CN109679973A - Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit - Google Patents
Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit Download PDFInfo
- Publication number
- CN109679973A CN109679973A CN201811590297.6A CN201811590297A CN109679973A CN 109679973 A CN109679973 A CN 109679973A CN 201811590297 A CN201811590297 A CN 201811590297A CN 109679973 A CN109679973 A CN 109679973A
- Authority
- CN
- China
- Prior art keywords
- dna polymerase
- archaeal dna
- host cell
- nucleotide sequence
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01074—Cutinase (3.1.1.74)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kits.The expressing gene of the archaeal dna polymerase includes the nucleotide sequence for the encoding DNA polymerase that the nucleotide sequence of coding cutinase is connect with the nucleotide sequence of coding cutinase, and the expressing gene of above-mentioned archaeal dna polymerase independent simultaneously in host cell can express cutinase and archaeal dna polymerase.Under the action of cutinase, the archaeal dna polymerase expressed in host cell can dissociate to outside host cell, so that being free of the DNA of host cell in the archaeal dna polymerase being prepared using the expressing gene of above-mentioned archaeal dna polymerase.
Description
Technical field
The present invention relates to field of molecular biotechnology, more particularly to a kind of archaeal dna polymerase and preparation method thereof, expression base
Cause, expression vector, host cell and kit.
Background technique
Polymerase chain reaction (PCR) is to carry out external quickly expansion to specific DNA fragment using single-stranded nucleotide primer of raising
A kind of method increased, can be such that in a short time the target DNA fragment of denier can specifically amplify ... by a million times.PCR is examined in clinic
It is widely used in testing.
The reaction system of PCR includes template, archaeal dna polymerase, primer, dNTPs and reaction buffer, wherein archaeal dna polymerase
It is the key factor for influencing amplification accuracy.Current archaeal dna polymerase is mainly the recombination egg isolated and purified by genetic engineering bacterium
It is white, although the archaeal dna polymerase of purification eliminates the impurity such as most foreign protein, carbohydrate, lipid, because of archaeal dna polymerase one
Kind nucleic acid binding protein, during separating genetic engineering bacterium and archaeal dna polymerase, archaeal dna polymerase is tended to and gene work
The DNA of journey bacterium is securely joined with, and is difficult to remove in subsequent purification process.Thus, the archaeal dna polymerase of this method production
In clinical application, if be detected as bacterium, false positive would tend to occur, cause mistaken diagnosis.
There are the methods of the DNA pollution of genetic engineering bacterium mainly DNA enzymatic solution and ion in solution archaeal dna polymerase at present
Exchanger resin method of purification.DNA enzymatic solution is by DNA enzymatic the DNA of genetic engineering bacterium to be hydrolyzed into nucleotide, but this method
High production cost, increase inactivation DNA enzymatic operating procedure, and if DNA enzymatic removing be not thorough, will affect downstream application.From
Sub-exchange resin method of purification utilizes the ion adsorption of anion exchange resin, and the DNA of genetic engineering bacterium is made to be adsorbed to resin
On, by being centrifuged or filtering, separate the DNA of genetic engineering bacterium with archaeal dna polymerase, to reach removal genetic engineering bacterium
The purpose of DNA pollution, but the DNA of archaeal dna polymerase and genetic engineering bacterium forms close combination, and resin adsorption is free
DNA, cannot adsorb the DNA of combination, it is thus impossible to achieve the purpose that completely remove DNA pollution.
Summary of the invention
Based on this, it is necessary to provide a kind of archaeal dna polymerase and preparation method thereof, expression vector, host cell and PCR amplification
Kit is to solve the problems, such as to the DNA pollution in existing archaeal dna polymerase there are genetic engineering bacterium.
A kind of expressing gene of archaeal dna polymerase, the core including encoding the nucleotide sequence of cutinase and with coding cutinase
The nucleotide sequence of the encoding DNA polymerase of nucleotide sequence connection.
A kind of expression vector, the expressing gene including above-mentioned archaeal dna polymerase.
A kind of host cell, including above-mentioned expression vector.
A kind of preparation method of archaeal dna polymerase, comprising the following steps:
Construct the expression vector of the expressing gene containing archaeal dna polymerase, wherein the expressing gene packet of the archaeal dna polymerase
Include the nucleotide sequence of coding cutinase and the core for the encoding DNA polymerase connecting with the nucleotide sequence of the coding cutinase
Nucleotide sequence；And
The expression vector is transferred to host cell, Fiber differentiation is transferred to the host cell of the expression vector, obtains institute
State archaeal dna polymerase.
A kind of archaeal dna polymerase is made by the preparation method of above-mentioned archaeal dna polymerase.
A kind of PCR amplification kit, including above-mentioned archaeal dna polymerase.
The expressing gene of above-mentioned archaeal dna polymerase includes the core for encoding the nucleotide sequence and encoding DNA polymerase of cutinase
Nucleotide sequence.The expressing gene of above-mentioned archaeal dna polymerase can express simultaneously cutinase and archaeal dna polymerase in host cell.?
Under the action of cutinase, the archaeal dna polymerase expressed in host cell can dissociate to outside host cell, thus in extraction purification
Directly centrifugation can separate host cell with archaeal dna polymerase when archaeal dna polymerase, avoid and cause because of host cell lysis
Archaeal dna polymerase in conjunction with the DNA of host cell the problem of occur so that using above-mentioned archaeal dna polymerase expressing gene prepare
The DNA of host cell is free of in obtained archaeal dna polymerase.
Detailed description of the invention
Fig. 1 is the amplification curve diagram of embodiment 3.
Specific embodiment
To facilitate the understanding of the present invention, a more comprehensive description of the invention is given in the following sections with reference to the relevant attached drawings.In attached drawing
Give section Example of the invention.But the invention can be realized in many different forms, however it is not limited to this paper institute
The embodiment of description.On the contrary, purpose of providing these embodiments is keeps the disclosure of invention more thorough and comprehensive.
Unless otherwise defined, all technical and scientific terms used herein and belong to technical field of the invention
The normally understood meaning of technical staff is identical.Term as used herein in the specification of the present invention is intended merely to description tool
The purpose of the embodiment of body, it is not intended that in the limitation present invention.
An embodiment of the present invention provides a kind of expressing gene of archaeal dna polymerase, the nucleotide including encoding cutinase
The nucleotide sequence of sequence and encoding DNA polymerase.
Specifically, the expressing gene of archaeal dna polymerase include encode cutinase nucleotide sequence and with coding cutinase
The nucleotide sequence of the encoding DNA polymerase of nucleotide sequence connection.The nucleotide sequence for encoding cutinase comes from thermophilic unwrapping wire
Bacterium (Thermobifida fusca).
The nucleotides sequence of encoding DNA polymerase in present embodiment is classified as the nucleotides sequence of coding Taq archaeal dna polymerase
Column.Certainly, in some other embodiment, the nucleotide sequence of encoding DNA polymerase can also be that coding is other kinds of
The nucleotide sequence of archaeal dna polymerase, for example encode the nucleotide sequence of Tth archaeal dna polymerase, encode the core of Pfu archaeal dna polymerase
Nucleotide sequence, encode VentR archaeal dna polymerase nucleotide sequence, encode Phusion archaeal dna polymerase nucleotide sequence or
The nucleotide sequence etc. of encoded K OD archaeal dna polymerase.
The nucleotide sequence of cutinase is encoded in one of the embodiments, as shown in SEQ ID No.1, the coding
The nucleotide sequence of archaeal dna polymerase is as shown in SEQ ID No.2.Wherein.The sequence of SEQ ID No.1 are as follows:
5’-ATGCCCCCGCATGCGGCGCGGCCCGGCCCTGCACAGAACCGAAGAGGATGTGCAATGGCTGTGAT
GACCCCCCGCCGGGAGCGCTCTTCCCTGCTCTCCCGAGCTCTGCAAGTGACGGCTGCGGCTGCCACAGCGCTTGTG
ACCGCGGTCAGCCTGGCCGCCCCCGCTCATGCCGCCAACCCCTACGAGCGCGGCCCCAACCCGACCGACGCCCTGC
TCGAAGCCCGCAGCGGCCCCTTCTCCGTCAGCGAGGAGAACGTCTCCCGGTTGGGCGCCAGCGGCTTCGGCGGCGG
CACCATCTACTACCCGCGGGAGAACAACACCTACGGTGCGGTGGCGATCTCCCCCGGCTACACCGGCACCCAGGCC
TCTGTCGCCTGGCTGGGCAAGCGCATCGCCTCCCACGGCTTCGTCGTCATCACCATCGACACCATCACCACCCTCG
ACCAGCCGGACAGCCGGGCCCGCCAGCTCAACGCCGCGCTGGACTACATGATCAACGACGCCTCGTCCGCGGTGCG
CAGCCGGATCGACAGCAGCCGACTGGCGGTCATGGGCCACTCCATGGGCGGCGGCGGCAGCCTGCGTCTGGCCTCC
CAGCGTCCCGACCTGAAGGCCGCCATCCCGCTCACCCCGTGGCACCTCAACAAGAACTGGAGCAGTGTGCGGGTTC
CCACCCTCATCATCGGTGCTGACCTGGACACCATCGCTCCGGTCCTCACCCACGCCCGGCCCTTCTACAACAGCCT
CCCGACCTCGATCAGCAAGGCCTACCTGGAGCTGGACGGCGCAACCCACTTCGCCCCGAACATCCCCAACAAGATC
ATCGGCAAGTACAGCGTCGCCTGGCTCAAGCGGTTCGTCGACAACGACACCCGCTACACCCAGTTCCTCTGCCCCG
GACCGCGCGACGGACTCTTCGGCGAGGTCGAAGAGTACCGCTCCACCTGCCCCTTCTAG-3'.SEQ ID No.2's
Sequence are as follows:
5’-ATGAGGGGGATGCTGCCCCTCTTTGAGCCCAAGGGCCGGGTCCTCCTGGTGGACGGCCACCACCT
GGCCTACCGCACCTTCCACGCCCTGAAGGGCCTCACCACCAGCCGGGGGGAGCCGGTGCAGGCGGTCTACGGCTTC
GCCAAGAGCCTCCTCAAGGCCCTCAAGGAGGACGGGGACGCGGTGATCGTGGTCTTTGACGCCAAGGCCCCCTCCT
TCCGCCACGAGGCCTACGGGGGGTACAAGGCGGGCCGGGCCCCCACGCCGGAGGACTTTCCCCGGCAACTCGCCCT
CATCAAGGAGCTGGTGGACCTCCTGGGGCTGGCGCGCCTCGAGGTCCCGGGCTACGAGGCGGACGACGTCCTGGCC
AGCCTGGCCAAGAAGGCGGAAAAGGAGGGCTACGAGGTCCGCATCCTCACCGCCGACAAAGACCTTTACCAGCTCC
TTTCCGACCGCATCCACGTCCTCCACCCCGAGGGGTACCTCATCACCCCGGCCTGGCTTTGGGAAAAGTACGGCCT
GAGGCCCGACCAGTGGGCCGACTACCGGGCCCTGACCGGGGACGAGTCCGACAACCTTCCCGGGGTCAAGGGCATC
GGGGAGAAGACGGCGAGGAAGCTTCTGGAGGAGTGGGGGAGCCTGGAAGCCCTCCTCAAGAACCTGGACCGGCTGA
AGCCCGCCATCCGGGAGAAGATCCTGGCCCACATGGACGATCTGAAGCTCTCCTGGGACCTGGCCAAGGTGCGCAC
CGACCTGCCCCTGGAGGTGGACTTCGCCAAAAGGCGGGAGCCCGACCGGGAGAGGCTTAGGGCCTTTCTGGAGAGG
CTTGAGTTTGGCAGCCTCCTCCACGAGTTCGGCCTTCTGGAAAGCCCCAAGGCCCTGGAGGAGGCCCCCTGGCCCC
CGCCGGAAGGGGCCTTCGTGGGCTTTGTGCTTTCCCGCAAGGAGCCCATGTGGGCCGATCTTCTGGCCCTGGCCGC
CGCCAGGGGGGGCCGGGTCCACCGGGCCCCCGAGCCTTATAAAGCCCTCAGGGACCTGAAGGAGGCGCGGGGGCTT
CTCGCCAAAGACCTGAGCGTTCTGGCCCTGAGGGAAGGCCTTGGCCTCCCGCCCGGCGACGACCCCATGCTCCTCG
CCTACCTCCTGGACCCTTCCAACACCACCCCCGAGGGGGTGGCCCGGCGCTACGGCGGGGAGTGGACGGAGGAGGC
GGGGGAGCGGGCCGCCCTTTCCGAGAGGCTCTTCGCCAACCTGTGGGGGAGGCTTGAGGGGGAGGAGAGGCTCCTT
TGGCTTTACCGGGAGGTGGAGAGGCCCCTTTCCGCTGTCCTGGCCCACATGGAGGCCACGGGGGTGCGCCTGGACG
TGGCCTATCTCAGGGCCTTGTCCCTGGAGGTGGCCGAGGAGATCGCCCGCCTCGAGGCCGAGGTCTTCCGCCTGGC
CGGCCACCCCTTCAACCTCAACTCCCGGGACCAGCTGGAAAGGGTCCTCTTTGACGAGCTAGGGCTTCCCGCCATC
GGCAAGACGGAGAAGACCGGCAAGCGCTCCACCAGCGCCGCCGTCCTGGAGGCCCTCCGCGAGGCCCACCCCATCG
TGGAGAAGATCCTGCAGTACCGGGAGCTCACCAAGCTGAAGAGCACCTACATTGACCCCTTGCCGGACCTCATCCA
CCCCAGGACGGGCCGCCTCCACACCCGCTTCAACCAGACGGCCACGGCCACGGGCAGGCTAAGTAGCTCCGATCCC
AACCTCCAGAACATCCCCGTCCGCACCCCGCTTGGGCAGAGGATCCGCCGGGCCTTCATCGCCGAGGAGGGGTGGC
TATTGGTGGCCCTGGACTATAGCCAGATAGAGCTCAGGGTGCTGGCCCACCTCTCCGGCGACGAGAACCTGATCCG
GGTCTTCCAGGAGGGGCGGGACATCCACACGGAGACCGCCAGCTGGATGTTCGGCGTCCCCCGGGAGGCCGTGGAC
CCCCTGATGCGCCGGGCGGCCAAGACCATCAACTTCGGGGTCCTCTACGGCATGTCGGCCCACCGCCTCTCCCAGG
AGCTAGCCATCCCTTACGAGGAGGCCCAGGCCTTCATTGAGCGCTACTTTCAGAGCTTCCCCAAGGTGCGGGCCTG
GATTGAGAAGACCCTGGAGGAGGGCAGGAGGCGGGGGTACGTGGAGACCCTCTTCGGCCGCCGCCGCTACGTGCCA
GACCTAGAGGCCCGGGTGAAGAGCGTGCGGGAGGCGGCCGAGCGCATGGCCTTCAACATGCCCGTCCAGGGCACCG
CCGCCGACCTCATGAAGCTGGCTATGGTGAAGCTCTTCCCCAGGCTGGAGGAAATGGGGGCCAGGATGCTCCTTCA
GGTCCACGACGAGCTGGTCCTCGAGGCCCCAAAAGAGAGGGCGGAGGCCGTGGCCCGGCTGGCCAAGGAGGTCATG
GAGGGGGTGTATCCCCTGGCCGTGCCCCTGGAGGTGGAGGTGGGGATAGGGGAGGACTGGCTCTCCGCCAAGGAGT
GA-3’。
The nucleotide sequence for encoding cutinase in one of the embodiments, is located at the nucleotides sequence of encoding DNA polymerase
The downstream of the transcriptional orientation of column.
The expressing gene of above-mentioned archaeal dna polymerase further includes restriction enzyme site in one of the embodiments,.Specifically, it is compiling
5 ' the ends and 3 ' ends of the nucleotide sequence of the nucleotide sequence and encoding DNA polymerase of code cutinase all have restriction enzyme site, with
Convenient for carrier will be imported after the expressing gene digestion of above-mentioned archaeal dna polymerase.
Further, the 5 ' ends and 3 ' ends of the nucleotide sequence of the coding cutinase of the expressing gene of above-mentioned archaeal dna polymerase
It is connected separately with NdeI restriction enzyme site and XhoI restriction enzyme site, the nucleosides of the encoding DNA polymerase of the expressing gene of archaeal dna polymerase
5 ' the ends and 3 ' ends of acid sequence are connected separately with NcoI restriction enzyme site and HindIII restriction enzyme site.
The expressing gene of above-mentioned archaeal dna polymerase includes the core for encoding the nucleotide sequence and encoding DNA polymerase of cutinase
Nucleotide sequence.The expressing gene of above-mentioned archaeal dna polymerase being capable of independent expression cutinase and the DNA polymerization simultaneously in host cell
Enzyme.Under the action of cutinase, the archaeal dna polymerase expressed in host cell can dissociate to outside host cell, thus extracting
Directly centrifugation can separate host cell with archaeal dna polymerase when purified DNA polymerase, avoid due to cracking host cell
Caused archaeal dna polymerase is in conjunction with the DNA of host cell, so that poly- using the DNA that the expressing gene of above-mentioned archaeal dna polymerase produces
The DNA of host cell is free of in synthase.
An embodiment of the present invention provides a kind of expression vector, which includes the expression of above-mentioned archaeal dna polymerase
Gene.Further, above-mentioned expression vector includes two promoters, corresponds respectively to the nucleotide sequence and volume of coding cutinase
The nucleotide sequence of code archaeal dna polymerase, so that the nucleotide sequence of the nucleotide sequence of coding cutinase and encoding DNA polymerase
It can independently express.
The expression vector includes pETDuet-1 carrier and is inserted in pETDuet-1 carrier in one of the embodiments,
Above-mentioned archaeal dna polymerase expressing gene.
An embodiment of the present invention provides a kind of host cell, and above-mentioned expression vector is contained in the host cell.It is preferred that
Ground, host cell are prokaryote, and further, host cell is Escherichia coli.Further, host cell is
BL21(DE3)。
An embodiment of the present invention provides a kind of preparation method of archaeal dna polymerase, comprising the following steps:
S110, the expressing gene of above-mentioned archaeal dna polymerase is provided.
The expression vector of the expressing gene of S120, building containing above-mentioned archaeal dna polymerase.
Specifically, by the clone of the nucleotide sequence containing coding cutinase and the nucleotide sequence of encoding DNA polymerase
Into expression vector, the expression vector of the expressing gene containing above-mentioned archaeal dna polymerase is obtained.Specifically include S121~S123:
The nucleotide sequence of S121, respectively building containing coding cutinase and the nucleotides sequence containing encoding DNA polymerase
The cloning vector of column.Specifically, the nucleotide sequence of the nucleotide sequence and encoding DNA polymerase that encode cutinase is inserted respectively
Enter the empty carrier for clone, obtains the cloning vector of cutinase and the cloning vector of archaeal dna polymerase.Further, it is used for
The empty carrier of clone is pUC57 carrier.
The expression vector of the expressing gene of S123, building containing above-mentioned archaeal dna polymerase.
Specifically, the cloning vector of difference digestion cutinase and the empty carrier for expression, then by the angle after digestion
The cloning vector of matter enzyme is connected with the empty carrier for expression after digestion, obtains just grade expression vector.Then distinguish digestion
The cloning vector of archaeal dna polymerase and first grade expression vector, and will be after the cloning vector of the archaeal dna polymerase after digestion and digestion
First grade expression vector connection, obtain the expression vector of the expressing gene containing above-mentioned archaeal dna polymerase.Further, it is used for table
The empty carrier reached is pETDuet-1 carrier.Certainly, in some other embodiment, can also first digestion archaeal dna polymerase clone
Carrier and empty carrier for expression, and connect and to form just grade expression vector, the cloning vector of digestion cutinase is then distinguished again
With first grade expression vector, and the expression vector to form the expressing gene containing above-mentioned archaeal dna polymerase is connected.
In one of the embodiments, respectively with NdeI and XhoI restriction enzyme cutting cutinase cloning vector and
PETDuet-1 carrier, recycle target fragment, then with T4DNA ligase connection cutting after cutinase cloning vector and
PETDuet-1 carrier after digestion, obtains pETDuet-cut carrier.Then NcoI and HindIII restriction enzyme is used respectively
The cloning vector and pETDuet-cut carrier of archaeal dna polymerase are cut in digestion, recycle target fragment, are then connected with T4DNA ligase
PETDuet-cut carrier after the cloning vector of archaeal dna polymerase after cutting and cutting, obtains containing above-mentioned archaeal dna polymerase
Expressing gene expression vector.
S130, the expression vector of the expressing gene containing archaeal dna polymerase is imported in host cell, is obtained poly- containing DNA
The host cell of the expression vector of the expressing gene of synthase.
Specifically, host cell is prokaryote, and further, host cell is Escherichia coli.Further,
Host cell is BL21 (DE3).
S140, inducing expression contain the host cell of the expression vector of the expressing gene of archaeal dna polymerase, obtain DNA polymerization
Enzyme.
Specifically, inducer IPTG；The temperature of inducing expression is the final concentration of 0.1mM of 30 DEG C~40 DEG C, inducer
~2mM, the time of inducing expression are 1h~12h.Further, the temperature of inducing expression is the end of 36 DEG C~38 DEG C, inducer
Concentration is 0.5mM~1mM, and time of inducing expression is 1h~for 24 hours.
After the host cell inducing expression containing the expression vector of the expressing gene of archaeal dna polymerase is complete, further include
The step of purifying.Specifically, by the host cell inducing expression of the expression vector of the expressing gene containing archaeal dna polymerase it is complete it
Afterwards, the host cell after the completion of expression is removed, crude extract is obtained, then purification crude extract, obtains archaeal dna polymerase.Into
One step, the mode of the host cell after the completion of removal expression is centrifugation.Further, crude extract ammonium sulfate precipitation will be purified
Afterwards, archaeal dna polymerase is obtained.
Solid ammonium sulfate is added to being saturated in crude extract kind in one of the embodiments, then centrifuging and taking precipitating is added
Precipitating is resuspended in re-suspension liquid (10mM Tris-HCl, pH8.0,1mM EDTA).75 DEG C, heat preservation makes foreign protein denaturation centrifugation for 10 minutes
Supernatant is taken, archaeal dna polymerase is obtained.
The preparation method of above-mentioned archaeal dna polymerase is to induce the host cell of the expressing gene containing above-mentioned archaeal dna polymerase to pass through
It expresses to produce archaeal dna polymerase, after the expressing gene expression of above-mentioned archaeal dna polymerase, the cutinase of generation can increase host
The cell permeability of cell, so that centrifugation can separate archaeal dna polymerase with host cell, because without by host cell
Cracking to obtain the archaeal dna polymerase of host cell inner expression, thus do not need to carry out yet special addition DNA enzymatic or carry out from
The step of DNA of the sub-exchange resin to remove host.The preparation method of above-mentioned archaeal dna polymerase saves production cost, simplifies production
Process flow, it is easier to industrialize.And verified, the archaeal dna polymerase being prepared according to the method described above is in pcr amplification reaction
In be less prone to false positive, accuracy is higher.
An embodiment of the present invention provides a kind of PCR amplification kit, including above-mentioned archaeal dna polymerase.
Further, above-mentioned PCR amplification kit further includes nucleic acid extracting reagent, PCR amplification buffer and dNTPs reagent
At least one of.Specifically, nucleic acid extracting reagent includes that DNA extracts at least one of reagent and RNA extraction reagent.
Above-mentioned PCR amplification kit includes above-mentioned archaeal dna polymerase, false positive is less prone in pcr amplification reaction, accurately
Property is higher.
Specific embodiment
It is described in detail below in conjunction with specific embodiment.In embodiment if not otherwise indicated using drug and instrument,
For this field conventional selection.Test method without specific conditions in embodiment, according to normal conditions, such as document, books
Described in condition or manufacturer recommend method realize.
Embodiment 1
(1) nucleotide sequence of cutinase is encoded as shown in SEQ ID No.1, the nucleotide sequence of encoding DNA polymerase
As shown in SEQ ID No.2, NdeI and XhoI digestion is separately added at 5 ' ends of the nucleotide sequence of coding cutinase and 3 ' ends
Site is separately added into NcoI and HindIII restriction enzyme site at 5 ' ends of the nucleotide sequence of encoding DNA polymerase and 3 ' ends, so
Commission Nanjing Genscript Biotechnology Co., Ltd. synthesis afterwards, and saved respectively with pUC57 carrier, obtain pUC57-cut carrier
(nucleotide sequence containing coding cutinase) and pUC57-Taq carrier (nucleotide sequence containing encoding DNA polymerase).
(2) pUC57-cut carrier is cut with NdeI and XhoI restriction enzyme, recycles target fragment；Equally use NdeI
With XhoI digestion pETDuet-1 carrier, large fragment is recycled；Then above-mentioned two bar segment T4DNA ligase is connected, and converted
JM109 bacterium obtains pETDuet-cut carrier after verifying is correct.
(3) pUC57-Taq carrier is cut with NcoI and HindIII restriction enzyme, recycles target fragment；It is same to use
NcoI and HindIII digestion pETDuet-cut carrier recycles large fragment；Then above-mentioned two silver is connected with T4DNA ligase
Section after verifying is correct, obtains pETDuet-cut-Taq carrier, and pETDuet-cut-Taq carrier contains the core of coding cutinase
The nucleotide sequence of nucleotide sequence and encoding DNA polymerase.
(4) pETDuet-cut-Taq carrier is transformed into e. coli bl21 (DE3), culture contains pETDuet-
The e. coli bl21 (DE3) of cut-Taq carrier, then uses IPTG inducing expression, and the temperature of inducing expression is 37 DEG C, induces
The final concentration of 0.5mM of agent, the time of inducing expression are 8h.
After inducing expression is completed, centrifugation removal e. coli bl21 (DE3) retains supernatant, and solid ammonium sulfate is added extremely
Saturation is then centrifuged for taking precipitating, re-suspension liquid (10mM Tris-HCl, pH8.0,1mM EDTA) is added, precipitating is resuspended.It 75 DEG C, protects
Temperature 10 minutes, centrifuging and taking supernatant obtains Taq archaeal dna polymerase.Using the work of Taq DNA enzymatic in isotope-labelling method measurement supernatant
Property, measurement the result is that 11.2U/ μ L.
Embodiment 2
The method of the step of Taq archaeal dna polymerase prepared by embodiment 2 is roughly the same with implementing 1, and difference is: 1) existing
The nucleotide sequence of coding Taq archaeal dna polymerase, insertion coding Taq archaeal dna polymerase are only inserted in pETDuet-1 expression vector
Nucleotide sequence as shown in SEQ ID No.2, without be inserted into coding cutinase nucleotide sequence；2) Taq DNA polymerize
Enzyme is to extract from thallus, rather than extract from culture medium.
Embodiment 3
(1) by the Taq archaeal dna polymerase that embodiment 1 obtains and the Taq archaeal dna polymerase that embodiment 2 is prepared respectively with
The DNA of e. coli bl21 (DE3), the amplimer of directed toward bacteria 16S rRNA and the corresponding probe of amplimer, PCR buffering
Liquid, dNTPs and water are prepared by mixing into the reaction system of the real-time fluorescent PCR amplification of 25 μ L, then carry out real-time fluorescence PCR inspection
It surveys, wherein the final concentration for the Taq archaeal dna polymerase that the Taq archaeal dna polymerase and embodiment 2 of the acquisition of embodiment 1 are prepared
It is 0.01U/ μ L；The final concentration of 40pg/ μ L of the DNA of e. coli bl21 (DE3)；The amplification of e. coli bl21 (DE3)
Primer: sequence are as follows: the upstream primer and sequence of 5 '-CCATGAAGTCGGAATCGCTAG-3 ' (SEQ ID No.3) are as follows: 5 '-
The downstream primer of ACTCCCATGGTGTGACGG-3 ' (SEQ ID No.4), upstream primer and downstream primer are in the reaction system
Final concentration is respectively 0.4uM；The sequence of probe are as follows: 5 '-CGGTGAATACGTTCCCGGGCCTTGTAC-3 ' (SEQ ID
No.5), 5 ' ends of probe are connected with fluorophor FAM, and 3 ' ends of probe are connected with quenching group TAMRA, and probe is in reactant
Final concentration of 0.4 μM in system；The component of PCR buffer and final concentration of: 67mM Tris-HCl (pH 8.9), 16mM (NH4)2SO4,4.5mM MgCl2, 0.01%Tween 20；DNTPs in the reaction system final concentration of 200 μM, are settled to 25 μ with water
L.It is synchronous the DNA of e. coli bl21 (DE3) is not added as compareing.Pcr amplification reaction condition: 95 DEG C of 5min；95 DEG C of 15s,
60 DEG C of 40s recycle 40 reactions.
The result of PCR amplification is as shown in Figure 1.Abscissa indicates recurring number (Cycles) in Fig. 1, and ordinate indicates that fluorescence is strong
It spends (Rn)；Old Taq corresponds to the Taq archaeal dna polymerase and addition 1ng e. coli bl21 that embodiment 2 is prepared in Fig. 1
(DE3) test group of DNA.New Taq corresponds to the Taq archaeal dna polymerase arrived prepared by embodiment 1 and 1ng large intestine bar is added
The test group of the DNA of bacterium BL21 (DE3).Old Taq NTC corresponds to Taq archaeal dna polymerase prepared by embodiment 2 and adds sterilizing
The test group of water.New Taq NTC corresponds to Taq archaeal dna polymerase prepared by embodiment 1 and adds the test group of aqua sterilisa.
As shown in Figure 1, under conditions of the DNA of e. coli bl21 (DE3) is added, the Taq that is prepared with embodiment 1
The test group that test group that archaeal dna polymerase is expanded and the Taq archaeal dna polymerase group being prepared with embodiment 2 are expanded
It can normally expand.Under conditions of the DNA of e. coli bl21 (DE3) is not added, it is polymerize with Taq DNA prepared by embodiment 2
There is amplification when proceeding to 35 circulations in the test group that enzyme group is expanded, shows as false positive；And with embodiment 1
The test group that the Taq archaeal dna polymerase being prepared is expanded is completed until amplification, still without amplification performance, is shown as true
It is negative.
Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, all should be considered as described in this specification.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention
Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>Shenzhen Gang Zhu medical science and technology Co., Ltd
<120>archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 960
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atgcccccgc atgcggcgcg gcccggccct gcacagaacc gaagaggatg tgcaatggct 60
gtgatgaccc cccgccggga gcgctcttcc ctgctctccc gagctctgca agtgacggct 120
gcggctgcca cagcgcttgt gaccgcggtc agcctggccg cccccgctca tgccgccaac 180
ccctacgagc gcggccccaa cccgaccgac gccctgctcg aagcccgcag cggccccttc 240
tccgtcagcg aggagaacgt ctcccggttg ggcgccagcg gcttcggcgg cggcaccatc 300
tactacccgc gggagaacaa cacctacggt gcggtggcga tctcccccgg ctacaccggc 360
acccaggcct ctgtcgcctg gctgggcaag cgcatcgcct cccacggctt cgtcgtcatc 420
accatcgaca ccatcaccac cctcgaccag ccggacagcc gggcccgcca gctcaacgcc 480
gcgctggact acatgatcaa cgacgcctcg tccgcggtgc gcagccggat cgacagcagc 540
cgactggcgg tcatgggcca ctccatgggc ggcggcggca gcctgcgtct ggcctcccag 600
cgtcccgacc tgaaggccgc catcccgctc accccgtggc acctcaacaa gaactggagc 660
agtgtgcggg ttcccaccct catcatcggt gctgacctgg acaccatcgc tccggtcctc 720
acccacgccc ggcccttcta caacagcctc ccgacctcga tcagcaaggc ctacctggag 780
ctggacggcg caacccactt cgccccgaac atccccaaca agatcatcgg caagtacagc 840
gtcgcctggc tcaagcggtt cgtcgacaac gacacccgct acacccagtt cctctgcccc 900
ggaccgcgcg acggactctt cggcgaggtc gaagagtacc gctccacctg ccccttctag 960
<210> 2
<211> 2499
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atgaggggga tgctgcccct ctttgagccc aagggccggg tcctcctggt ggacggccac 60
cacctggcct accgcacctt ccacgccctg aagggcctca ccaccagccg gggggagccg 120
gtgcaggcgg tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac 180
gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc ctacgggggg 240
tacaaggcgg gccgggcccc cacgccggag gactttcccc ggcaactcgc cctcatcaag 300
gagctggtgg acctcctggg gctggcgcgc ctcgaggtcc cgggctacga ggcggacgac 360
gtcctggcca gcctggccaa gaaggcggaa aaggagggct acgaggtccg catcctcacc 420
gccgacaaag acctttacca gctcctttcc gaccgcatcc acgtcctcca ccccgagggg 480
tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga ccagtgggcc 540
gactaccggg ccctgaccgg ggacgagtcc gacaaccttc ccggggtcaa gggcatcggg 600
gagaagacgg cgaggaagct tctggaggag tgggggagcc tggaagccct cctcaagaac 660
ctggaccggc tgaagcccgc catccgggag aagatcctgg cccacatgga cgatctgaag 720
ctctcctggg acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa 780
aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga gtttggcagc 840
ctcctccacg agttcggcct tctggaaagc cccaaggccc tggaggaggc cccctggccc 900
ccgccggaag gggccttcgt gggctttgtg ctttcccgca aggagcccat gtgggccgat 960
cttctggccc tggccgccgc cagggggggc cgggtccacc gggcccccga gccttataaa 1020
gccctcaggg acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc 1080
ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc ctacctcctg 1140
gacccttcca acaccacccc cgagggggtg gcccggcgct acggcgggga gtggacggag 1200
gaggcggggg agcgggccgc cctttccgag aggctcttcg ccaacctgtg ggggaggctt 1260
gagggggagg agaggctcct ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320
ctggcccaca tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc 1380
ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct ggccggccac 1440
cccttcaacc tcaactcccg ggaccagctg gaaagggtcc tctttgacga gctagggctt 1500
cccgccatcg gcaagacgga gaagaccggc aagcgctcca ccagcgccgc cgtcctggag 1560
gccctccgcg aggcccaccc catcgtggag aagatcctgc agtaccggga gctcaccaag 1620
ctgaagagca cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc 1680
cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc cgatcccaac 1740
ctccagaaca tccccgtccg caccccgctt gggcagagga tccgccgggc cttcatcgcc 1800
gaggaggggt ggctattggt ggccctggac tatagccaga tagagctcag ggtgctggcc 1860
cacctctccg gcgacgagaa cctgatccgg gtcttccagg aggggcggga catccacacg 1920
gagaccgcca gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgccgg 1980
gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg cctctcccag 2040
gagctagcca tcccttacga ggaggcccag gccttcattg agcgctactt tcagagcttc 2100
cccaaggtgc gggcctggat tgagaagacc ctggaggagg gcaggaggcg ggggtacgtg 2160
gagaccctct tcggccgccg ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220
cgggaggcgg ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc 2280
atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc caggatgctc 2340
cttcaggtcc acgacgagct ggtcctcgag gccccaaaag agagggcgga ggccgtggcc 2400
cggctggcca aggaggtcat ggagggggtg tatcccctgg ccgtgcccct ggaggtggag 2460
gtggggatag gggaggactg gctctccgcc aaggagtga 2499
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ccatgaagtc ggaatcgcta g 21
<210> 4
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
actcccatgg tgtgacgg 18
<210> 5
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cggtgaatac gttcccgggc cttgtac 27
Claims (10)
1. a kind of expressing gene of archaeal dna polymerase, which is characterized in that including encode cutinase nucleotide sequence and with the volume
The nucleotide sequence of the encoding DNA polymerase of the nucleotide sequence connection of code cutinase.
2. the expressing gene of archaeal dna polymerase according to claim 1, which is characterized in that the nucleosides of the coding cutinase
Acid sequence is as shown in SEQ ID No.1；And/or
The nucleotide sequence of the encoding DNA polymerase is as shown in SEQ ID No.2.
3. a kind of expression vector, which is characterized in that the expressing gene including archaeal dna polymerase of any of claims 1 or 2.
4. expression vector according to claim 3, which is characterized in that the empty carrier of the expression vector is pETDuet-1
Carrier.
5. a kind of host cell, which is characterized in that the host cell include have the right to require 3 or 4 described in expression vector.
6. host cell according to claim 5, which is characterized in that the host cell is Escherichia coli.
7. a kind of preparation method of archaeal dna polymerase, which comprises the following steps:
Construct the expression vector of the expressing gene containing archaeal dna polymerase, wherein the expressing gene of the archaeal dna polymerase includes compiling
The nucleotide of the nucleotide sequence of code cutinase and the encoding DNA polymerase being connect with the nucleotide sequence of the coding cutinase
Sequence；And
The expression vector is transferred to host cell, Fiber differentiation is transferred to the host cell of the expression vector, obtains the DNA
Polymerase.
8. a kind of archaeal dna polymerase, which is characterized in that be made by the preparation method of archaeal dna polymerase as claimed in claim 7.
9. a kind of PCR amplification kit, which is characterized in that including archaeal dna polymerase according to any one of claims 8.
10. PCR amplification kit according to claim 9, which is characterized in that further include nucleic acid extracting reagent, PCR amplification
At least one of buffer and dNTPs reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811590297.6A CN109679973A (en) | 2018-12-25 | 2018-12-25 | Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811590297.6A CN109679973A (en) | 2018-12-25 | 2018-12-25 | Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109679973A true CN109679973A (en) | 2019-04-26 |
Family
ID=66189278
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811590297.6A Pending CN109679973A (en) | 2018-12-25 | 2018-12-25 | Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109679973A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690626A (en) * | 2020-07-02 | 2020-09-22 | 南京诺唯赞生物科技股份有限公司 | Fusion type Taq DNA polymerase and preparation method and application thereof |
| CN114015672A (en) * | 2021-12-06 | 2022-02-08 | 江南大学 | Pfu DNA polymerase |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586312A (en) * | 2012-02-27 | 2012-07-18 | 江南大学 | Method for expressing intracellular protein matrix and application thereof |
| CN103966183A (en) * | 2014-04-30 | 2014-08-06 | 厦门安普利生物工程有限公司 | Method for extracting purified Taq DNA polymerases |
-
2018
- 2018-12-25 CN CN201811590297.6A patent/CN109679973A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586312A (en) * | 2012-02-27 | 2012-07-18 | 江南大学 | Method for expressing intracellular protein matrix and application thereof |
| CN103966183A (en) * | 2014-04-30 | 2014-08-06 | 厦门安普利生物工程有限公司 | Method for extracting purified Taq DNA polymerases |
Non-Patent Citations (1)
| Title |
|---|
| WEI,R. ET AL.: "FR727680.1", 《GENBANK》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690626A (en) * | 2020-07-02 | 2020-09-22 | 南京诺唯赞生物科技股份有限公司 | Fusion type Taq DNA polymerase and preparation method and application thereof |
| CN114015672A (en) * | 2021-12-06 | 2022-02-08 | 江南大学 | Pfu DNA polymerase |
| CN114015672B (en) * | 2021-12-06 | 2022-05-31 | 江南大学 | Pfu DNA polymerase |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102489902B1 (en) | Methods of processing nucleic acid samples | |
| CN110684752B (en) | Mutant Taq DNA polymerase with improved tolerance as well as preparation method and application thereof | |
| CN107636004A (en) | Polymerase mutants and application thereof | |
| KR102432501B1 (en) | Thermolabile exonucleases | |
| CN108070577B (en) | Antiserum interference TaqDNA polymerase and preparation and application thereof | |
| CN103602643B (en) | Recombinant Taq DNA polymerase and preparation method thereof | |
| CN110023493A (en) | Taq DNA polymerase through changing | |
| CN109679973A (en) | Archaeal dna polymerase and preparation method thereof, expressing gene, expression vector, host cell and kit | |
| WO2011157437A1 (en) | Dna polymerases with increased 3'-mismatch discrimination | |
| CN103966183A (en) | Method for extracting purified Taq DNA polymerases | |
| EP2582802A1 (en) | Dna polymerases with increased 3'-mismatch discrimination | |
| CN115916997A (en) | Method for detecting target nucleic acid | |
| CN115667522A (en) | Method for detecting target nucleic acid | |
| CN109266628B (en) | Fused TaqDNA polymerase and application thereof | |
| CN102344967B (en) | Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof | |
| EP2582807A1 (en) | Dna polymerases with increased 3'-mismatch discrimination | |
| CN109486919A (en) | A kind of PCR amplification reagent and its application | |
| CN108192907A (en) | A kind of heat-stable DNA amplification fusion enzyme | |
| EP2582804B1 (en) | Dna polymerases with increased 3'-mismatch discrimination | |
| KR101230362B1 (en) | Hot-start pcr based on the protein trans-splicing of nanoarchaeum equitans dna polymerase | |
| WO2022241158A1 (en) | Methods for making libraries for nucleic acid sequencing | |
| EP2582803B1 (en) | Dna polymerases with increased 3'-mismatch discrimination | |
| CN115261351B (en) | Reverse transcription-polymerization bifunctional enzyme and preparation method and application thereof | |
| CN114438053A (en) | DNA polymerase mutant and application thereof | |
| CN117070492A (en) | Taq DNA polymerase fusing double-stranded DNA binding protein Sto7dm and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190426 |
|
| RJ01 | Rejection of invention patent application after publication |