full length sequence;
2, ox PLIN2 gene is connected on BiFC-VN173 carrier by seamless clone, by being transformed into DH5 α large intestine Bacillus competent cell, and select positive cell clone and carry out plasmid extraction, sequencing, obtain PLIN2-VN73 gene cloning load Body;
3, that the PLIN2-VN73 recombinated is transfected into 293T with the general CGI-58-VC155 carrier previously built is thin In born of the same parents, after 24 hours microscope detect luciferase expression situation, thus detect PLIN2 whether with CGI-58 occur interaction.
It is the specific embodiment that inventor provides below.
Embodiment 1: ox PLIN2 gene C DS sequence clone
This experiment uses BiFC expression vector system, the ox Plin2 gene order (Accession announced with GenBank Number:NM_173980) it is template, designs and synthesizes primer, expands ox Mef2a gene C DS full length sequence.
The primer sequence is as follows:
Upstream primer (Forward primer):
5-caagcttgcggccgcgaattcAGCATCTGTTGCAGTTGAACCA-3;
Downstream primer (Reverse primer):
5-ggtggcgatggatcttctagaAGAGGAGCTGTCATCTGGCTGG-3;
Wherein, the protection base that " A " of upstream primer overstriking adds after being EcoRI, otherwise gene order meeting frameshift mutation, on Swimming selected primer is EcoRI, and primer selected by downstream is XbaI.
This experiment carries out overall length amplification, amplification system with CDS area of the KOD-PLus High fidelity PCR enzyme to ox PLIN2 gene And amplification condition is shown in Table 1, table 2, augmentation detection the result is shown in Figure 1.
Table 1:PCR amplification system
2:PCR response procedures
The building of embodiment 2:PLIN2-VN73
Under the conditions of 37 DEG C, digestion 2h is carried out to BiFC-VN73 zero load with EcoRI+XbaI enzyme, isometric PCR product is used Homologous recombination is carried out with ClonExpress II One Step Cloning Kit with carrier after digestion, 37 DEG C of reaction 2h pass through It is transformed into DH5 α competent escherichia coli cell, and selects positive cell clone and carries out plasmid extraction, sequencing etc., obtains PLIN2- VN73 gene clone carrier., carry out bacterium solution PCR after homologous recombination and run glue figure as shown in Fig. 2, linked system see the table below 3.
Run glue as the result is shown: purpose band becomes clear single, and size is correct, and can carry out subsequent glue recovery test is homologous recombination It prepares.
It is compared through sequencing result, ox PLIN2 is without mutant nucleotide sequence success and bimolecular fluorescence complementary carrier VN-173 carrier weight Group can be used for the interaction development test of its subsequent albumen as a purpose.
Table 3:PLIN2-VN73 linked system
Embodiment 3:PLIN2-VN73 and CGI-58-VC155 corotation 293T cell line
It is 80% progress transfection assay by 293T cell line culture to cell density, after plasmid passes through transfection reagent cotransfection (Fig. 3) is observed under fluorescence microscope after 18 hours, finds apparent yellow fluorescence occur in 293T cytoplasm at this time, then Illustrate destination protein of the ox PLIN2 albumen as research, is that there are interactions with ox CGI-58 albumen.Picture scale is 100μm。
Nucleotides sequence list
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier
<160>
<210>1
<211>1353
<212>area the CDs full length amino acid sequence of ox PLIN2
<213>DNA
<220>
<400>
atggcatctgttgcagttgaaccacaactgagtgtggtgaccagggtggccaacctccccttggtgagctcc acgtatgatctggtctcctcggcttacatcagtagaaaggatcagtatccttacttgaagtctctgtgtgagatgg cagagaagggcatgaagaccatcacttctgtggctgtgaccagcgcgctgccaatcatccaaaagttagagccaca aattgctgttgccaatacctatgcgtgtaaggggctagacaggattgaggagaagctgcctattctgaatcagcca acaaaccaggttgtggccaatgccaaaggggctatgactggggcaaaagatgctgtgacgactactgtgaccgggg ccaaggattctgtggccagcacaatcacgggggtggtggacaggaccaagggagctgtgactggtagtgtggagaa gaccaagtccgtggtcagtggcagcattaacacagtcctacgaagtcgggtgatgcagctgatgagcagtggagta gaaaatgcactcaccaaatcagagctgctggtagaccagtacctccctcttaccaaggatgaactagaaaaagaag ccaaaaaagtggaaggattcgatatggttcagaagccgagttactatgttagactgggatctctgtccaccaagct gcgctcacgggcctaccagcaggccctttgtagggttgaagaagctaagcgaaaaggccaggagaccatttctcag ctccattccgccttcaacctgagtgaacttgccaggaagaatgtgcataatgccaaccagaaaattcaggatgctc aggataagctctatctgtcctggctggagtggaagagaagcatcggctacgatgatacagatgaatcccactgtgc tgagcacattgagtcacgtactcttgctattgcccggaacctgactcagcagctccagaccatgtgccacaccctc ctgtccaacatccaggggttaccacagaacattcaagatcgggccaaccacttgggggtgatggctggtgacatct actctgtgtttcgcaatgctgcctcctttaaagaagtgtctgatggcctcctcgcttccagcaaggggcagctgca gaaaatgaaggagtctttagatgatgtgatggattatcttgttaacaacacacccctcaactggctggtaggtccc ttttatccccaggtgaccgagtctgagagtgctcaggccccaggtacaaccaggaggcctggcaggtggagtagaa aacaccctaaacccgtccctgtcagcaatgcagagggcagccagccagatgacagctcctcttga
<210>2
<211>43
<212>primer sequence VN173-Plin2-F
<213>DNA
<220>
<400>
caagcttgcggccgcgaattcAGCATCTGTTGCAGTTGAACCA
<210>3
<211>43
<212>primer sequence VN173-Plin2-R
<213>DNA
<220>
<400>
ggtggcgatggatcttctagaAGAGGAGCTGTCATCTGGCTGG

Claims (2)

1. a kind of construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier, which is characterized in that this method is with ox The area the CDs full length amino acid sequence of PLIN2, by designing primer of the PLIN2 on bimolecular fluorescence complementary VN-173 carrier, with PBiFC-VN173 carrier recombinates to construct destination protein expression vector, and restriction enzyme site selects EcoRI and XbaI enzyme cutting, reaction temperature Degree is 37 DEG C, and increases a base A behind the site EcoRI, prevents frameshift mutation, and it is double to finally obtain ox PLIN2 interaction albumen Molecular fluorescence complementing vector pBiFC-VN173-PLIN2.
2. the method as described in claim 1, which is characterized in that the area the CDs full length amino acid sequence of the ox PLIN2 are as follows:
atggcatctgttgcagttgaaccacaactgagtgtggtgaccagggtggccaacctccccttggtgagctcc acgtatgatctggtctcctcggcttacatcagtagaaaggatcagtatccttacttgaagtctctgtgtgagatgg cagagaagggcatgaagaccatcacttctgtggctgtgaccagcgcgctgccaatcatccaaaagttagagccaca aattgctgttgccaatacctatgcgtgtaaggggctagacaggattgaggagaagctgcctattctgaatcagcca acaaaccaggttgtggccaatgccaaaggggctatgactggggcaaaagatgctgtgacgactactgtgaccgggg ccaaggattctgtggccagcacaatcacgggggtggtggacaggaccaagggagctgtgactggtagtgtggagaa gaccaagtccgtggtcagtggcagcattaacacagtcctacgaagtcgggtgatgcagctgatgagcagtggagta gaaaatgcactcaccaaatcagagctgctggtagaccagtacctccctcttaccaaggatgaactagaaaaagaag ccaaaaaagtggaaggattcgatatggttcagaagccgagttactatgttagactgggatctctgtccaccaagct gcgctcacgggcctaccagcaggccctttgtagggttgaagaagctaagcgaaaaggccaggagaccatttctcag ctccattccgccttcaacctgagtgaacttgccaggaagaatgtgcataatgccaaccagaaaattcaggatgctc aggataagctctatctgtcctggctggagtggaagagaagcatcggctacgatgatacagatgaatcccactgtgc tgagcacattgagtcacgtactcttgctattgcccggaacctgactcagcagctccagaccatgtgccacaccctc ctgtccaacatccaggggttaccacagaacattcaagatcgggccaaccacttgggggtgatggctggtgacatct actctgtgtttcgcaatgctgcctcctttaaagaagtgtctgatggcctcctcgcttccagcaaggggcagctgca gaaaatgaaggagtctttagatgatgtgatggattatcttgttaacaacacacccctcaactggctggtaggtccc ttttatccccaggtgaccgagtctgagagtgctcaggccccaggtacaaccaggaggcctggcaggtggagtagaa aacaccctaaacccgtccctgtcagcaatgcagagggcagccagccagatgacagctcctcttga;
The primer sequence are as follows:
VN173-Plin2-F:
CaagcttgcggccgcgaattcAGCATCTGTTGCAGTTGAACCA:
VN173-Plin2-R:
ggtggcgatggatcttctagaAGAGGAGCTGTCATCTGGCTGG。
CN201811547741.6A 2018-12-18 2018-12-18 The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier Pending CN109679995A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811547741.6A CN109679995A (en) 2018-12-18 2018-12-18 The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811547741.6A CN109679995A (en) 2018-12-18 2018-12-18 The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier

Publications (1)

Publication Number Publication Date
CN109679995A true CN109679995A (en) 2019-04-26

Family

ID=66186784

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811547741.6A Pending CN109679995A (en) 2018-12-18 2018-12-18 The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier

Country Status (1)

Country Link
CN (1) CN109679995A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105177041A (en) * 2015-11-04 2015-12-23 中国热带农业科学院热带生物技术研究所 Expression vector for bimolecular fluorescence complementation) research and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105177041A (en) * 2015-11-04 2015-12-23 中国热带农业科学院热带生物技术研究所 Expression vector for bimolecular fluorescence complementation) research and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
NIELSEN R.L等: "NM_173980.1", 《NCBI》 *
PEIWEI LI等: "The Expression Pattern of PLIN2 in Differentiated Adipocytes from Qinchuan Cattle Analysis of Its Protein Structure and Interaction with CGI-58", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 *
Y. JOHN SHYU等: "Identification of new fluorescent protein fragments for bimolecular fluorescence complementation analysis under physiological conditions", 《BIOTECHNIQUES》 *
胡濒月等: "PLIN2对脂类代谢的调控研究", 《中国医药科学》 *

Similar Documents

Publication Publication Date Title
Brodie et al. The algal revolution
Poliner et al. Advanced genetic tools enable synthetic biology in the oleaginous microalgae Nannochloropsis sp.
Ma et al. SCRaMbLE generates evolved yeasts with increased alkali tolerance
Niu et al. Transformation of diatom Phaeodactylum tricornutum by electroporation and establishment of inducible selection marker
Moog et al. In vivo localization studies in the stramenopile alga Nannochloropsis oceanica
Tanaka et al. Ultrastructure and membrane traffic during cell division in the marine pennate diatom Phaeodactylum tricornutum
Miyagishima et al. Two types of FtsZ proteins in mitochondria and red-lineage chloroplasts: the duplication of FtsZ is implicated in endosymbiosis
US20100021912A1 (en) Methods of Modulating Lipid Concentrations in Eukaryotic Cells
CN107075452A (en) The promoter and its application method of adenine A Shi yeast are conciliate from Yarrowia lipolytica
US11873497B2 (en) Regulatory elements from labyrinthulomycetes microorganisms
Ohnuma et al. Transient gene suppression in a red alga, Cyanidioschyzon merolae 10D
Wagner et al. An integrated strategy for efficient vector construction and multi-gene expression in Plasmodium falciparum
Kira et al. Nuclear transformation of the diatom Phaeodactylum tricornutum using PCR-amplified DNA fragments by microparticle bombardment
CN103820405A (en) Method for expression of fatty acid desaturase by acellular protein synthesis system
Südfeld et al. Expression of glycerol-3-phosphate acyltransferase increases non-polar lipid accumulation in Nannochloropsis oceanica
Kong et al. Efficient approaches for nuclear transgene stacking in the unicellular green microalga Chlamydomonas reinhardtii
CN108559727A (en) A method of promoting goat follicular cell proliferation
US11124798B2 (en) Algal lipid productivity via genetic modification of a TPR domain containing protein
CN109679995A (en) The construction method of ox PLIN2 interaction albumen bimolecular fluorescence complementary carrier
Jia et al. A vector for multiple gene co-expression in Chlamydomonas reinhardtii
CN105814190A (en) Biomass productivity regulator
Chen et al. Molecular cloning of a plasma membrane Ca2+ ATPase (PMCA) from Y-organs of the blue crab (Callinectes sapidus), and determination of spatial and temporal patterns of PMCA gene expression
CN112824528B (en) Alpha-charantin gene and overexpression method thereof in mammalian cells
CN105647956B (en) The method that a kind of pair of hidden dinoflagellate of production docosahexaenoic acid carries out genetic transformation
CN110408596A (en) Chinese hamster ovary celI strain and preparation method thereof based on the transformation of CRISPR/Cas9 gene editing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190426