CN109674807A

CN109674807A - A kind of CSE zymoexciter and its with CSE/H2Application in the relevant disease medicament of S system

Info

Publication number: CN109674807A
Application number: CN201910060997.2A
Authority: CN
Inventors: 耿彬; 杜从阔
Original assignee: Fuwai Hospital of CAMS and PUMC
Current assignee: Fuwai Hospital of CAMS and PUMC
Priority date: 2019-01-18
Filing date: 2019-01-18
Publication date: 2019-04-26

Abstract

The invention discloses demethylbellidifolin FMDV VP1 genes in preparation prevention or treatment and CSE/H₂Application in the relevant disease medicament of S system.Inventor has found that demethylbellidifolin FMDV VP1 gene is to promote CSE enzymatic activity in combination with CSE, increases heart, blood vessel and kidney endogenous H₂The generation of S is the activator of new CSE enzyme.Demethylbellidifolin FMDV VP1 gene activates blood vessel CSE/H₂S system significantly reduces hypertension, and mitigates vascular remodeling, and can inhibit vascular inflammation, mitigates atherosclerotic plaque.Activate kidney CSE/H₂S system reduces ischemia-reperfusion injury of kidney.Therefore, demethylbellidifolin FMDV VP1 gene can be used for treating CSE/H₂The relevant disease of S.

Description

A kind of CSE zymoexciter and its with CSE/H2In the relevant disease medicament of S system Using

Technical field

The present invention relates to biomedicine technical fields, and in particular to a kind of CSE zymoexciter and its with CSE/H₂S system Application in relevant disease medicament.

Background technique

Hydrogen sulfide (hydrogen sulfide, H₂S) as after nitric oxide (NO) and carbon monoxide (CO) Three kinds of gaseous signal molecules, the adjusting of multiple system physiological functions such as wide participation nerve, cardiovascular, digestion, breathing.Cystathionie γ lyases (cystathionine γ-lyase, CSE) is that cardiovascular organization generates H₂The key enzyme of S, key reaction substrate It is cysteine.In cardiovascular system, CSE/H₂S can reduce blood pressure, and mitigate atherosclerosis, improve heart, kidney The effect of ischemical reperfusion injury.In a variety of cardiovascular disease models, such as spontaneously hypertensive rat model, Atherosclerosis Change model and ischemia-reperfusion injury model etc., H₂The content of S is remarkably decreased, and external source gives H₂S donor can effectively mitigate cardiovascular damage Wound.Therefore, H₂S is considered as a kind of novel cardiovascular protection factor, develops H₂S donor medicine becomes treatment cardiovascular disease A kind of new approaches.

So far, the H of people's exploratory development₂S donating species are various, and that mainly studies has: (1) H₂S gas, H₂S's is full And aqueous solution, NaHS, Na₂S, the sulphurizing salts such as CaS；(2) lawesson reagent derivative, such as GYY4137；(3) big in natural products Allicin class, such as diallyl trisulfide (DATS)；(4) dithiothione analog derivative such as removes first Anethol Trithione (ADT-OH)； (5) cysteine analog derivative, such as S-propargyl-cysteine (S-Propargyl-Cysteine, SPRC)；(6) carbonyl sulfide Classifications such as (carbonyl sulfide, COS).

In research work, Chang Xuanyong NaHS and GYY4137 are as H₂S donor, discharges H automatically₂S gas, it is efficient and convenient.H₂S Gas controllability is bad, it is difficult to control H₂The rate of release of S gas, and have H₂The danger of S poisoning.Sulphurizing salt such as NaHS belongs to fastly Quick-release puts H₂S donor discharges H₂S rate is exceedingly fast, and half-life period is of short duration, is only applicable to scientific research, is not used to clinical test.GYY4137 Discharge H₂S rate is relatively slow.(pH=7.4,37 DEG C) in physiological conditions, the H of GYY4137 (1mmol/L) release₂S exists 15min reaches peak value, and can maintain 75min.But GYY4137 equally has its shortcoming, and it is remaining molten that product is often easy doping Agent, such as chloride dichloromethane complex (xCHCl₂), secondary products and three-level product after GYY4137 metabolism, it is possible to have new Biological characteristics.In addition, though the duration of GYY4137 can reach 1h, apply it is still partially of short duration on human body, and it away from Still there is a certain distance from clinical application.

Diallyl polysulfide in garlic P.E can be generated by way of mercaptan dependence in red blood cell H₂S, this is also that garlic realizes blood pressure lowering, protects cardiovascular main mechanism, but it is with stronger penetrating odor.Remove first fennel Trithio (ADT-OH) itself has certain H₂The effect of S donor, but people are more to select itself and other drugs split, drop Play the role of drug combination while low drug side-effect.The drug of these splits often has the advantages that both sides, while secondary Effect can be smaller, but the applicable object of these drugs is also restricted, and is no longer simple H₂S donor, is no longer desirable for height The other diseases such as blood pressure, atherosclerosis.

Although to H₂The research of S donor has been compared deeply, and alternative type is also very much, but these H₂S donor is also big It all can be only applied to scientific experiment, actually enter the seldom of clinical experimental stage.Many drug body intracellular metabolite half-life shorts, It is more toxic, the deficiencies of druggability is poor, really applied to the treatment of cardiovascular disease, there are also one section of not short distances for distance.

Existing H₂S donor is all direct exogenous offer H₂S, it is few to intervene endogenous H from other angles₂The generation of S And then improve the horizontal drug of hydrogen sulfide in body.CSE is H in cardiovascular system₂The key enzyme that S is generated.Day can be found Right activator of the small molecule as CSE, the activity of CSE, improvement body H in reinforcement₂The expression of S, to reach treatment The purpose of cardiovascular disease is current those skilled in the art's urgent problem.

Summary of the invention

To solve the above-mentioned problems, the main purpose of the present invention is to provide a kind of natural small molecule compounds as CSE Activator, enhancing CSE activity, endogenous increase H₂S yield, and then play the role for the treatment of disease.

Based on this, the present invention is with endogenous H₂The key enzyme CSE that S is generated is point of penetration, using molecular docking technology from day Screening can have selected small point natural with the natural small molecule compounds of CSE specific bond, finishing screen in right small molecule compound library Sub- compound-demethylbellidifolin FMDV VP1 gene (norswertianolin, NW).And from molecular level confirm NW with There are intermolecular interactions by CSE.NW is verified on isolated condition, cell level and animal model increases endogenous H₂S, protection The effect of the functions such as angiocarpy.

Firstly, the present invention provides demethylbellidifolin FMDV VP1 genes in preparation prevention or treatment CSE/H₂S system Application in relevant disease medicament.

Preferably, described and CSE/H₂The relevant disease of S system includes circulation system disease, respiratory disease, digestion Systemic disease, disease in the urological system, endocrine system disease, genital system diseases, sensorium's disease or motor system disease.

Preferably, the circulation system disease includes hypertension, atherosclerosis, angiosteosis, coronary syndrome, the heart Flesh infarct, myocardial hypertrophy, heart ischemia reperfusion, heart failure, aneurysm, haemorrhagic shock, phlebothrombosis, cerebral infarction, brain Bleeding.Preferably, the respiratory disease includes Chronic Obstructive Pulmonary Disease, pulmonary hypertension, acute lung injury, interstitial lung Fibrosis, chronic bronchitis, asthma, pulmonary heart disease.Preferably, the disease of digestive system includes digestive tract ulcer, liver fiber Change, nonalcoholic fatty liver, cirrhosis, straight colon cancer.Preferably, the disease in the urological system includes Ischemia-reperfusion Injury, urgency Property renal damage, kidney fibrosis, chronic renal failure.Preferably, the endocrine system disease includes type-1 diabetes mellitus, II type Diabetes.Preferably, the genital system diseases include impotence, premature ejaculation.Preferably, sensorium's disease includes retina Lesion.Preferably, the motor system disease includes fracture, rheumatoid arthritis.

Further, the present invention provides a kind of agonist of CSE enzyme, and the agonist is that natural small molecule compounds go first Base daisy leaf gentisin glycosides.

Further, the present invention provides demethylbellidifolin FMDV VP1 genes in the agonist for preparing CSE enzyme Using.

Preferably, there is interaction between the demethylbellidifolin FMDV VP1 gene and CSE enzyme, key combines Site is Leu91.

Preferably, the methyl daisy leaf gentisin glycosides can increase CSE expression, enhance the activity of CSE, in increase Source property H₂The generation of S.

Preferably, the methyl daisy leaf gentisin glycosides can activate blood vessel CSE/H₂S system significantly reduces high blood Pressure, and mitigate vascular remodeling, and can inhibit vascular inflammation, mitigate atherosclerotic plaque.Activate kidney CSE/H₂S system, Ischemia-reperfusion injury of kidney is reduced, acute renal injury is alleviated.

Further, the agonist provided by the invention is in preparation prevention or treatment and CSE/H₂S system is relevant Application in disease medicament.

Further, the present invention provides a kind of pharmaceutical composition, and the drug contains natural small molecule compounds and goes first Base daisy leaf gentisin glycosides and pharmaceutically acceptable carrier.

Preferably, the pharmaceutically acceptable carrier include but is not limited to diluent, buffer, suspension, emulsion, Granula, encapsulation agents, excipient, filler, adhesive, spray, cutaneous permeable agent, wetting agent, disintegrating agent, sorbefacient, Surfactant, colorant, corrigent or absorption carrier.

Preferably, the effective dose of described pharmaceutical composition administration is the demethyl daisy leaf of daily 4~80mg/kg weight Gentisin glycosides.

Preferably, the effective dose of described pharmaceutical composition administration is the demethyl daisy leaf of daily 4.22mg/kg weight Gentisin glycosides.

The effective dose of pharmaceutical composition administration of the invention can with administration mode and disease to be treated it is serious Degree etc. is adjusted correspondingly.It is preferred it is a effective amount of can be each because usually determining by those of ordinary skill in the art's synthesis. The factor includes but is not limited to: the pharmacokinetic parameter of demethylbellidifolin FMDV VP1 gene, treated patient Health status, weight, administration route etc..

Preferably, described pharmaceutical composition can for tablet, capsule, granule, pill, sustained release preparation, controlled release preparation, Oral solution or patch etc..

Preferably, the pharmaceutical composition can be carried out by oral, injection, spraying sucking or through approach such as gastrointestinal tracts Administration.

Still further, pharmaceutical composition of the present invention is in preparation prevention or treatment and CSE/H₂The relevant disease of S system Application in medicine.

Preferably, with CSE/H₂The relevant disease of S system includes circulation system disease: hypertension, atherosclerosis, blood Pipe calcification, coronary syndrome, myocardial infarction, myocardial hypertrophy, heart ischemia reperfusion, heart failure, aneurysm, it is blood loss stop Gram, phlebothrombosis, cerebral infarction, cerebral hemorrhage；Respiratory disease: Chronic Obstructive Pulmonary Disease, pulmonary hypertension, acute lung damage Wound, pulmonary interstitial fibrosis, chronic bronchitis, asthma, pulmonary heart disease；Disease of digestive system: digestive tract ulcer, liver fibrosis, non- Alcoholic fatty liver, cirrhosis, straight colon cancer；Disease in the urological system: Ischemia-reperfusion Injury, acute renal injury, kidney fibrosis, slow Property renal failure；Endocrine system disease: type-1 diabetes mellitus, type-2 diabetes mellitus；Reproductive system: impotence, premature ejaculation；Sensorium: Retinopathy；Kinematic system: fracture, rheumatoid arthritis.

The utility model has the advantages that

Present invention finds demethylbellidifolin FMDV VP1 genes can be coupled on CSE enzyme, forms crucial hydrogen with Leu91 Key；Demethylbellidifolin FMDV VP1 gene promotes CSE enzymatic activity, can not only promote the H of cell₂S yield increases the table of CSE It reaches, and dose dependent increases the in vitro tissues H such as heart, kidney, blood vessel₂S yield.After animal administration, the devices such as angiocarpy, kidney Official H₂The yield of S also dramatically increases.

Endogenous CSE/H₂S is impaired in a variety of diseases, leads to endogenous H₂S yield is lowered, and supplements H₂S donor has Good protective effect.Previously research is all made of directly supplement H₂The donor of S, present invention finds H₂S generates key enzyme CSE's Agonist-demethylbellidifolin FMDV VP1 gene can not only stimulate the expression of CSE albumen, and can increase endogenous Property H₂The generation of S can activate blood vessel CSE/H₂S system significantly reduces hypertension, and mitigates vascular remodeling, and can inhibit vasculitis Disease mitigates atherosclerotic plaque.Activate kidney CSE/H₂S system reduces ischemia-reperfusion injury of kidney.Therefore, first is gone Base daisy leaf gentisin glycosides can be used for treating CSE/H₂The relevant disease of S system.

Detailed description of the invention

The interaction of instrument analysis NW and CSE is moved in the micro thermophoresis of Fig. 1.In figure, the affinity of (A) between NW, PPG and CSE point Analysis, NW concentration are 122nM~4mM, and PPG concentration is 244nM~8mM.(B) NW and CSE and two kinds of mutain affinity analysis. NW concentration is 122nM-4mM.

Fig. 2 NW in gradient dependence enhancing CSE activity, increase H₂S yield.Various concentration NW is to (A) heart (B) blood Manage (C) kidney (D) hepatic homogenate liquid H₂The influence of S yield.Wherein, kidney, liver incubation reaction 2h, n=4；Heart group Reaction 3h is knitted, 5h, n=3 react in vascular tissue.(E) fat cell of originally culture is inoculated in 24 orifice plates, 100 μM of NW is added, It is incubated for 36h, detects its H₂The amount of S.(F) SD rat skin lower injection NW4.4mg/kg body weight/day continues one week, and coring is dirty, kidney Detect its H₂S yield, n=10.(G) NW of gradient concentration is added in 6 orifice plates in HepG2 cell inoculation, is incubated for for 24 hours, detects CSE Protein expression.As a result it is indicated with average value ± standard error, * p < 0.05, * * p < 0.01versus (NW=0mM) group.

Fig. 3 NW improves I/R rat H₂S expression alleviates acute kidney injury.Ischemic 1h Reperfu- sion for 24 hours after, detect (A) The H of renal tissue₂S yield detects the content of (B) creatinine, (C) urea nitrogen in serum, detects the sulphur of (D) nephridial tissue β-actin Hydrogenation modification is horizontal, measures internal H₂S is horizontal, detects the CSE protein expression of (E) renal tissue.As a result with average value ± standard It accidentally indicates, * p < 0.05, * * p < 0.01, * * * p < 0.001versus sham group；#p < 0.05, ##p < 0.01versus I/R group.

Fig. 4 NW alleviates acute kidney injury caused by kidney I/R.

The oxidative stress of I/R is effectively relieved in Fig. 5 NW.Kidney frozen section, room temperature rewarming, DHE dyes 30min, glimmering Photo-beat is shone.N=5.

Fig. 6 NW inhibits the apoptosis of I/R induction.Kidney frozen section carries out the immunohistochemistry dye of cleaved caspase-3 Color.

Fig. 7 rat blood serum urea nitrogen, creatinine content.Bilateral renal ischaemia 1h after Reperfu- sion 2 weeks, detects Serum Indexes.N= 5.BUN: urea nitrogen；Cr: creatinine.As a result it is indicated with average value ± standard error, * * p < 0.01, versus sham group；#p < 0.05, Versus I/R group.

Fig. 8 NW alleviates ischemia-reperfusion.Bilateral renal ischaemia 1h, Reperfu- sion 2 weeks.It takes kidney to fix, embed, stone Wax slice, HE dyeing observation Renal pathology.N=5.

Fig. 9 bilateral renal ischaemia 1h, Reperfu- sion 4 weeks.It takes kidney to fix, embed, paraffin section, HE dyeing observation Pathological Variation.N=5.

Bottom SHR rat blood pressure significantly drops in Figure 10 NW.As a result N=10 indicates with average value ± standard error, p < 0.01 * *.

Figure 11 NW reduces SHR rat systolic pressure.As a result N=7 indicates with average value ± standard error, * * p < 0.01versus WKY；##p<0.01versus SHR.

Figure 12 NW can increase the H of SHR rat aorta, heart₂S yield improves the expression of CSE in aorta.(A) it takes WKY group, SHR group and SHR+NW group aorta obtain lysate with 100mM kaliumphosphate buffer (pH 7.4) liquid nitrogen grinding, sub- The H of methyl blue laws detection vascular tissue₂S yield, N=8.(B) three groups of rat cardiac tissue homogenate, measures H₂S yield, N=8. (C) westernblot detects the protein expression of three groups of rat aorta CSE.(D) westernblot is detected in three groups of rat hearts The protein expression of CSE.(E) CSE in Immunohistochemical study blood vessel.Antibody dilution ratio 1:200.As a result with average value ± Standard error expression, * p < 0.05, * * p < 0.01, versus WKY group；#p < 0.05, ##p < 0.01, versus SHR group.

Figure 13 NW can partially inhibit inflammatory reaction, reduce the expression of VCAM-1.(A) VCAM- is detected with real-time quantitative PCR 1；(B)MCP-1；(C)Adiponectin；(D)TNF-α.As a result N=10 indicates with average value ± standard error, * p < 0.05, * * p < 0.01, versus WKY group；#p < 0.05, versus SHR group.

Thickening for Hypertensive Rats resistance vessel wall can be effectively relieved in Figure 14 NW.Take rat femoral carry out paraffin section, HE dyeing, counts the pipe thickness (A) of resistance vessel and the ratio (B) of pipe thickness and intravascular space diameter；(C) it is contaminated for HE Color result.As a result it is indicated with average value ± standard error, n=10, * p < 0.05, versus WKY group；#p<0.05,versus SHR Group.

Figure 15 NW significantly reduces atherosclerotic lesions.In figure, (A) aorta en-face oil red O stain；(B) actively Arteries and veins root Mac-2 dyeing.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment Used in the conventional means that are well known to those skilled in the art of technological means.

The present invention downloads the crystal file (PDB_ID:3COG) of source of people CSE from Protein Data Bank RCSB.org, with text This software for editing (VI) removes unwanted part, using molecular docking technology, from screening in natural products database (CNPD) The natural small molecule compounds that can be interacted with CSE.The present invention screens to obtain natural small molecule compounds-demethyl daisy Leaf gentisin glycosides.To confirm NW and CSE there are intermolecular interaction, inventor prepares CSE- green fluorescent protein (green fluorescentprotein, GFP) fusion protein moves instrument (microscale with micro thermophoresis Thermophoresis, MST) the technology analysis CSE and intermolecular interaction of demethylbellidifolin FMDV VP1 gene.

For the biological function for understanding demethylbellidifolin FMDV VP1 gene, inventor studies demethyl daisy leaf first Gentisin glycosides is to the tissue homogenates such as heart, kidney, blood vessel H₂The influence of S yield；And then experiments in vivo is used, living body is thin Born of the same parents give the H collected after demethylbellidifolin FMDV VP1 gene is handled for 24 hours₂S release, and detect the protein expression and H of CSE₂S Yield.Further, inventor's demethylbellidifolin FMDV VP1 gene from whole animal model makees the activation of CSE With, and demethylbellidifolin FMDV VP1 gene is observed to hypertension, ischemia-reperfusion injury of kidney and atherosclerosis The therapeutic effect of three cardiovascular disease models.

It is the dynamic analysis life of the thermophoresis based on biomolecule that (microscale thermophoresis, MST) is moved in micro thermophoresis The technology of object interaction of molecules.Instrument is moved in micro thermophoresis causes molecular orientation mobile using infrared laser progress local heating, after And pass through the molecular distribution ratio in the included fluorescence analysis temperature gradient field of molecule.It is intermolecular to cause biomolecule in the presence of combination The variation of size, charge and hydrated sheath, and then influence the distribution of fluorescence in temperature gradient field.The one of the nature in the end of the year 2010 Piece article first reported this technology, to analyze the interaction between protein-protein.Nowadays, MST can analyze respectively The interaction of kind different molecular is skill optimal at present in the magnitude range and detection dynamics range parameter of analysis object Art.It has many advantages, such as amount of samples is few, without purifying, being at low cost, simple and fast.

Main reagent is as follows in the embodiment of the present invention:

Experimental animal and cell:

6-8 week old male Sprague-Dawley (SD) rat (weight 160-180g)；8 week old male WKY rats and SHR Rat (about 200g)；8 week old C57BL/6 mouse (about 25g) above animals are mentioned by Department Of Medicine, Peking University's Experimental Animal Center For being SPF grades of healthy animals, normal condition raising, ad lib and drinking-water.This research is completely in accordance with Department Of Medicine, Peking University's reality The relevant regulations for testing the care of animal regulations and Ethics Committee carry out.

293A cell line, HepG2 cell line are purchased from Chinese Academy of Medical Sciences basis and Institute for Medical Research's cellular resources The heart.

Experiment reagent:

Common general chemistry reagent is ommercially available AR

Demethylbellidifolin FMDV VP1 gene (norswertianolin, NW) is had by Sichuan Province's Wei Keqi biotechnology Limit company provides；L-cysteine: sigma company, the U.S.；Zinc acetate (Beijing Chemical Plant)；N, N- dimethyl-p-phenylenediamine's hydrochloric acid Salt (three factory of Shanghai reagent)；Ammonium ferric sulfate (Tianjin Ke Miou chemical reagent development centre)；Vulcanized sodium (Chinese medicines group chemistry examination Agent Co., Ltd)；Phosphopyridoxal pyridoxal phosphate (article No. VWRV0573-5g, Amresco company, the U.S.)；The gland for being overexpressed mPCSK9 is related (control provides virus for AAV8-CMV-GFP) You Weizhen Biotechnology Co., Ltd；The anti-Actin antibody (SC-47778) of mouse: beauty Santa Cruz Biotechnology company, state；Rabbit-anti EIF-5 antibody: U.S. Santa Cruz Biotechnology is public Department；Rabbit-anti CSE antibody (ab189916): abcam company, the U.S.；The anti-CBS antibody of mouse: Abnova company；Horseradish peroxidase The secondary antibody of rabbit-anti goat of label, the secondary antibody of rabbit anti-mouse, goat antirabbit secondary antibody be purchased from sigma company, the U.S.；It is fat-free The bovine serum albumin(BSA) (BSA) of acid: Beijing Puli's lema gene Technology Co., Ltd.；Ultra-sensitive chemical luminescence detection kit (ECL): Beijing Puli's lema gene Technology Co., Ltd.；DAB developing solution: Beijing Bioisystech Co., Ltd, Zhong Shan Golden Bridge；DMEM high sugar training Support base: sigma company, the U.S.；Trypsase: sigma company, the U.S.；Fetal calf serum (FBS): Hyclone company, the U.S..

There are intermolecular interaction, key binding sites are by 1 demethylbellidifolin FMDV VP1 gene of embodiment and CSE Leu91

The present invention downloads the crystal file (PDB_ID:3COG) of source of people CSE from Protein Data Bank RCSB.org, with text This software for editing (VI) removes unwanted part, using molecular docking technology, from screening in natural products database (CNPD) The natural small molecule compounds that can be interacted with CSE.Compound demethylbellidifolin mouth mountain ketone has been obtained through screening Glycosides (norswertianolin, NW).

NW is exported from CNPD database, saves as 3D structure with Discovery Studio Visualizer 4.1.With The structure of Gauss software optimization NW simultaneously is used to make field of force template.It is obtained using Autodock Vina docking CSE and NW initial Composite structure calculates the molecular dynamics of 20ns using NAMD2.9, calculates RMSD.From the point of view of the result of RMSD, dynamics Have reached equilibrium state.The kinetic locus for taking rear 10ns exports average structure with VMD, and analyzes interaction.

Kinetic measurement is fitted by this computer mould, there are two kinds of possible combinations with CSE by NW, after molecular docking Two kinds of compounds can be obtained.The first of NW and CSE combination mainly pass through traditional hydrogen bond, C-H bond and cation-π The interaction such as key, there is six amino acid binding sites of Leu68, Arg96, Gly93, Thr94, Asp164, Ser186；Second Combination is mainly traditional hydrogen bond and Pi-Alkyl key, there is five amino of Gly67, Leu68, Glu134, Asp164, Leu318 Sour binding site.Compare two kinds of combinations, inventor has found that the binding site of two kinds of combinations is respectively positioned on the height guarantor of CSE Sequence is kept, their shared two basic change sites: Leu68, Asp164.Due to pre-processing CSE crystal file when, once remove before Unwanted 23 amino acid in face, therefore actual sequence number of the two amino acid in CSE should be Leu91 and Asp187.It is clear NW's and CSE be combined with each other, and inventor selects to attempt to be mutated the two sites, and Leu91 is mutated into serine by inventor's selection (Ser), it is denoted as L91S；Asp187 is mutated into alanine (Ala), is denoted as D187A, and number represents the sequence of mutational site amino acid Number, number front and back respectively represents the amino acid of mutation front and back.The Gene Name of CSE albumen is CTH.Inventor is tieed up true by Shandong Biotechnology Co., Ltd purchase wild type human CTH is overexpressed plasmid, and (CH887115, NM_001902ORF are cloned into pENTER load Body) and construct two kinds of mutains L91S, D187A overexpression plasmid.The shadow that detection mutation CSE interacts to NW in CSE It rings, that is, can verify that the binding site of NW Yu CSE intermolecular interaction.

Inventor constructs the plasmid for being overexpressed GFP-CSE fusion protein first.The area the CDS overall length of design primer amplification CTH: 18 bases are respectively selected end to end in CTH sequence and the restriction enzyme site of Xho I and EcoR I is added at both ends.Design primer is as follows:

Forward,CCGCTCGAGCGGATGCAGGAAAAAGACGCC(SEQ ID NO.1)；

Reverse,CCGGAATTCCGGCTAGCTGTGACTTCCACT(SEQ ID NO.2)。

Plasmid is overexpressed as template using people CTH, carries out High fidelity PCR using this primer, the condition of amplified reaction is 98 DEG C 5min, (98 DEG C of 10s, 60 DEG C of 15s, 68 DEG C of 3min) are recycled for 35 totally, 68 DEG C of 5min, 4 DEG C of preservations.The bis- enzymes of Xho I and EcoR I After cutting, it is attached with the pEGFP-C3 vector plasmid for also passing through Xho I and EcoR I double digestion, pEGFP-C3 carrier The ratio between amount of substance of pcr amplification product of plasmid and CTH is about 1:5,16 DEG C of 12h, 70 DEG C of 5min.The expression vector built Transformed competence colibacillus cell, bed board select the single colonie culture of growth, and pick out the positive clone of conversion by PCR identification.Into One step passes through sequencing identification.Two kinds of CSE mutains are equally operated, and the matter of expression GFP- mutain fusion protein is obtained Grain.

Inventor selects the micro thermophoresis of MonolithNT.115 of nanotemper company to move between instrument detection NW and CSE Intermolecular interaction.

Select 293A cell, the DMEM high glucose medium culture of 10%FBS, it is to be grown to 70%~80% when, cell point The plasmid or L91S-GFP of 10 μ g expression GFP-CTH fusion protein, the plasmid of D187A-GFP fusion protein, transfection are not transfected 48h.In receiving cell on ice, PBS is washed three times, and after pancreatin digests 30s, serum terminates digestion, 1000rpm, 4 DEG C of centrifugation 5min.It abandons Supernatant, PBS (ice) are cleaned three times, and 250 μ l lysis Buffer are added and are cracked.1h is cracked on ice, it is 3 times ultrasonic, every time 10S, 30% amplitude.Centrifugation, 12000rpm, 4 DEG C, 15min takes supernatant stand-by.NW DMSO dissolves configuration 100mM storing liquid, Again with diluted to 8mM, and then using dilution doubling dilution 15 times to 244nM (a certain amount of DMSO is added, DMSO is excluded Interference).Take protein lysate by 1:1, the ratio of 1:2,1:5 dilute respectively, carry out fluorescence intensity detection, and selection is suitable glimmering The corresponding dilution ratio of luminous intensity mixes mixing with the NW of 16 concentration gradients such as 4mM-244nM respectively, is drawn with capillary mixed Solution after even is uniformly put into the interaction of instrument detection CES and NW.

Inventor analyzes the interaction of NW and CSE using MST, while choosing the inhibitor PPG of CSE as positive right According to.As a result as shown in Figure 1, NW and CSE are there are significant combination, the interaction of L91S mutant and NW are completely disappeared, The combination of D187A mutant and NW obviously weaken, this shows there is interaction between NW and CSE, and its key binding sites For Leu91.

2 demethylbellidifolin FMDV VP1 gene of embodiment increases H₂The yield of S

In order to study NW to the active influence of CSE, present invention selection looks first at NW in vitro tissue homogenate H₂S yield Influence.Inventor chooses NW pairs of normal SD rats heart, blood vessel, kidney and liver organization research various concentration gradient respectively Tissue homogenate H₂The influence of S yield.

Methylene blue laws is selected to detect hydrogen sulfide yield.Firstly, weighing 200mg rat heart, 2ml 50mMpH6.8 is added Kaliumphosphate buffer (ratio of 1:10) homogenate.4 DEG C of 12000rpm are centrifuged 10min, take supernatant.Prepare 10ml working solution, ingredient For the phosphopyridoxal pyridoxal phosphate containing 2mM, 100mM pH7.4 kaliumphosphate buffer (matching while using, the 10ml phosphoric acid of 10mM cysteine 12.1mg cysteine is added in potassium buffer, 5.3mg phosphopyridoxal pyridoxal phosphate is protected from light, and concussion is uniform).50.64mgNW is taken, is added 300 μ l DMSO dissolution can obtain 400mM NW storing liquid.It takes special fine taper bottle (10), has a circle cylindrical shape prominent in bottle It rises and space in conical flask is allocated as inside and outside two parts.Filter paper, size 2cm*3cm are cut according to sample size.In in conical flask Circle spools filter paper, and bottle stopper is not touched on filter paper top, and inner ring adds 500 μ l, 5% zinc acetate solution.Outer ring be added 900 μ l working solutions and 100 μ l homogenates.The 400mMNW of different volumes is added to outer ring, making the concentration of NW is respectively 0.25mM-40mM (concentration gradient Are as follows: 0,0.25,0.5,1,2,4,8,16,32,40), low concentration dosage adds a certain amount of DMSO, keeps the final concentration of DMSO identical. Bottle stopper is covered, 37 DEG C of shaking baths are incubated for 3h.Outer ring is added 20% trichloroacetic acid of 1ml and terminates reaction 1h.Inner ring zinc acetate is molten Liquid and filter paper are transferred to new test tube, sequentially add 2ml ddH₂O, 500 μ l phenylenediamine solutions, 50 μ l ammonium ferric sulfate solutions mix It is even, react 15min.It using vulcanized sodium as standard items, is equally reacted, ultraviolet specrophotometer measures production concentration.

Its hetero-organization uses same method, detects NW to each tissue H₂The influence of S yield.Because of H in different tissues₂S is raw It is variant at the activity of enzyme, therefore the incubation time of different tissues slightly has difference.Kidney, liver incubation reaction 2h, heart tissue It is incubated for 3h and detects H in each tissue after 5h reacts in vascular tissue₂The yield of S.This index can not only intuitively reflect NW to life Object endogenous H₂The influence of S yield also can partially reflect the active variation of CSE.As a result as shown in Fig. 2, heart (Fig. 2A), In blood vessel (Fig. 2 B), kidney (Fig. 2 C) tissue, the dose-dependent increase H of NW₂S yield, enhancing CSE activity.In liver organization In (Fig. 2 D), NW is to H₂S yield has no significant effect, and this point may be with liver organization basis H₂S yield is excessively high and cystathionie- β-synthase (cystathionine β-synthase, CBS) rich content is related.

Further, inventor starts to observe NW to the active influence of CSE in body tissue cell.Take male SD rat (160 ~180g), sacrificed by decapitation takes out fat pad by epididymis.After shredding be added clostridiopetidase A I working solution (I containing clostridiopetidase A 1mg/ml, The KRB solution of 1%BSA bovine serum albumin(BSA) component V and 200nM adenosine), 37 DEG C of water-bath 100rpm 40~50min of Pingyao make It is completely discrete between fat cell.It is resuspended afterwards three times after cell filtration using without phenol red DMEM washing.Then it is drawn in shake Equal cell suspension is divided into each hole of 24 orifice plates, and 37 DEG C contain 5%CO₂Environment in be incubated for culture.When cell it is long to 80% when, more 10mM L-cysteine and 2mM phosphopyridoxal pyridoxal phosphate is added in the DMEM high glucose medium renewed, by 24 hole cells in 24 orifice plates point Make two groups, experimental group gives 100 μM of NW processing, and control group gives equivalent DMSO.Adherency filter membrane is covered in tissue culture plate, and is dripped Add 200 μ L zinc acetate solutions, the H of the adsorbable cell release of zinc acetate₂S generates zinc sulphide and precipitates, and after cell culture 36h, utilizes Methylene blue laws detection plate covers filter membrane absorption H₂The amount of S.The result shows that NW can dramatically increase the H of active somatic cell₂S yield increases The activity (Fig. 2 E) of Qiang Ti CSE.

Next, inventor carries out verifying NW to endogenous H with whole animal₂The influence that S is generated, inventor is to SD Rat skin lower injection NW 4.22mg/kg body weight/day, continues one week.Rat is put to death after a week, the tissue such as dirty, kidney of coring, It prepares homogenate and detects its H₂S yield.As a result, it has been found that NW is after one week of dosing, rat heart, renal tissue are with L-cysteine Substrate catalysis generates H₂The ability of S significantly increases (Fig. 2 F), this shows rat endogenous H₂The efficiency that S is generated improves, internal CSE Activity be significantly enhanced.In addition, inventor selects HepG2 cell, the NW processing of various concentration is given, the albumen of CSE is detected Content, the results showed that NW can improve the protein expression level (Fig. 2 G) of CSE.Existing research shows exogenous H₂S can be improved dynamic Therefore object prompts NW by increasing endogenous H in the CSE expression of body₂S and then the protein concentration for improving CSE.

The above experiment, in body, again to whole animal from homogenate to cell, demonstrates NW pairs in different level from vitro H₂The gain effect of S yield prompts NW that can enhance the activity of CSE and then increases endogenous H₂The generation of S.

3 demethylbellidifolin FMDV VP1 gene of embodiment can alleviate the ischemical reperfusion injury of kidney

One of the main reason for renal ischemic reperfusion injury is acute renal failure is clinically common in shock or kidney In the surgical procedures such as transplanting, Shenbing mixture.Some researches show that H₂Renal ischemic reperfusion injury can be effectively relieved in S, and CSE is knocked out Kidney of mouse H₂The generation of S is reduced, and the damage and the death rate after ischemia-reperfusion also greatly increase.Therefore, exogenous to mention For H₂S or H₂S donor is possible as the effective ways for mitigating ischemical reperfusion injury in the operation such as kidney transplant.

Inventor takes SD rat, and divide three groups: sham-operation group (Sham group), Ischemia-reperfusion Injury group (I/R group), renal ischaemia is again NW treatment group (I/R+NW group) is given in perfusion.Sham group only opens abdomen, does not press from both sides and closes blood vessel；After I/R group Rat Right kidney folder closes 1h, left kidney It extracts or permanently ligatures left renal artery, left renal vein together with left side ureter, restore right kidney blood supply after 1h, Reperfu- sion is for 24 hours.I/R+ NW group operation consent 2h gastric infusion NW (42mg/kg body weight), ischemic 1h, Reperfu- sion is for 24 hours.3 fillings during Reperfu- sion Stomach administration.After for 24 hours, anesthesia takes blood, tissue sampling to fix.Can observe by improving nephridial tissue H after NW is administered₂S concentration is alleviated The damage of Ischemia-reperfusion Injury bring.

Inventor looks first at rat kidney CSE/H₂The variation of S system expression.As a result, it has been found that after I/R, kidney group The H knitted₂S yield significantly reduces, and the protein expression level of CSE is significantly reduced；The H that can significantly improve kidney is administered in NW₂S yield The sulphur hydrogenation modification level of (Fig. 3 A), β-actin also have raising (Fig. 3 D), and the protein expression level of CSE does not have significant change Change (Fig. 3 E), which demonstrate the activity that NW can significantly improve CSE, improve the H of I/R rat₂S is horizontal, and it is to CSE protein expression Horizontal influence or because the time is insufficient, has no significant changes.

Wherein, the H of nephridial tissue₂S yield is detected using methylene blue laws.It is examined using the Biotin-switch method of improvement The sulphur for surveying β-actin hydrogenates modification: 1) rat kidney tissue about 100mg is taken, according to the ratio HEN solution (HEPES- of 1:10 NaOH,pH 7.7,250mM；EDTA 1mM；New cuprous 0.1mM) (100 μM of de-iron head amine are added) homogenate cracking nephridial tissue, 4 DEG C 12000g is centrifuged 10min, takes supernatant.With BCA method protein quantification, protein concentration is adjusted to 0.8mg/ml.By experimental animal point Group: sham group, I/R group, I/R+NW group respectively take the Tissue lysates of 300 μ l.2) 4 times of volumes are added into lysate Blocking solution (HEN buffer:9volumes；SDS (25%w/v inddH₂O):1volume；It is added final concentration of The MMTS of 20mM), it is incubated in 50 DEG C of water-baths 20 minutes, concussion in every 5 minutes is primary.3) 10 times of volume pre-coolings are then added Sample is placed in -20 DEG C 20 minutes by acetone, and protein precipitation simultaneously removes the MMTS in Blocking solution.4) 4 DEG C of 5000g from Heart 10min.Abandon supernatant.5) 5ml cold acetone washing albumen precipitation is added, 4 DEG C of 5000g are centrifuged 10min.Abandon supernatant.Room temperature is dried in the air Dry acetone.6) HENS solution (HEN buffer 18ml is used；10%SDS 2ml) albumen is resuspended.Take appropriate protein lysate with etc. 2 × sample-loading buffer of volume mixes, and 95 DEG C of water-baths are boiled 3 times, every time 5 minutes.This part protein lysate is as input.It will remain Remaining albumen and 1/3 volume 4mM Biotin-HPDP are incubated at room temperature 3 hours.7) the Dynabeads magnetic bead of biotin labeling is washed: It takes appropriate magnetic bead to be put into 1.5ml EP pipe, EP pipe is placed on above Beads enrichment device, magnetic bead will be adsorbed on tube wall, abandon buffering Liquid is added HENS solution and washs 3 times.It is eventually adding appropriate HENS solution and suspension containing magnetic beads is made.8) then in protein lysate The washed suspension containing magnetic beads of 20 μ l are added to be incubated at room temperature 4 hours.After 9) being incubated for, wash magnetic bead 2 times with 1ml HENS solution, PBS is washed magnetic bead 2 times.1 × sample-loading buffer is added, sample is made, the electrophoresis in SDS-PAGE glue.WesternBlot detects sulphur Hydrogenate the β-actin albumen of modification.The protein expression level of CSE uses WesternBlot method, and renal tissue is split using RIPA It solves liquid and is homogenized cracking in the ratio (50mg/ml) of 1:20, centrifugation takes supernatant.Through BCA protein quantification, concentration is leveled, is added four points One of volume 5*loadingbuffer, make final concentration of 1*loadingbuffer.It is carried out with 50 μ g albumen/hole applied sample amount SDS-PAGE, albumen are transferred to NC film, and 5% skim milk closes 1h, respectively plus rabbit-anti people CSE monoclonal antibody (1:3000), Anti- Actin antibody (1:3000) primary antibody of mouse, 4 DEG C of overnight incubations wash film, and ELIAS secondary antibody incubation at room temperature 1h simultaneously washes film, last chemistry The ECL method that shines development.

In order to observe influence of the NW administration to renal function, inventor is complete certainly using clinical laboratory, Peking University's third affiliated hospital Automatic Biochemical Analyzer has detected renal function index creatinine, urea nitrogen in serum.Experimental result shows that creatinine, urea nitrogen are equal after I/R It is significant to increase several times, though being still higher than normal value after NW administration, (Fig. 3 B, C) is significantly reduced compared to I/R group, this shows NW Acute kidney injury caused by kidney I/R can be effectively relieved.

Take kidney through fixation, dehydration, transparent and paraffin embedding, slice, HE dyeing observation Renal pathology.Under the microscope The results show that I/R metanephric tubule lumen is obviously expanded, epithelial cell swelling, most of brush border compared with sham-operation group animal It falls off, the visible cast of part official jargon, interstitial visible hyperemia and inflammatory cell infiltration, I/R+NW group pathological change is substantially reduced, kidney Tubular epithelial cell Mild edema, part brush border fall off, and the hyperemia of interstitial is substantially reduced with inflammatory infiltration, but compared with Sham group Still there is difference (Fig. 4).

Nephridial tissue is embedded through OCT carries out frozen section, DHE dyeing observation rat kidney oxidative stress.Result under mirror It has been shown that, compared with Sham group, kidney oxidative stress enhances the fluorescence intensity of I/R group by force and after I/R, and after NW administration, oxidative stress has one Fixed reduction (Fig. 5).This shows that NW can reduce response to oxidative stress to a certain extent.

In order to observe influence of the NW to Apoptosis in ischemia-reperfusion injury of kidney, inventor selects cleaved Caspase-3 is Apoptosis index, passes through the apoptosis rate of Immunohistochemical study kidney.

Firstly, paraffin section de-waxing is protected from light 3%H to water₂O₂The activity that 10min eliminates endogenous peroxydase is handled, Deionized water 5min, PBS 5min.Antigen hot repair is multiple, prepares 500ml 10mM sodium citrate buffer (pH6.0), slice is put Enter to fill in the 1000ml beaker of 500ml citrate buffer, setting heating in water-bath is maintained at fluid temperature in container Between 92 DEG C~98 DEG C and continue 10 minutes.Beaker room temperature is dried in the air 15min, and cooling 10min in water can not will be sliced directly from buffering Cooling is taken out in liquid.1%BSA (12.8mg+1280 μ l PBS), 37 DEG C of closing 20min.Incline serum deprivation, does not wash.Primary antibody is added dropwise Cleaved caspase-3 (1:150, PBS dilution), 4 DEG C of overnight incubations.PBS 5min is cleaned three times.It is dilute that 1:200 ratio is added dropwise The secondary antibody for the horseradish peroxidase-labeled released, 37 DEG C of incubation 60min.DAB colour developing, haematoxylin redye core.

The results show that there are no apoptotic cell under Sham group mirror substantially, the visible apparent brown color dot of I/R group is Cleaved caspase-3 represents the cell that apoptosis occurs, and the apoptotic cell of I/R+NW group then substantially reduces, and illustrates that NW inhibits Apoptosis (Fig. 6) caused by I/R.

Because NW can enhance CSE activity, endogenous increases H₂Other H are compared in S content, effect₂S donor is more longlasting, therefore sends out Bright people observes NW to the long lasting protective effect after ischemical reperfusion injury, and inventor extends ischemia-reperfusion injury model again Infusion time, and long term administration after surgery.

I/R+NW group operation consent 2h gastric infusion NW (4.2mg/kg body weight), daily same dosage NW after operation Administration 2 weeks, Sham group inject the solvent (DMSO+ tri-distilled water) of corresponding volume with I/R group respectively at the corresponding time.After 2 weeks, anesthesia Blood, tissue sampling is taken to fix.Can observe by improving nephridial tissue H after NW is administered₂S concentration alleviates Ischemia-reperfusion Injury bring Damage.

After two weeks, the serum urea nitrogen of I/R group rat is significantly higher than sham-operation group, the serum of I/R+NW group to ischemia-reperfusion Urea nitrogen is then substantially reduced compared with I/R group, and statistically significant (Fig. 7 A), and NW is prompted to have certain improvement to renal function.I/R group is big The serum creatinine of mouse and sham-operation group indifference, are at a normal level, treatment group also indifference (Fig. 7 B).

Taken kidney forms wax stone after fixation, dehydration, paraffin embedding, then is sliced the disease that observation rat kidney is dyed through HE Reason variation.It observes under an optical microscope, rats in sham-operated group glomerulus is without obvious pathological change, renal tubule structural integrity.I/R The Renal pathology of group is obvious, and renal tubule official jargon is obviously expanded, the visible cast of part official jargon, renal cells brush border Flat, shrinkage falls off, and part endothelial cell is denaturalized in vacuole sample, graininess.The visible inflammatory cell infiltration of interstitial.I/R+NW group Lesion is substantially reduced compared with I/R group, and renal tubule structure is relatively complete, and interstitial inflammatory cells infiltration is reduced, but is still had with sham-operation group Difference (Fig. 8).

Then, inventor has chosen a collection of SD rat again, and NW is administered 4 weeks after ischemia-reperfusion, HE dyeing observation kidney trouble Reason variation.The Renal pathology of I/R group is obvious, and renal tubule official jargon is obviously expanded, and renal cells brush border falls off, disappears It loses, endothelial cell is in vacuole sample, and renal interstitial inflammatory cell infiltration is obvious.I/R+NW group pathological change mitigates, and renal interstitial inflammatory is thin Born of the same parents infiltrate substantially reduced (Fig. 9).

4 demethylbellidifolin FMDV VP1 gene of embodiment can effectively increase CSE activity, improve SHR Hypertension Rats

4.1NW reduces SHR rat blood pressure

H₂Hair of the S in spontaneous hypertensive rat (Spontaneously Hypertensive Rats, SHR) hypertension Raw development process plays an important role.Inventor chooses 8 weeks SHR rats, and SHR rat is divided into two groups of SHR groups and SHR+NW Group.The daily gastric infusion NW of SHR+NW group rat (4.2mg/kg body weight), the physiology salt of the daily stomach-filling equivalent of SHR group Water, successive administration 8 weeks, arteria caudalis monitored blood pressure twice a week.

Tail sleeve method non-invasive measurement rat blood pressure is surveyed using Softron intelligence non-invasive blood pressure measuring BP-98A Series Amount, selection and the sizeable mouse bag of rat, mouse net and heating bucket, mouse net is placed in heating bucket, and mouse bag packet is heating outside bucket, Rat is allowed to be pierced in mouse net automatically, mouse bag is fixed, and rat-tail leaks out.Rat preheating 5-10min in heating bucket sets the mind at rest, and makes Local vascular is sufficiently expanded, and pressurization inductor is then placed in rat root of the tail portion.Rat is stablized awake under rest state Start to measure rat blood pressure after several seconds, every rat measures 5-10 times, takes measurement result to stablize, measured waveform is 5-10 times correct As a result it averages as final result.Record rat systolic pressure (SBP), diastolic pressure (DBP), mean arterial pressure (MAP), heart rate (HR)。

From the point of view of tail sleeve method detects SHR rat blood pressure situation, SHR+NW group compares control group and starts appearance one after administration 2 weeks Fixed antihypertensive effect, there are about 10mmHg (Figure 10 A) for whole antihypertensive effect.Area is analyzed under statistic curve, SHR+NW group phase Also there is significant difference (Figure 10 B) compared with control group.

After 8 weeks, arteria carotis intubation monitoring blood pressure.Rat 10mg/ml yellow Jackets (5 μ l/g bodyweight) abdomen After chamber injecting anesthetic, fixed rat four limbs, neck cropping, throat center is made stringer skin incision (being about 1cm), blunt with haemostatic clamp Property separation fascia, spatium intermusculare, it is free go out left common carotid after ligature its distal end, proximal part artery clamp folder closes, and uses ophthalmology It cuts and makees a " V " shape notch on arterial wall, the conduit of test tube of hepari is inserted into left common carotid artery from incision, removes artery clamp, this When observation display on waveform be arterial blood pressure waveform.Ligature fixes, and prevents conduit from slipping.Continuous observation arterial blood About 30min is pressed, until waveform stabilization, obtains reliably arterial pressure numerical value.Before experiment, need using standard mercury column sphygmomanometer Instrument is calibrated, guarantees the accuracy of registration.Using same week old WKY rat as normotensive controls, SHR group is compared with WKY group Systolic pressure is significantly improved with diastolic pressure, and after NW gastric infusion, contraction is pressed with significant decline, reduces amplitude about 13mmHg, Though diastolic pressure slightly reduces, simultaneously no difference of science of statistics (Figure 11 A, B).

4.2NW increases the expression of blood vessel CSE, increases H₂S yield

Arteria carotis is intubated after measuring blood pressure, and arterial blood is extracted from intubation through tee tube.Rat is put to death, and coring is dirty, chest master Artery, femoral artery, the PBS washing being pre-chilled on ice, removal pipe week is fatty, freezes or fixes respectively.Take WKY group, SHR group and SHR+NW group aorta obtains lysate with 100mM kaliumphosphate buffer (pH 7.4) liquid nitrogen grinding lytic cell, uses methylene Blue laws detects heart and aorta H respectively₂S yield.As a result as shown in figure 12, SHR rat heart and aorta H₂S yield is more same Week old WKY rat is obviously relatively low, the treatment group H of NW gastric infusion₂S yield increases.The H of its medium vessels₂S yield restores to WKY group Similar level (Figure 12 A), the H of heart₂S level is still below WKY group, but also has statistical difference (Figure 12 B) compared to SHR group. The expression of CSE in aorta and heart is detected with WesternBlot.CSE expression is substantially reduced in SHR rat aorta, gives NW Afterwards, CSE is obviously increased (Figure 12 C), and the protein expression of CSE has no significant change (Figure 12 D) in heart.Inventor chooses femoral artery Paraffin section, pass through the distribution of CSE in immunohistochemical observation blood vessel.Inventor has found that CSE is obviously few in SHR rat femoral The content of CSE is improved to the level (Figure 12 E) close to WKY group after WKY rat femoral, NW administration.

4.3NW can partially inhibit inflammatory reaction, reduce the expression of VCAM-1

Inventor takes each group rat aorta, using liquid nitrogen grinding method, selects the Trizol reagent (goods of invitrogen Number: 15596018) it extracts mRNA and obtains cDNA with the Reverse Transcriptase kit of Thermo (K1622) reverse transcription, with Mx3000 reality When quantitative PCR apparatus detection the inflammatory factors such as VCAM-1, MCP-1, Adiponectin and TNF-α expression.

Primer sequence is as follows:

The results show that in SHR rat medium vessels intercellular adhesion molecule-1 (vascular cell adhesion Molecule-1, VCAM-1) expression apparent increase, the transcriptional level of VCAM-1 is decreased obviously after NW administration, has been approached same week old The transcriptional level (Figure 13 A) of WKY rat.Monocyte chemoattractant protein-1 (monocyte chemotactic protein 1, MCP-1) the transcriptional level raising in SHR rat has more than 10 times, and has statistical significance, has after NW gastric infusion certain Downward trend, only no statistical difference (Figure 13 B).Some researches show that expression drop of the adiponectin in SHR rat It is low, but find that the transcriptional level of adiponectin (adiponectin) in SHR rat aorta significantly increases in this experiment, this It may be a kind of compensatory mechanism, concrete reason is unknown, has no that adiponectin has significant change (Figure 13 C) after NW administration.TNF-α turns Record is horizontal not to be influenced (Figure 13 D) by hypertension and NW administration.The prompt of these results, NW is able to suppress inflammatory reaction, but only makees For the segmental inflammation factor.

4.4NW inhibits vascular remodeling

It is research object that inventor, which chooses femoral artery, and HE dyes (Figure 14 C) and counts tunicae media vasorum thickness, as a result, it has been found that SHR The media thickness of rat is noticeably greater than normotensive rat, and the increase of SHR rat media thickness can be effectively relieved after NW administration The ratio of (Figure 14 A), pipe thickness and official jargon internal diameter is significantly reduced (Figure 14 B) compared with SHR rat.This shows that NW can effectively press down The reconstruct of Hypertensive Rats resistance vessel processed.

5 demethylbellidifolin FMDV VP1 gene of embodiment mitigates atherosclerosis

Atherosclerosis (atherosclerosis, AS) is the most common disease in disease of cardiovascular system, and one kind is tired And the chronic inflammation disease of ductus arteriosus wall, seriously threaten human health.H₂S has the function of significant antagonism artery sclerosis, The generation of artery sclerosis can be effectively relieved, mitigate atherosclerotic plaque damage.Inventor uses 8 weeks wild type C57 mouse, Tail vein injection virus mPCSK9, high fat diet 3 months, constructs the Atherosclerosis Model of mouse.It is small during high fat diet Mouse is allocated as two groups, and 4.2mg/kg/day is administered in experimental group NW, is dissolved in 0.5% sodium carboxymethylcellulose, control group gives equivalent Sodium carboxymethylcellulose.After three months, plucks eyeball and take blood, put to death mouse, separating mouse aorta, including the arch of aorta, chest master Artery, abdominal aorta and left and right arteria iliaca communis part, removal pipe week is fatty, and blood vessel is splitted along vertical section, merging oil red O work 8min is dyed in liquid (sigma company, the U.S.), takes out blood vessel, deionized water cleaning.Blood vessel is laid on black cake wax, it is stereoscopic Mirror is taken pictures and Split picture.Inventor passes through aorta vertical section (en face) staining analysis plaque area, as a result, it has been found that, NW After administration, the plaque lesions area inside aorta significantly reduces (Figure 15 A).

Isolating cardiac and aortic root, OCT (Tissue-Teck) embedding, liquid nitrogen flash freezer make 8 μ in aorta proximal part The continuous frozen section of m, choosing has the part of aorta petal, carries out immunohistochemical staining, 1%BSA (12.8mg+1280 μ lPBS), 37 DEG C of closing 20min.Incline serum deprivation, does not wash.Primary antibody Mac-2 (1:200, PBS dilution), 4 DEG C of overnight incubations are added dropwise.PBS 5min Cleaning is three times.The secondary antibody of the horseradish peroxidase-labeled of 1:200 dilution proportion, 37 DEG C of incubation 60min are added dropwise.DAB colour developing, Soviet Union Lignin redyes core.Inventor dyes aortic root Mac-2, and discovery aortic root inflammatory infiltration also significantly mitigates (figure 15B)。

Conclusion: NW is the activator of CSE, can effectively enhance the activity of CSE, improves the diseases such as hypertension, ischemia-reperfusion H in model₂The expression of S reduces blood pressure, alleviates the effects of ischemia-reperfusion injury of kidney, and it is cardiovascular to be likely to become treatment Disease or CSE/H₂The newtype drug of the relevant disease of S system.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.

Sequence table

<110>Fu Wai Hospital, Chinese Academy of Medical Sciences

<120>it a kind of CSE zymoexciter and its is applied in disease medicament relevant to CSE/H2S system

<130> p18076

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 1

ccgctcgagc ggatgcagga aaaagacgcc 30

<210> 2

<211> 30

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 2

ccggaattcc ggctagctgt gacttccact 30

<210> 3

<211> 21

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 3

gggaagatgg tcgtgatcct t 21

<210> 4

<211> 21

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 4

tctggggtgg tctcgatttt a 21

<210> 5

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 5

tctcttcctc caccactatg 20

<210> 6

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 6

atgagtagca gcaggtgagt 20

<210> 7

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 7

cccctttatc gtctactcct 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 8

tgtgtttctg agcatcgtag 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 9

agtctggctc caagtgtatg 20

<210> 10

<211> 20

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 10

gctctgaatt agtggcagtc 20

Claims

1. demethylbellidifolin FMDV VP1 gene is in preparation prevention or treatment and CSE/H₂In the relevant disease medicament of S system Using.

2. application as described in claim 1, which is characterized in that described and CSE/H₂The relevant disease of S system includes the circulatory system Disease, respiratory disease, disease of digestive system, disease in the urological system, endocrine system disease, genital system diseases, sense organ Systemic disease or motor system disease.

3. application as claimed in claim 2, which is characterized in that the circulation system disease includes hypertension, Atherosclerosis Change, angiosteosis, coronary syndrome, myocardial infarction, myocardial hypertrophy, heart ischemia reperfusion, heart failure, aneurysm, blood loss Property shock, phlebothrombosis, cerebral infarction, cerebral hemorrhage；The respiratory disease includes Chronic Obstructive Pulmonary Disease, pulmonary artery height Pressure, acute lung injury, pulmonary interstitial fibrosis, chronic bronchitis, asthma, pulmonary heart disease；The disease of digestive system includes digestion Road ulcer, liver fibrosis, nonalcoholic fatty liver, cirrhosis, straight colon cancer；The disease in the urological system: Ischemia-reperfusion Injury, Acute renal injury, kidney fibrosis, chronic renal failure；The endocrine system disease: type-1 diabetes mellitus, type-2 diabetes mellitus；Institute State genital system diseases: impotence, premature ejaculation；Sensorium's disease: retinopathy；The motor system disease: fracture, class Rheumatic arthritis.

4. application of the demethylbellidifolin FMDV VP1 gene in the agonist for preparing CSE enzyme.

5. application as claimed in claim 4, which is characterized in that between the demethylbellidifolin FMDV VP1 gene and CSE enzyme There are interaction, key binding sites Leu91.

6. application as claimed in claim 5, which is characterized in that the methyl daisy leaf gentisin glycosides can increase CSE table It reaches, enhances the activity of CSE, increase endogenous H₂The generation of S.

7. being applied as described in claim any one of 4-6, which is characterized in that the agonist is in preparation prevention or treatment CSE/H₂S Application in the relevant disease medicament of system.

8. a kind of pharmaceutical composition, which is characterized in that described pharmaceutical composition contains natural small molecule compounds demethyl daisy Leaf gentisin glycosides and pharmaceutically acceptable carrier.

9. pharmaceutical composition as claimed in claim 8, which is characterized in that the effective dose of described pharmaceutical composition administration is every The demethylbellidifolin FMDV VP1 gene of its 4~80mg/kg weight.

10. if claim 8 or 9 described pharmaceutical compositions are in preparation prevention or treatment CSE/H₂In the relevant disease medicament of S system Application.