CN109673156A - For the plant promoter of transgene expression and 3 ' UTR - Google Patents

Abstract

This disclosure relates to the composition and method of the transcription and translation for promoting nucleotides sequence to be listed in plant or plant cell using the 3 ' UTR from -3 gene of rice ubiquitin.Some embodiments are related to the 3 ' UTR from -3 gene of rice ubiquitin, it plays the function of terminating the transcription for the nucleotide sequence being operably connected in plant.

Description

For the plant promoter of transgene expression and 3 ' UTR

Cross reference to related applications

This application claims the equity for the U.S. Provisional Patent Application Serial No. 62/350898 that on June 16th, 2016 submits

Technical field

Present invention relates generally to field of plant molecular biology, and more particularly, are related to the table of plant transgenic It reaches.

Background technique

Many plant species can be converted by transgenosis to introduce character or feature required on agronomy.Resulting plant Object species are developed and/or are modified to have specific required character.In general, required character includes for example improving nutriture value It is worth quality, increases yield, imparting pest or disease resistance, increase arid and stress tolerance, improve gardening quality (for example, color Plain calm and growth), conferring herbicide tolerance, make it possible to be generated by plant industrially applicable compound and/or material, And/or make it possible to generate drug.

Transgenic plant species comprising multiple transgenosis are generated via plant transformation techniques, and the multiple transgenosis is folded It piles up at individual gene group locus.Plant transformation techniques to recycle Plant Genome in transgenosis introduced plant cell In the transgene copies containing stable integration fertile genetically modified plants, and via the transcription and translation of Plant Genome after Continuous transgene expression generates the genetically modified plants with required character and phenotype.However, allow generate transgenic plant species with The mechanism of the engineered multiple transgenosis stacked for character of height expression is required.

Equally, the mechanism for allowing transgenosis to express in the specific organization of plant or organ is also required.For example, increasing Plant can be by with pathogen-resistance gene-transformed plant genome, so that cause of disease to the resistance of the pathogenic infection of soil-borne Body resistance protein is steadily and surely expressed in plant roots to realize.Or, it may be necessary to (all in particular growth or stage of development Such as, cell division or elongation) in plant tissue in express transgenic.Furthermore, it may be necessary in the leaf and stem tissue of plant Express transgenic is directed to the tolerance of herbicide, or the resistance for insect on ground and pest to provide.

Therefore, it is necessary to the new gene regulations of the expression of level needed for transgenosis can be driven to realize in specified plant tissue Element.

Summary of the invention

In the embodiment of the disclosure, this disclosure relates to a kind of nucleic acid carrier, it includes be operably coupled to poly Connector or short polynucleotide sequence, -3 gene of non-rice (Oryza sativa) ubiquitin or poly connector/short polynucleotide sequence With the 3 ' UTR, i.e. ZMEXP18544.1 of the combination of non-- 3 gene of rice ubiquitin.In terms of these of the embodiment, 3 ' UTR packets Containing the polynucleotide sequence with SEQ ID NO:1 at least 90% sequence identity.Other embodiments include comprising length Degree is 3 ' UTR of the polynucleotides of 1001bp.Further include with the 3 ' UTR of SEQ ID NO:1 share 80%, 85%, 90%, 92.5%, the polynucleotides of 95%, 97.5%, 99% or 99.9% sequence identity.Multiple embodiments include also comprising compiling The nucleic acid carrier of the sequence of code selected marker.The embodiment for also contemplating nucleic acid carrier the, wherein 3 ' UTR is operationally It is connected to transgenosis.The example of such transgenosis includes assigning insecticidal resistance, herbicide tolerant, nitrogen service efficiency, water The selected marker or gene product of service efficiency or nutritional quality.The embodiment for also contemplating nucleic acid carrier, wherein described 3 ' UTR are operably coupled to RNAi expression polynucleotides.

In other respects, this disclosure relates to which a kind of nucleic acid (or polynucleotides), it includes have at least with SEQ ID NO:2 80%, the promoter polynucleotides sequence of 85%, 90%, 92.5%, 95%, 97.5%, 99% and 99.9% sequence identity Column.Therefore, such promoter is integrated in the nucleic acid carrier of the 3 ' UTR comprising SEQ ID NO:1.In the embodiment Many aspects, promoter (such as SEQ ID NO:2) are operably coupled to 5 ' ends of poly connector or transgenosis, and 3 ' UTR is operably coupled to 3 ' ends of poly connector or transgenosis.It further include nucleic acid carrier in this embodiment, wherein starting Son also includes introne or 5'- UTR.Then, the nucleic acid of 3 ' UTR of promoter and SEQ ID NO:1 containing SEQ ID NO:2 Carrier driving carrys out express transgenic with composing type tissue specific expression.

In other respects, this disclosure relates to comprising there is operating at least 90% sequence identity with SEQ ID NO:1 Ground is connected to the plant of the polynucleotide sequence of transgenosis.Therefore, plant is unifacial leaf or dicotyledon.The specific reality of plant Example includes maize, wheat, rice, sorghum, oat, rye, banana, sugarcane, soybean, cotton, Arabidopsis (Arabidopsis), tobacco, sunflower and mustard.In various embodiments, such plant can be converted, wherein base will be turned Because being inserted into the genome of the plant.In a further embodiment, which includes and contains to have extremely with SEQ ID NO:2 The polynucleotide sequence of few 80%, 85%, 90%, 92.5%, 95%, 97.5%, 99% or 99.9% sequence identity opens Mover.In such embodiment, the length of SEQ ID NO:1 is 1001bp.In the one aspect of the embodiment, 3 ' UTR It is operably coupled to transgenosis.In other embodiments, which includes and contains to have at least with SEQ ID NO:1 80%, the 3 ' of the polynucleotide sequence of 85%, 90%, 92.5%, 95%, 97.5%, 99% or 99.9% sequence identity UTR.In such embodiment, the length of SEQ ID NO:1 is 1001bp.In the one aspect of the embodiment, SEQ ID The 3'UTR of NO:1 is operably coupled to transgenosis.In addition, multiple embodiments are related to the promoter comprising SEQ ID NO:2 Or the plant of -3 gene promoter of rice ubiquitin, wherein transgene expression is composing type.Equally, multiple embodiments are related to wrapping The plant of the 3 ' UTR of the NO:1 of ID containing SEQ, wherein transgene expression is composing type or tissue specific expression, such as by being used for Determined by the promoter for driving transgenosis.

In other respects, this disclosure relates to a kind of method for generating transgenic plant cells.Such method utilizes Expression casette converts plant cell, which includes to be operably coupled at least one multicore glycosides of interest 3 ' the UTR of -3 gene of rice ubiquitin of acid sequence.Next, the method discloses separation to include the transformed of the expression casette Plant cell.In addition, this method considers generation transgenic plant cells, which includes to be operably connected 3 ' the UTR of -3 gene of rice ubiquitin of the polynucleotide sequence of interest at least one.Equally, this method includes making the transgenosis Plant cell regenerates genetically modified plants.In addition, this method includes obtaining genetically modified plants, wherein the genetically modified plants include base Because of expression cassette, the expression casette is general comprising the rice for being operably coupled at least one polynucleotide sequence of interest 3 ' UTR of plain -3 gene.In such embodiments, the method for converting plant cell is carried out with plant transformation.In other realities It applies in scheme, the method for converting plant cell causes stable integration of interest more into the genome of transgenic plant cells Nucleotide sequence.In many aspects of such embodiment, 3 ' UTR of -3 gene of rice ubiquitin includes the multicore of SEQ ID NO:1 Thuja acid.

In other respects, this disclosure relates to which a kind of isolated polynucleotides, it includes the polynucleotides with SEQ ID NO:1 Nucleic acid sequence with the sequence identity of at least 80%, 85%, 90%, 92.5%, 95%, 97.5%, 99% or 99.9%. In one embodiment, isolated polynucleotides also include the open reading frame polynucleotides for encoding polypeptide；And promoter Sequence.In another embodiment, the length of the polynucleotides of SEQ ID NO:1 is 1001bp.

In the embodiment of the disclosure, this disclosure relates to which a kind of nucleic acid carrier, following it includes being operably coupled to Partial 3 ' UTR: poly joint sequence；Non- -3 sample gene of rice ubiquitin；Or poly joint sequence and non-- 3 gene of rice ubiquitin The combination of sample gene the, wherein 3 ' UTR includes the polynucleotides sequence for having at least 90% sequence identity with SEQ ID NO:1 Column.In some embodiments, the length of 3 ' UTR is 1001bp.In a further embodiment, 3 ' UTR by with SEQ ID There is NO:1 the polynucleotide sequence of at least 90% sequence identity to form.In other embodiments, 3 ' UTR terminate coding choosing The expression of the polynucleotides of selecting property label.In a further embodiment, 3 ' UTR are operably coupled to transgenosis.In the reality The aspect of scheme is applied, transgenes encoding assigns insecticidal resistance, herbicide tolerant, nitrogen service efficiency, water service efficiency or battalion Support the selected marker or gene product of quality.3 ' UTR for the SEQ ID NO:1 being used together with promoter are provided, this is opened Promoter polynucleotide sequence includes the sequence for having at least 90% sequence identity with SEQ ID NO:2, and wherein the promoter is more Nucleotide sequence is operably coupled to the poly connector or the transgenosis.In other embodiments, it provides and appoints 3 ' UTR for the SEQ ID NO:1 what known plant promoter sequences is used together, the promoter sequence include and SEQ ID NO:2 or the sequence with -3 gene promoter sequence of rice ubiquitin at least 90% sequence identity.In another embodiment In, the 3 ' UTR of SEQ ID NO:1 are used for composing type or tissue specific expression.

In yet another embodiment, the disclosure is provided comprising having at least 90% sequence identity with SEQ ID NO:1 The polynucleotide sequence for being operably coupled to transgenosis or joint sequence plant.According to the embodiment, plant choosing From: maize, wheat, rice, sorghum, oat, rye, banana, sugarcane, soybean, cotton, Arabidopsis (Arabidopsis), cigarette Grass, sunflower and mustard.Then, in some embodiments, comprising there is at least 90% sequence identity with SEQ ID NO:1 The plant of polynucleotide sequence can be corn plant.In other embodiments, it will be operably coupled to and SEQ ID There is NO:1 the transgenosis of at least polynucleotide sequence of 90% sequence identity to be inserted into Plant Genome.In some implementations In scheme, having the polynucleotide sequence of at least 90% sequence identity with SEQ ID NO:1 is 3 ' UTR and the 3 ' UTR It is operably coupled to transgenosis.In other embodiments, plant include with SEQ ID NO:2 promoter sequence or with SEQ ID NO:2 has the promoter sequence of at least 90% sequence identity, and wherein the promoter sequence is operably coupled to Transgenosis.In another embodiment, there is the polynucleotide sequence of at least 90% sequence identity to use with SEQ ID NO:1 In carrying out express transgenic with composing type or tissue specific expression.In another embodiment, have extremely with SEQ ID NO:1 The length of the polynucleotide sequence of few 90% sequence identity is 1001bp.

In one embodiment, present disclose provides a kind of method for generating transgenic plant cells, this method The following steps are included: with -3 gene of rice ubiquitin comprising being operably coupled at least one polynucleotide sequence of interest The expression casette of 3 ' UTR converts plant cell；Separation includes the transformed plant cell of the expression casette；And it generates Transgenosis comprising being operably coupled to the 3 ' UTR of -3 gene of rice ubiquitin of at least one polynucleotide sequence of interest is planted Object cell.In other embodiments, the step of carrying out conversion plant cell with methods for plant transformation.The methods for plant transformation can It is selected from: method for transformation that Agrobacterium (Agrobacterium) mediates, gene gun conversion method, silicon carbide method for transformation, primary Plastid transformation method and lipofection method.In other embodiments, polynucleotide sequence of interest is entirely turning base Because of constitutive expression in plant cell.In some embodiments, polynucleotide sequence stable integration of interest is to transgenosis In the genome of plant cell.It therefore, can be the following steps are included: making to turn base for generating the method for transgenic plant cells Because plant cell regenerates genetically modified plants；And genetically modified plants are obtained, wherein the genetically modified plants include expression casette, The expression casette includes the rice for being operably coupled to the SEQ ID NO:1 of at least one polynucleotide sequence of interest 3 ' UTR of -3 gene of ubiquitin.In one embodiment, transgenic plant cells are unifacial leaf transgenic plant cells or dicotyledonous Transgenic plant cells.For example, dicot transgenic plants cell can be selected from: Arabidopsis plant cell, tobacco plant cell, Soybean plant cell, mustard flowering plant cell and cotton plant cell.In addition, unifacial leaf transgenic plant cells are selected from: maize Plant cell, rice plant cell and wheat plant cell.It may include SEQ with 3 ' UTR of -3 gene of rice ubiquitin in the method The polynucleotides of ID NO:1.In various embodiments, 3 ' UTR of -3 gene of rice ubiquitin can also be comprising being operably connected To the first polynucleotide sequence of interest of the end 3' of SEQ ID NO:1.

In one embodiment, the disclosure provides a kind of for expressing polynucleotides sequence of interest in plant cell The method of column, this method include the polynucleotide sequence of interest that will be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin In introduced plant cell.In some embodiments, the of interest more of 3 ' UTR of -3 gene of rice ubiquitin are operably coupled to Nucleotide sequence passes through in plant transformation introduced plant cell.Therefore, which can be selected from: Agrobacterium mediates Method for transformation, gene gun conversion method, silicon carbide method for transformation, protoplast transformation method and lipofection method.? In embodiment, the polynucleotide sequence of interest constitutive expression in entire plant cell.In some embodiments, institute The polynucleotide sequence stable integration of concern is into the genome of plant cell.Therefore, transgenic plant cells are unifacial leaf plant Object cell or dicotyledonous plant cells.For example, dicotyledonous plant cells are selected from: Arabidopsis plant cell, tobacco plant cell, Soybean plant cell, mustard flowering plant cell and cotton plant cell.In addition, monocot plant cell is selected from: maize plant is thin Born of the same parents, rice plant cell and wheat plant cell.

In one embodiment, present disclose provides a kind of transgenic plant cells, and it includes -3 genes of rice ubiquitin 3'UTR.In some embodiments, transgenic plant cells include transgenic event.In the one aspect of the embodiment, turn Gene event includes Agronomic character.Therefore, Agronomic character is selected from: insecticidal resistance trait, herbicide tolerance trait, nitrogen Service efficiency character, water service efficiency character, Nutrient Quality Traits, DNA combination character, selected marker character, tiny RNA character Or any combination thereof.In other embodiments, Agronomic character includes herbicide tolerance trait.The one of the embodiment A aspect, herbicide tolerance trait include aad-1 coded sequence.In some embodiments, transgenic plant cells generate Commodity.The commodity are seleced protein concentrate, Protein Separation object, cereal, food, flour, oil or fiber.Implement at one In scheme, transgenic plant cells are selected from by dicotyledonous plant cells or monocot plant cell.Therefore, monocot plant cell For maize plant cell.In other embodiments, 3 ' UTR of -3 gene of rice ubiquitin includes the multicore with SEQ ID NO:1 Thuja acid has the polynucleotides of at least 90% sequence identity.In yet another embodiment, -3 gene of rice ubiquitin 3 ' UTR Length is 1001bp.In other embodiments, 3 ' UTR of -3 gene of rice ubiquitin is made of SEQ ID NO:1.In other implementations In scheme, 3 ' UTR of -3 gene of rice ubiquitin is used to express Agronomic character with composing type or tissue specific way.

The disclosure provides a kind of isolated polynucleotides, and it includes have at least with the polynucleotides of SEQ ID NO:1 The nucleic acid sequence of 90% sequence identity.In some embodiments, isolated polynucleotides driving composing type or organizing specific Property expression.In other embodiments, isolated polynucleotides have expression activity in plant cell.In multiple embodiments In, isolated polynucleotides include the open reading frame polynucleotides of coding polypeptide；And promoter sequence.Other embodiment party Case includes the isolated multicore comprising having at least nucleic acid sequence of 90% sequence identity with the polynucleotides of SEQ ID NO:1 Thuja acid, wherein the length of the polynucleotides of SEQ ID NO:1 is 1001bp.

With reference to the detailed description to several embodiments carried out below in conjunction with attached drawing, preceding feature and other features will become It obtains more obvious.

Detailed description of the invention

Fig. 1: the figure is the schematic diagram of plasmid pDAB116099, which includes that the rice (rice) of SEQ ID NO:2 starts Son (being labeled as " OsUbi3 promoter ") and the 3 ' UTR of -3 gene of rice ubiquitin of SEQ ID NO:1 (are labeled as "ZMEXP18544.1").These controlling elements are operably coupled to cry34Ab1 gene.It also include aad-1 base on this plasmid Because of expression cassette, which includes 1 promoter of maize ubiquitin (being labeled as " Zm Ubi1 promoter ") and maize lipase 3 '-UTR (are labeled as " Zm Lip33 ' UTR ").These controlling elements are operably coupled to aad-1 gene.

Fig. 2: this figure is the schematic diagram of plasmid pDAB113121, which includes that 1 promoter of maize ubiquitin (is labeled as " ZmUbi1 promoter ") and 3 '-UTR of potato (Solanum tuberosum) protease inhibitors-II gene (be labeled as "StPinII 3'UTR").It is glimmering that these controlling elements are operably coupled to the yellow from cup jellyfish (Phialidium) species Photoprotein (is labeled as " PhiYFP ").It also include aad-1 expression casette on this plasmid, which includes maize ubiquitin 1 promoter (being labeled as " Zm Ubi1 promoter ") and 3 '-UTR of maize lipase (being labeled as " 3 ' UTR of ZmLip3 ").These are adjusted Control element is operably coupled to aad-1 gene.

Specific embodiment

I. the general introduction of several embodiments

The exploitation of transgenic plant product just becomes to become increasingly complex.Viable commercial genetically modified plants need at present by Multiple transgenosis are stacked to individual gene seat.For basic research or the plant promoter and 3 ' UTR mono- of biotechnology applications As be it is unidirectional, be directed only to merge one in the 5 ' ends (upstream) of the end 3' (downstream) or its 3 ' UTR of its promoter Gene.Therefore, each transgenosis is required to promoter and 3 ' UTR usually with for expressing, wherein in one gene of expression stacks Multiple transgenosis need multiple controlling elements.With gene stack in the number of transgenosis increase, routinely using identical Promoter and/or 3 ' UTR to obtain the expression pattern of the optimum level of different transgenosis.Obtain the transgenosis table of optimum level Up to being necessary to generate single polygenic character.Regrettably, it is known that driven by identical promoter and/or 3 ' UTR Polygenes construct causes gene silencing, to generate the transgene product being less effective in the art.Duplicate promoter And/or 3 ' UTR element can cause the gene silencing based on homology.In addition, the repetitive sequence in transgenosis can cause gene to exist Homologous recombination in locus, causes polynucleotides to be reset.The silencing of transgenosis and rearrangement will likely be to generated transgenosis The performance of plant express transgenic has undesirable influence.In addition, transcription factor (TF) caused by being repeated due to promoter Binding site excessively can cause endogenous TF to exhaust, and cause transcriptional inactivation.In view of need by multiple genes into plant with It is stacked for metabolic engineering and character, needs multiple promoters and/or 3 ' UTR to generate turning for the multiple gene expressions of driving Gene crops.

Particular problem in promoter and/or 3 ' UTR identification is the specific cell type for needing to identify with plant, development Stage and/or the relevant tissue-specific promoter that do not expressed in other plant tissue of function.Tissue specificity is (that is, group Knit preferred) or the kernel of organ specific promoters driving such as plant, root, leaf or tapetum certain tissues in gene Expression.Tissue and stage of development specificity promoter and/or 3 ' UTR can initially the expression of gene identifies from, the gene Special time period expression in specific organization or during development of plants.These tissue-specific promoters and/or 3 ' UTR are It is certain using required in genetically modified plants industry, and since it allows heterologous gene to organize and/or the stage of development is selected Selecting property mode is specific expressed but desired, to show heterologous gene differentially in various organs, tissue and/or time Expression, but do not expressed in its hetero-organization.It can be by with disease to the resistance of the pathogenic infection of soil-borne for example, increasing plant Pathogen resistance gene-transformed plant genome, so that pathogen-resistance albumen is steadily and surely expressed in plant roots to realize.Alternatively, can It can need the express transgenic in the plant tissue in particular growth or in the stage of development (such as, cell division or elongation). Another application is that expectation uses the transgenosis of tissue-specific promoter and/or 3 ' UTR limitation coding Agronomic character such as It is expressed in the particular tissue type of developmental parenchyma cell.Therefore, promoter and/or 3 ' UTR identify in particular problem be How to identify promoter and how to be associated with the promoter identified to be used for specific tissue table with the developmental characteristic of cell It reaches.

Another problem identified about promoter is to need to clone all related cis actings and transactivated transcription control Element processed is transcribed with the DNA fragmentation that toilet is cloned with desired particular expression mode activated.In view of such control element is located at Translation starting or initiation site distal side are chosen as the size of the polynucleotides comprising promoter for providing promoter polynucleotides The expression and expression pattern of sequence are most important.It is known that promoter length includes functional information, and different bases There is promoter longer than the promoter of other genes in genome or shorter because verified.Illustrate the transcription initiation of promoter Functioning gene element in site and prediction promoter region is challenging.Further increase challenge be regulation motif with And complexity, diversity and the intrinsic degeneracy (Blanchette, Mathieu et al., " of cis and trans controlling element Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression.”Genome research 16.5(2006): 656-668).Cis and trans controlling element is located at the distal part of promoter, which adjusts the room and time of gene Only there is (Porto, Milena Silva et al., " Plant promoters:an in required site and specific time in expression approach of structure and function."Molecular biotechnology 56.1(2014):38- 49).Existing promoter Analysis tool can not reliably in sldh gene group sequence such cis-regulating element, so that prediction is too More false positives, because these tools generally concentrate merely on sequence content (Fickett JW, Hatzigeorgiou AG (1997) Eukaryotic promoter recognition.Genome research 7:861–878).Therefore, identify promoter tune It controls element and needs to obtain the appropriate sequence with particular size, which will lead to what driving in a desired manner was operably connected The expression of transgenosis.

The present invention provides through use -3 gene regulatory elements of rice ubiquitin that problems is overcome to turn to express in plant The method and composition of gene.

II. term and abbreviation

Present patent application in the whole text in, used many terms.In order to provide to present specification and claims (including Provide the range of such term) clear and consistent understanding, provide defined below.

As used herein, term " introne " refers to included in gene (or expression polynucleotide sequence of interest) It has transcribed but untranslated any nucleic acid sequence.Introne includes in the expressed sequence of DNA and the RNA molecule by its transcription Untranslated nucleic acid sequence in corresponding sequence.Construct as described herein contains enhancing translation and/or mRNA stability Sequence, such as introne.The example of one such introne is the histone of arabidopsis (Arabidopsis thaliana) The First Intron of the gene II of H3 variant or any other commonly known intron sequences.Introne can be with promoter sequence It is applied in combination to enhance translation and/or mRNA stability.

As used herein, term " separation " means to remove from its natural surroundings, or works as and be initially formed the compound When removed from other existing compounds.Term " separation " covers the material separated from natural origin and by place Recombinant expression in chief cell and the material (such as nucleic acid and protein) or chemically synthesized compound recycled after preparing (such as nucleic acid molecules, protein and peptide).

As used herein, term " purifying " is related to separating molecule or compound in the form of following: substantially free of natural Or pollutant usually associated with the molecule or compound in natural environment, or when being initially formed the compound, substantially Increase the concentration relative to compound existing for other, and means to increase since the other components with original composition separate Purity.Term " nucleic acid of purifying " is herein for describing and including but not limited to polypeptide, lipid and carbohydrate The separation of other biological compound, separation are generated or are isolated and purified, while realizing the nucleic acid sequence that the chemistry of component or function change (for example, nucleic acid can be by removing the protein pollutant in chromosome and being broken the chemical bond of connection nucleic acid and remaining DNA It is purified from chromosome).

As used herein, term " synthesis " refer to formed via chemical synthesis as in-vitro method polynucleotides (that is, DNA or RNA) molecule.For example, synthetic DNA can be during reaction in Eppendorf^TMIt is formed in pipe, so as to by n DNA or RNA Chain enzymatic generates synthetic DNA.Other laboratory method synthetic polyribonucleotides sequences can be used.Oligonucleotides can be closed in oligonucleotides Carry out chemical synthesis via synthesis in solid state using amidophosphate on Cheng Yi.Synthesized oligonucleotides, which can anneal with one another, to be connected as again Object is closed, to generate " synthesis " polynucleotides.Other methods for chemical synthesis polynucleotides are known in the art, and It can be easy to implement for the disclosure.

As used herein, term " about " means bigger than described value or value range or small by 10%, but be not intended to any value or Value range is appointed as only this broad definition.Each front have the value of term " about " or value range be also intended to cover the absolute value or It is worth the embodiment of range.

For the purpose of this disclosure, " gene " includes that encoding gene product (see below) region of DNA, and adjust gene All region of DNA of the generation of product, no matter whether such regulating and controlling sequence is adjacent to coded sequence and/or transcription sequence.Therefore, gene Including (but being not necessarily limited to) promoter sequence, terminator, translational control sequence (such as ribosome bind site and internal ribosomal Body entry site), enhancer, silencer, insulator, boundary element, replication orgin, matrix attachment site and locus control Area.

As used herein, term " natural " or " nature " define condition present in nature." natural DNA sequence " is certainly It is generated rather than is passed through genetically engineered (for example, using molecule by natural means or traditional breeding technology present in right boundary Biology/transformation technology) generate DNA sequence dna.

As used herein, " transgenosis " is defined as the nucleic acid sequence of encoding gene product (, including such as (but not limited to) mRNA.In one embodiment, transgenosis is Exogenous Nucleic Acid, and wherein the transgenic sequence has passed through genetically engineered draw Enter and does not usually find in the host cell of the transgenosis (or its filial generation).In an example, transgenes encoding is industrial or cures The compound of pharmaceutically useful, or to encode the gene (for example, herbicide resistance gene) of required agronomic traits.In yet another embodiment In, transgenosis is anti sense nucleotide sequence, wherein the expression of the expression inhibiting target nucleic acid sequence of the anti sense nucleotide sequence.At one In embodiment, transgenosis is endogenous nucleic acid, and wherein the other genome copies of the endogenous nucleic acid are required；Or it is opposite Target nucleic acid sequence in host organisms is in the nucleic acid of antisense orientation.

As used herein, term " non-- 3 transgenosis of rice ubiquitin " or " non-- 3 gene of rice ubiquitin " are and rice ubiquitin -3 Gene coded sequence (SEQ ID NO:5, Genbank NCBI accession number NP_001053957.1) has same less than 80% sequence Any transgenosis of one property.

" gene product " defined herein is the spawn generated by the gene.For example, gene product can be gene Direct transcription product (such as mRNA, tRNA, rRNA, antisense RNA, RNA interfering, ribozyme, structure RNA or any other type RNA) or pass through mRNA translation generate protein.Gene product also includes by such as capped, polyadenylation, methylation With the RNA of the method modification of editor and for example, by methylation, acetylation, phosphorylation, ubiquitination, ADP ribosylation, cardamom Acylated and glycosylation modified protein.Gene expression can be influenced by external signal, such as cell, tissue or organism are sudden and violent It is exposed to the medicament for increasing or decreasing gene expression.Gene expression can also be in appointing in the approach to protein again from DNA to RNA What position is regulated and controled.Controlling gene expression is for example (all to transcription, translation, rna transport and processing, middle element by controlling Such as mRNA) effect of degradation, or by activation, inactivation, compartmentation or the degradation after specific proteins molecule has generated, or These combination and occur.Gene expression can pass through any method known in the art, including but not limited to Northern trace Method, RT-PCR, western blot method, or external, original position or vivo protein activation measurement, in rna level or protein Horizontal measurement.

As used herein, term " gene expression " is related to making the coding of transcribed nucleic acid unit (including such as genomic DNA) Information is converted to the process of the operability of cell, non-operational or structure division, generally includes protein synthesis.Gene expression It may be influenced by external signal, such as cell, tissue or organism are exposed to the medicament for increasing or decreasing gene expression.Base Because expression can also be regulated and controled in any position from DNA to RNA again in the approach to protein.Controlling gene is expressed for example Effect by control to transcription, translation, rna transport and processing, middle element (such as mRNA) degradation, or by specificity Protein molecular generated after activation, inactivation, compartmentation or degradation or these combination and occur.Gene expression can pass through Any method known in the art, including but not limited to Northern blotting, RT-PCR, western blot method, Huo Zheti Outside, original position or vivo protein activation measurement are measured in rna level or protein level.

As used herein, " gene silencing based on homology " (HBGS) be include transcriptional gene silencing and posttranscriptional gene The generic term of both silencings.Target gene seat can correspond respectively to open by the silencing of non-chain cryptiogene seat due to generating The double-stranded RNA (dsRNA) of mover or transcription sequence and by Transcription inhibition (transcriptional gene silencing；TGS) or mRNA degradation is (after transcription Gene silencing；PTGS) cause.Participations of different cellular components shows that TGS that dsRNA is induced and PTGS may be by during each The diversification of ancient common mechanism causes.However, TGS's and PTGS has strictly been difficult to realize, because it is generally relied on In the analysis to different cryptiogene seats.In some cases, single transgene locus can correspond to different targets due to generating It marks the promoter of gene and the dsRNA of transcription sequence and triggers both TGS and PTGS.Mourrain et al. (2007) Planta 225:365-79.SiRNA may be for the actual molecules of the triggering TGS and PTGS on homologous sequence: siRNA will lead in this model Cross by the methylation of transgenic sequence extend in internal promoter and with the silencing of cis and trans triggering homologous sequence and Methylation.

As used herein, term " nucleic acid molecules " (or " nucleic acid " or " polynucleotides ") can refer to the polymerization shape of nucleotide Formula, it may include the synthesized form and mixing of both RNA, cDNA, the sense strand of genomic DNA and antisense strand and above-mentioned items Polymer.Nucleotide can refer to the modification of any one in ribonucleotide, deoxyribonucleotide or both types nucleotide Form." nucleic acid molecules " and " nucleic acid " and " polynucleotides " are synonyms as used herein.Unless otherwise specified, nucleic acid The length of molecule is generally at least 10 bases.The term can refer to RNA or DNA molecular with uncertain length.The term packet Include single-stranded and double-stranded form DNA.Nucleic acid molecules may include any in naturally occurring nucleotide and modified nucleotide Person or both of which, they are connected by naturally occurring nucleotide and/or the bonding of non-naturally occurring nucleotide is connected to Together.

As easily understood by the skilled person like that, nucleic acid molecules can be modified by sulphation or biochemical modification, or Person contains non-natural or derivatization nucleotide base.Such modification is set including such as marker, methylation, with analog One or more of naturally occurring nucleotide, internucleotide modification are changed (for example, not charged bonding: such as methyl-phosphonate, phosphorus Sour three esters, phosphoramidate, carbamate etc.；Charged linkage: such as thiophosphate, phosphorodithioate；Depending portion Point: such as peptides；Intercalator: such as acridine, psoralen；Chelating agent；Alkylating agent；And modified bonding: for example α is different Head nucleic acid etc.).Term " nucleic acid molecules " further includes any topological conformation, including it is single-stranded, double-strand, partial duplex, three Serobila, hairpin-shaped, circular and padlock shape (padlocked) conformation.

Transcription is advanced in a manner of 5 ' to 3 ' along DNA chain.This means that RNA is by pressing ribonucleotide -5'- triphosphoric acid Sequence is added to the 3 ' ends (while must eliminate pyrophosphoric acid) of growing chain to prepare.In linear or circular nucleic acid molecules, such as Fruit is dispersed in element (for example, specific nucleotide sequence) and combines in the direction 5' of another element or will combine identical nucleic acid, then It can be referred to as relative to another element " upstream " or " 5 ' ".Similarly, if being dispersed in element the 3 ' of another element Direction is or will can then be referred to as in conjunction with identical nucleic acid relative to another element " downstream " or " 3' ".

As used herein, base " position " refers to the position that base or nucleotide residue are given in specified nucleic acid.Specified core Acid can be defined by the comparison (see below) with reference nucleic acid.

Hybridization is related to two strands of polynucleotide chains and passes through Hydrogenbond.Oligonucleotides and the like passes through between complementary base Hydrogen bond hybridization, which includes Watson-Crick (Watson-Crick) hydrogen bond, Hu Sitan (Hoogsteen) hydrogen bond or anti- To Hu Sitan hydrogen bond.In general, nucleic acid molecules are made of nitrogenous base, which is that (cytimidine (C), urine are phonetic for pyrimidine Pyridine (U) and thymidine (T)) or purine (adenine (A) and guanine (G)).These nitrogenous bases are between pyrimidine and purine Hydrogen bond is formed, and the bond of pyrimidine and purine is known as " base pairing ".More particularly, A will be incited somebody to action with T or U Hydrogenbond, G With C Hydrogenbond." complementation " refers between two different nucleic acid sequences or between two of identical nucleic acid sequence not same district There are base pairings.

" can specific hybrid " and " specificity is complementary " be indicate complementarity be sufficient to make in oligonucleotides and DNA or The term stablized and specifically bound occurs between RNA target mark.Oligonucleotides is not necessarily to and its specifically hybridized target sequence 100% is complementary.When the normal function of oligonucleotides and target DNA or combination the disturb target DNA or RNA of RNA molecule, the widow Nucleotide is specifically hybridized, and under conditions of needing to specifically bind, such as the feelings of analysis or system in vivo Under condition, in physiological conditions, there are enough complementarities to tie to avoid the non-specific of the oligonucleotides and non-target sequence It closes.Such combination is known as specific hybrid.

Cause the hybridization conditions of specific stringency degree will be according to the property of the hybridizing method of selection and hybrid nucleic acid sequence Composition and length and change.In general, the temperature of hybridization and hybridization buffer ionic strength (especially Na+ and/or Mg2+ concentration) it will be helpful to the stringency hybridized, but washing times also influence stringency.About the specific stringency degree institute of acquisition The calculating of the hybridization conditions needed is in Sambrook et al. (eds.), Molecular Cloning:A Laboratory Manual, the 2 editions, the 1-3 volumes, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, the 9th and 11 has been discussed in chapter.

As used herein, " stringent condition " is covered hybridization and will only be existed between hybrid molecule and DNA target mark less than 50% The condition just occurred when mispairing." stringent condition " includes other specific Stringency levels.Therefore, as used herein, " medium tight Lattice " condition is the condition that will not hybridize of molecule that sequence mismatch is more than 50%；" high stringency " condition is that mispairing is more than 20% The condition that will not hybridize of sequence；And " high stringency " condition is the condition that will not hybridize of sequence that mispairing is more than 10%.

In a particular embodiment, stringent condition may include hybridizing at 65 DEG C, then with 0.1 × SSC/ at 65 DEG C 0.1%SDS is washed 40 minutes.

It is representative non-limiting hybridization conditions below:

High stringency: hybridize 16 hours at 65 DEG C in 5 × SSC buffer；In room temperature in 2 × SSC buffer Under wash twice, 15 minutes every time；And it is washed twice at 65 DEG C in 0.5 × SSC buffer, 20 minutes every time.

High stringency: hybridize 16-20 hours at 65-70 DEG C in 5 × -6 × SSC buffer；In 2 × SSC buffer In wash twice at room temperature, it is 5-20 minutes each；And washed twice at 55-70 DEG C in 1 × SSC buffer, every time 30 minutes.

Medium stringency: in room temperature to hybridizing 16-20 hours at 55 DEG C in 6 × SSC buffer；It is slow in 2 × -3 × SSC It is 20-30 minutes each in room temperature at least washing twice at 55 DEG C in fliud flushing.

In a particular embodiment, specifically hybridized nucleic acid molecules can keep knot under high Stringent hybridization conditions It closes.In these and other embodiments, specifically hybridized nucleic acid molecules can keep knot under high stringency hybridization conditions It closes.In these and other embodiments, specifically hybridized nucleic acid molecules can be kept under the conditions of Moderate stringency hybridization In conjunction with.

Oligonucleotides: oligonucleotides is short nucleic acid polymers.Oligonucleotides can by cut longer nucleic acid segment or It is formed and polymerizeing individual nucleotide precursor.The few nucleosides of the automatic synthesizer permission up to several hundred a bases of composition length Acid.Since oligonucleotides can be in conjunction with complementary nucleotide sequence, so can be used as detecting the probe of DNA or RNA.By small DNA The oligonucleotides (oligodeoxyribonucleotide) of sequence composition can use in PCR (a technique for for DNA amplification).? In PCR, oligonucleotides is commonly known as " primer ", allows archaeal dna polymerase to extend oligonucleotides and replicates complementary strand.

As used herein, term " sequence identity " or " identity " are herein in two nucleic acid or the ring of polypeptide sequence Can refer to the residue in two sequences when using under border is identical when comparing maximum correspondence in specified comparison window.

As used herein, term " Percentage of sequence identity " can refer to by comparing two best ratios in comparison window To the value that sequence (for example, nucleic acid sequence and amino acid sequence) determines, wherein the optimal comparison in order to realize the two sequences, is somebody's turn to do Sequence in comparison window may include addition or lack (that is, empty compared to reference sequences (it is without addition or missing) Position).By determining that the number for the position for occurring identical nucleotide or amino acid residue in the two sequences generates match bit Number is set, with the matching position number divided by the sum of position in comparison window, result is generated to the hundred of sequence identity multiplied by 100 Divide ratio, to calculate the percentage.

Sequence alignment method for comparing is well known in the art.Various programs and alignment algorithm are described in for example following In document: Smith and Waterman (1981) Adv.Appl.Math.2:482；Needleman and Wunsch (1970) J.Mol.Biol.48:443；Pearson and Lipman (1988) Proc.Natl.Acad.Sci.U.S.A.85:2444； Higgins and Sharp (1988) Gene 73:237-44；Higgins and Sharp (1989) CABIOS 5:151-3；Corpet Et al. (1988) Nucleic Acids Res.16:10881-90；Huang et al. (1992) Comp.Appl.Biosci.8: 155-65；Pearson et al. (1994) Methods Mol.Biol.24:307-31；Tatiana et al. (1999) FEMS Microbiol.Lett.174:247-50.The detailed consideration items that sequence alignment method and homology calculate are found in for example Altschul et al., (1990) J.Mol.Biol.215:403-10.

Basic Local Alignment Search Tool (the BLAST of National Center for Biotechnology Information (NCBI)^TM；Altschul etc. People (1990)) it can be obtained from several sources (including National Center for Biotechnology Information (Bethesda, MD)) and can be It is obtained on internet, to combine several sequence analysis programs to use.How the description of sequence identity is determined using the program It can BLAST on the internet^TM" help " part obtain.In order to compare nucleic acid sequence, default parameters execution can be used BLAST^TM(Blastn) " 2 sequence of Blast " function of program.When being assessed by the method, have even more with reference sequences The nucleic acid sequence of big similitude will show that homogeneity percentage increases.

As used herein, term " being operably connected " is related to closing when the first nucleic acid sequence and second nucleotide sequence at function When being, the first nucleic acid sequence is operably connected with second nucleotide sequence.For example, when promoter influence coded sequence transcription or When expression, promoter is operably connected with coded sequence.When being generated with recombination form, the nucleic acid sequence that is operably connected Usually adjacent, and two protein coding regions can be connected in the same reading frame if necessary.However, nucleic acid without It need to abut to be operably connected.

As used herein, term " promoter ", which refers to, is normally at upstream region of gene (towards the area 5' of gene) and to originate With region of DNA needed for driving genetic transcription.The appropriate activation or inhibition of gene that promoter can be such that it controls.Promoter can containing by The specific sequence of transcription factor identification.These factors cause RNA polymerase (by gene in combination with to promoter DNA sequence Code area synthesis RNA enzyme) recruitment.Promoter typically refers to all gene regulatory elements positioned at upstream region of gene, including upper Swim promoter, 5'-UTR, introne and leader sequence.

As used herein, term " upstream promoter " refers to the adjoining polynucleotide sequence for being enough to guide transcription initiation.Such as Used herein, upstream promoter covers transcription initiation site and multiple sequence motifs, including TATA box, homing sequence, TFIIB know Other element and other promoter motifs (Jennifer, E.F. et al., (2002) Genes&Dev., 16:2583-2592).Upstream Promoter provides basic or general transcription factor the action site of rna plymerase ii with such as TFIIA, B, D, E, F and H, and RNA is poly- Synthase II is multi-subunit enzyme.These factors are assembled into transcription preinitiation complex, which synthesizes RNA by DNA profiling.

The activation of upstream promoter is carried out by the adjusting DNA sequence element of other sequence, the adjusting DNA sequence element It is combined and then interacted with transcription initiation complex with active gene expression by various protein.These gene regulations member Part sequence and specific DNA binding factor interact.These sequence motifs can be described as cis element sometimes.Tissue specificity or Such cis element that development-specific transcription factor combines either individually or in combination can make decision promoter in transcriptional level Spatial and temporal expression profile.These cis elements change extensively in terms of the Control Cooling that it is applied to the gene being operably connected. Some elements are for increasing turning for the gene being operably connected in response to environment reaction (for example, temperature, humidity and injury) Record.Other cis elements can be to development clue (for example, germinateing, seed is mature and blooms) or to spatial information (for example, tissue Specificity) it makes a response.See, for example, Langridge et al., (1989) Proc.Natl.Acad.Sci.USA 86:3219- 23.These cis elements are located at the different distance away from transcripting start point, and some cis elements (referred to as proximal element) are neighbouring most Small core promoter region, and other elements can be located at thousands of a bases in promoter (enhancer) upstream or downstream.

As used herein, term " 5' non-translational region " or " 5'-UTR " are defined as the end 5' of premessenger RNA or maturation mRNA Untranslated section.For example, 5'-UTR usually contains 7- methylguanosine cap in its end 5' and participates in many on mature mRNA Process, such as montage, polyadenylation, mRNA export the end 5' and the protection for identifying mRNA to cytoplasm, by machine translator MRNA is from degradation.

As used herein, term " transcription terminator " is defined as the transcription section of the end 3' of premessenger RNA or maturation mRNA. For example, the relatively length dna extension except " polyadenylation signal " site is transcribed into premessenger RNA.This DNA sequence dna usually contains transcription Premessenger RNA to be suitably processed as mature mRNA by termination signal.

As used herein, term " 3 ' non-translational region " or " 3'-UTR " are defined as the end 3' of premessenger RNA or maturation mRNA Untranslated section.For example, on mature mRNA, this area contain the poly- tail portion (A) and it is known mRNA stability, translation initiation and There are many effects in mRNA output.In addition, 3'-UTR is considered as including polyadenylation signal and transcription terminator.

As used herein, nucleic acid sequence present in term " polyadenylation signal " instruction mRNA transcript, works as presence When poly- (A) polymerase, allow transcript in the site of polyadenylation for example at the base of poly- 10 to 30, downstream of (A) signal Upper polyadenylation.Many polyadenylation signals are known in the art and are suitable for the present invention.Exemplary sequence includes AAUAAA and its variant, such as Loke J. et al., (2005) Plant Physiology 138 (3)；Described in 1457-1468.

" DNA combination transgenosis " is the protein-bonded polynucleotide encoding sequence of coding DNA.The subsequent energy of DNA binding protein Enough it is bound to another molecule.Binding protein is combinable to such as DNA molecular (DNA binding protein), RNA molecule (RNA combination egg It is white) and/or protein molecule (protein-binding proteins).For protein-binding proteins, in combination with to its own (with shape At homodimer, homotrimer etc.) and/or its combinable one or more to one or more different protein Molecule.Binding protein can have more than a type of combination activity.For example, zinc finger protein have DNA combine, RNA combine and Protein binding activity.

The example of DNA binding protein includes；It can " engineered " be a wide range of core for being bound to predetermined nucleotide sequence Sour enzyme, zinc finger, CRISPR and TALE binding domain.In general, engineered DNA binding protein (for example, zinc finger, CRISPR or It TALE) is non-naturally occurring protein.The non-limiting example of method for engineered DNA binding protein be design and Selection.Designed DNA binding protein is the protein being not present in nature, and design/composition is generally by rule of reason It generates.The rule of reason of design include replace rule and computerized Algorithm application, with handle existing ZFP, CRISPR and/or Information in the database storage information of TALE design and combined data.See, for example, United States Patent (USP) 6,140,081,6,453, 242 and 6,534,261；Also reference can be made to WO 98/53058；WO 98/53059；WO 98/53060；WO 02/016536 and WO 03/016496 and U.S. Patent Publication No. 20110301073,20110239315 and 20119145940.

" zinc-finger DNA Binding Protein " (or binding domain) is to be combined by one or more zinc fingers with sequence-specific fashion The protein of DNA or compared with the region in larger protein, which is the amino acid sequence area in binding domain, the structure of the binding domain Stablized by the coordination of zinc ion.Term zinc-finger DNA Binding Protein is commonly abbreviated as zinc finger protein or ZFP.Zinc finger binding domain can " engineered " is to be bound to predetermined nucleotide sequence.The non-limiting example of method for engineered zinc finger protein is Design and selection.Designed zinc finger protein is the protein being not present in nature, and design/composition is generally by rationally quasi- Then generate.The rule of reason of design includes replacing the application of rule and computerized Algorithm, to handle existing ZFP design and combine Information in the database storage information of data.See, for example, U.S. Patent number 6,140,081,6,453,242,6,534,261 With 6,794,136；Also reference can be made to WO 98/53058, WO 98/53059, WO 98/53060, WO 02/016536 and WO 03/ 016496。

In other instances, the DNA binding domain of one or more nucleases includes naturally occurring or engineered (non- It is naturally occurring) TAL effector DNA binding domain.See, for example, U.S. Patent Publication No. 20110301073, full text is to quote Mode is incorporated herein.The plant pathogenetic bacteria of known xanthomonas (Xanthomonas) causes many diseases in important crops Disease.The pathogenicity of xanthomonas depends on conservative type III and secretes (T3S) system, and the system is by more different effect eggs In white injection plant cell.In the protein that these are injected, simulating plant turns transcriptional activators sample (TALEN) effector It records activation factor and manipulates plant transcription object group (referring to Kay et al., (2007) Science318:648-651).These albumen Matter contains DNA binding domain and transcriptional activation domain.A kind of TAL effector most sufficiently characterized is from xanthomonas campestris capsicum Spot disease pvs oryzae and oryzicola (Xanthomonas campestgrispv.Vesicatoria) AvrBs3 (referring to Bonas et al., (1989) Mol Gen Genet218:127-136 and WO2010079430).TAL effector contains the concentration of tandem repetitive sequence Domain, each repetitive sequence contain about 34 amino acid, they are the key that the DNA binding specificities of these protein.In addition, They contain nuclear localization sequence and acid transcriptional activation domain (is commented referring to Schornack S et al., (2006) J Plant Physiol163(3):256-272).In addition, in plant-pathogenic bacterium Ralstonia solanacearum (Ralstonia Solanacearum in), it has been found that in 4 bacterial strain RS1000 of Ralstonia solanacearum biovariety bacterial strain GMI1000 and biovariety The AvrBs3 family of the two kinds of genes and xanthomonas that are named as brg11 and hpx17 is homologous (referring to Heuer et al., (2007) Appl and Enviro Micro73(13):4379-4384).The nucleotide sequence of these genes have each other 98.9% it is same One property, but the difference is that 1,575bp is lacked in the repetitive sequence domain of hpx17.However, two kinds of gene products and Xanthomonas campestris Belonging to AvrBs3 family protein has less than 40% sequence identity.See, for example, U.S. Patent Publication No. 20110301073, It is incorporated by reference and is incorporated to.

The specificity of these TAL effectors depends on sequence found in tandem repetitive sequence.Repetitive sequence includes big About 102bp and repetitive sequence usually each other 91-100% homologous (Bonas et al., ibid).The polymorphism of repetitive sequence is usual The mark of Gao Bianshuan residue at position 12 and 13, and at position 12 and 13 and the target sequence of TAL effector Seem that there are one-to-one correspondences (referring to Moscou and Bogdanove, (2009) Science between continuous nucleotide mark 326:1501 and Boch et al., (2009) Science326:1509-1512).These TAL are used for by experiment method measurement The natural coding of the DNA identification of effector, so that the HD sequence at position 12 and 13 is bound to cytimidine (C), NG is bound to T, NI is bound to A, C, G or T, and NN is bound to A or G, and ING is bound to T.These DNA combination repetitive sequences with new combination It is assembled into protein with the repetitive sequence of quantity, with manufacture of intraocular transcription factor, which can be with new sequence phase Interaction and activate expression (Boch et al., ibid) of the non-endogeneous reporter gene in plant cell.Engineered TAL albumen has been connected to FokI and cuts half domain, is shown in yeast reporter gene assays (target based on plasmid) with generating Active TAL effect subdomain histone-nuclease fusion object (TALEN).

CRISPR (the short palindrome repetitive sequence in the interval of regular cluster)/Cas (CRISPR is related) nucleic acid enzyme system is nearest Engineered nucleic acid enzyme system, based on the bacterial system that can be used for genome project transformation.It is based on many bacteriums and A part of the adaptive immune response of archaeal.When virus or plasmid intrusion bacterium, the section of effractor DNA passes through " immune " Response is converted to CRISPR RNA (crRNA).Then this crRNA passes through another type in partial complementarity area and referred to as tracrRNA The RNA of type is associated with, and Cas9 nuclease is guided to the area that is known as " prototype introns " homologous with the crRNA in target DNA. Cutting DNA at the specified site of the boot sequence for 20 nucleotide that Cas9 contains in crRNA transcript, in double-strand break (DSB) blunt end is generated at.Cas9 needs both crRNA and tracrRNA, identifies and cuts for locus specificity DNA.This is Unite it is engineered be so that crRNA and tracrRNA can be combined to a molecule (" individually guiding RNA "), and it is single Guiding the crRNA equal parts of RNA engineered can target any required sequence (referring to Jinek for guidance Cas9 nuclease Et al., (2012) Science 337, the 816-821 pages, Jinek et al., (2013), eLife 2:e00471 and David Segal, (2013) eLife 2:e00563).Therefore, needed for CRISPR/Cas system can engineered be in genome DSB is formed at target, and the reparation of DSB can be influenced by the use of repair inhibitors, so that Error-free repair increases.

In other instances, DNA combination transgenosis includes engineered (non-naturally occurring) a wide range of nucleic acid The site specific nucleic acid enzyme of enzyme (also referred to as homing endonuclease).Such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII Homing endonuclease or the identification sequence of meganuclease be known.Referring also to U.S. Patent number 5,420,032； U.S. Patent number 6,833,252；Belfort et al., (1997) Nucleic Acids Res.25:3379-30 3388；Dujon Et al., (1989) Gene 82:115-118；Perler et al., (1994) Nucleic Acids Res.22,11127；Jasin (1996)Trends Genet.12:224–228；Gimble et al., (1996) J.Mol.Biol.263:163-180；Argast Et al., (1998) J.Mol.Biol.280:345-353 and New England Biolabs catalogue.In addition, nucleic acid of going back to the nest The DNA binding specificity of restriction endonuclease and meganuclease can be engineered in conjunction with non-natural target site.See, for example, Chevalier et al., (2002) Molec.Cell 10:895-905；Epinat et al., (2003) Nucleic Acids Res.531:2952-2962；Ashworth et al., (2006) Nature 441:656-659；Paques et al., (2007) Current Gene Therapy7:49-66；U.S. Patent Publication No. 20070117128.Homing endonuclease and a wide range of The DNA binding domain of nuclease can change (that is, nuclease is made to include homologous cutting domain) under the background of nuclease as a whole Or heterologous cutting domain can be fused to.

As used herein, term " conversion " covers all technologies that can be imported nucleic acid molecules in this cell.Example packet It includes but is not limited to: being transfected with viral vectors；It is converted with plasmid vector；Electroporation；Liposome transfection；Microinjection (Mueller etc. People, (1978) Cell 15:579-85)；The transfer that Agrobacterium mediates；Direct DNA intake；WHISKERS^TMThe conversion of mediation； And microparticle bombardment.These technologies can be used for both stable conversion and instantaneous conversion of plant cell." stable conversion " refers to core Acid fragment is introduced into the gene generated in host organisms genome and stablizes heredity.Once stable conversion, nucleic acid fragment is stablized whole It closes into host organisms and the genome of any filial generation.Host organisms containing inverted nucleic acid fragment are known as " transgenosis " Organism." instantaneous conversion " refers to that nucleic acid fragment is introduced into the nucleus of host organisms or the organelle containing DNA, in no gene The gene expression generated in the case where stablizing heredity.

Exogenous nucleic acid sequence.In an example, transgenosis is gene order (for example, herbicide resistance gene), compiles The gene of the compound of code industry or pharmaceutically useful or the gene for encoding required agronomic traits.In another example, turn base Because being anti sense nucleotide sequence, the wherein expression of the expression inhibiting target nucleic acid sequence of the anti sense nucleotide sequence.Transgenosis can contain It is operably coupled to the regulating and controlling sequence (for example, promoter) of transgenosis.In some embodiments, polynucleotides of interest Sequence is transgenosis.However, in other embodiments, polynucleotide sequence of interest is endogenous nucleic acid sequence, wherein The other genome copies of the endogenous nucleic acid sequence are required, or the sequence of the target nucleic acids molecule relative to host organisms Column are in the nucleic acid sequence of antisense orientation.

As used herein, term transgenosis " event " is generated by following steps: (including of interest with heterologous DNA Transgenosis nucleic acid construct) conversion plant cell, be inserted into the regeneration that Plant Genome causes plant population from transgenosis, And the specified plant that selection is characterized and being inserted into specific gene group position.Term " event " refers to including heterologous DNA Original transformation and transformant filial generation.Term " event " also refers to through transformant and includes genome/transgenosis DNA The filial generation that sexual cutcross between another kind generates.Even if coming inverting after with backcross parent repeated backcross The insertion transgenosis DNA of parent and flank the identical dye that genomic DNA (genome/transgenosis DNA) is still in hybrid generation Colour solid position.Term " event " also refer to from original transformation and its filial generation DNA comprising insertion DNA and close to insertion DNA Flank genome sequence, it is contemplated that the DNA is transferred to filial generation, the filial generation receive include transgenosis of interest insertion DNA, packet Include transgenosis of interest be one include insertion DNA (for example, original transformation and selfing generate filial generation) parental department and The result of the sexual hybridization of parental department without insertion DNA.

As used herein, term " polymerase chain reaction " or " PCR " define amplification trace dna, RNA and/or DNA Program or technology, the U.S. Patent number 4 such as authorized on July 28th, 1987, described in 683,195.In general, regions of interest is come from Domain end or in addition sequence information needs be available, in order to design Oligonucleolide primers；The sequence of these primers will be with The opposite strand of template to be amplified is consistent or similar.The 5' terminal nucleotide of two primers can be consistent with the amplification end of substance. PCR can be used for specific amplification RNA sequence, the specific DNA sequences from total genomic dna and from total cell rna transcription CDNA, bacteriophage or plasmid sequence etc..Usually referring to Mullis et al., Cold Spring Harbor Symp.Quant.Biol.,51:263(1987)；Erlich is compiled, PCR Technology, (Stockton Press, NY, 1989)。

As used herein, term " primer " refers to when condition is suitable for synthetic primer extension products, potentially acts as along mutual Mend the oligonucleotides of the starting point of chain synthesis.Synthesis condition includes there are four kinds of different deoxyribonucleotide triphosphoric acids and extremely A kind of few polymerisation induced agent, such as reverse transcriptase or archaeal dna polymerase.They are present in suitable buffer, which can It include the ingredient at various suitable temperature as the conditions such as co-factor or influence pH.Primer is preferably single-stranded sequence Column, so that amplification efficiency is optimised, but can also be used double-stranded sequence.

As used herein, term " probe " refers to the oligonucleotides hybridized with target sequence.?OrA part of target hybridization in type analysis program, between probe and the annealing site for being positioned at two primers.Probe Including about eight nucleotide, about ten nucleotide, about 15 nucleotide, about 20 nucleotide, about 30 nucleotide, about 40 nucleotide or about 50 nucleotide.In some embodiments, probe includes about eight nucleotide to about 15 Nucleotide.Probe may also include detectable label, such as fluorogen (Texas-Fluorescein isothiocynate etc.).It is detectable Label can directly be covalently attached to probe oligonucleotides, such as positioned at the end 5' of probe or the end 3' of probe.Including fluorescence The probe of group can also also comprise quencher, such as Black Hole Quencher^TM、Iowa Black^TMDeng.

As used herein, term " restriction endonuclease " and " restriction enzyme " refer to bacterial enzyme, each in them Person's cutting double-stranded DNA at or near specific nucleotide sequences.2 type restriction enzymes same loci identify and cutting DNA, and And including but not limited to XbaI, BamHI, HindIII, EcoRI, XhoI, SalI, KpnI, AvaI, PstI and SmaI.

As used herein, term " carrier " is used interchangeably with term " construct ", " cloning vector " and " expression vector ", And mean that DNA or RNA sequence (for example, allogenic gene) host cell can be introduced to convert host and to promote introduced Sequence expression (for example, transcription and translation) carrier." non-virus carrier " is intended to mean without viral or retrovirus Any carrier.In some embodiments, " carrier " is comprising at least one DNA replication dna starting point and at least one selected marker The DNA sequence dna of gene.Example includes but is not limited to plasmid, clay, bacteriophage, bacterial artificial chromosome (BAC) or will be exogenous DNA is carried to the virus in cell.Carrier may also comprise one or more genes, antisense molecule and/or selected marker And other genetic elements known in the art.Carrier can transduce, convert or infection cell, express nucleic acid so as to cause cell Molecule and/or protein by the vector encoded.Term " plasmid " is defined in protokaryon or eukaryotic host cell and can often dye The annular nucleic acid chains of body duplication.The term includes that can be DNA or RNA and can be single-stranded or double-stranded nucleic acid.With this definition Plasmid may also comprise the sequence corresponding to bacterial origin of replication.

As used herein, the term as used herein " selected marker " defines gene or other expression cassettes, coding Facilitate the protein of the cell of identification insertion selected marker.For example, " selected marker " covers reporter gene And for Plant Transformation so as to for example protect plant cell from the influence of selective pesticides or provide to selective pesticides Resistance/tolerance gene.In one embodiment, only receive those of functionally selective label cell or plant ability It is enough to divide or grow under conditions of with selective pesticides.The example of selective pesticides may include such as antibiotic, including big Miromycin (spectinomycin), neomycin (neomycin), kanamycins (kanamycin), paromomycin (paromomycin), gentamicin (gentamicin) and hygromycin (hygromycin).These selected markers include new mould Plain phosphotransferase (npt II), expression assign the enzyme to antibiotic kalamycin resistance；With associated antibiotic neomycin, bar The gene of lung doxorubicin, gentamicin and G418；Or the gene of hygromix phosphotransferase (hpt), expression are assigned to hygromycin The enzyme of resistance.Other selected markers may include the gene of Herbicid resistant of the coding including bar or pat (for careless ammonium The resistance of phosphine (glufosinate ammonium) or glufosinate (phosphinothricin))；The gene of acetolactate synthase (ALS, for such as sulfonylureas (SU), imidazolone (IMI), triazolo pyrimidine (TP), pyrimidine radicals p-methoxybenzoic acid ester (POB) And the resistance of the inhibitor of sulfonyl amido carbonyl triazole quinoline ketone (prevent branched-chain amino acid from synthesizing the first step)), coding grass it is sweet The gene of phosphine (glyphosate), 2,4-D and metal resistance or sensibility.It can be used as " reporter gene " of selected marker Example include reporter gene protein expressed by visual observations, such as encoding p-glucuronidase (GUS), luciferase, green Color fluorescin (GFP), yellow fluorescence protein (YFP), DsRed, beta galactosidase, chloramphenicol acetyltransferase (CAT), alkali The protein of acid phosphatase etc..Phrase " label is positive " refers to that plant has been converted into including selected marker.

As used herein, term " detectable label " refers to label that can be detected, such as radioactive isotope, Fluoresceinated Close object, bioluminescent compound, chemiluminescence compound, metal-chelator or enzyme.The example of detectable label includes but unlimited In: fluorescent marker (such as FITC, rhodamine (rhodamine), group of the lanthanides phosphor), enzyme label (such as horseradish peroxidase, β- Galactosidase, luciferase, alkaline phosphatase), chemiluminescent labeling, biotinyl, identified by second level reporter gene it is pre- First determining polypeptide epitope (such as binding site, metal binding domain, epitope tag of leucine zipper pair sequences, secondary antibody).? In one embodiment, detectable label can be connected by the spacerarm of various length to reduce potential steric hindrance.

As used herein, refer to can be in specific restriction site or logical for term " box ", " expression cassette " and " expression casette " Cross the DNA section in homologous recombination insertion nucleic acid or polynucleotides.As used herein, which includes that coding is of interest The polynucleotides of polypeptide, and box and restriction site are designed to ensure that and box are inserted into reading frame appropriate to transcribe and to turn over It translates.In one embodiment, expression cassette may include the polynucleotides of coding polypeptide of interest, and facilitate spy with removing Determine the element other than the polynucleotides of transformation of host cells.In one embodiment, expression casette, which may also comprise, allows to compile The element of polynucleotides Enhanced expressing in host cell of code polypeptide of interest.These elements may include but be not limited to: open Mover, minimal promoter, enhancer, response element, terminator sequence, polyadenylation sequence etc..

As used herein, " connector " or " introns " is key, molecule or the molecular group for so that two separation entities is bonded to each other. Connector and introns can provide best spacing to two entities, or the labile bond for allowing two entities to be separated from each other can also be provided It closes.Unstable bonding includes can photodestruciton group, acid labile moiety, alkali labile moiety and can enzyme cleavable group.Such as this paper institute Three be located in 10 nucleotide in nucleic acid sequence each other or more are defined with, term " poly connector " or " multiple cloning sites " Multiple 2 type restriction enzyme sites clusters.In other cases, the term as used herein " poly connector " refers to by any known seamless Cloning process is (that is, GibsonNEBuilder HiFiDNA Golden Gate Assembly、Assembly etc.) through targeting with one section of nucleotide of two sequences of engagement.Include poly connector Construct for such as gene coding region nucleic acid sequence insertion and/or excision.

As used herein, term " control " refers to the sample used in analysis program for comparative purposes.Control can For " positive " or " feminine gender ".For example, analysis program purpose be detection cell or tissue in differential expression transcript or It usually preferentially include positive control in the case where polypeptide, the plant sample expressed needed for such as known performance；And it is negative right According to such as known to lack the required plant sample expressed.

As used herein, term " plant " includes spawn, cell, tissue or the part of full plants and plant.It can It is extensive usually as the high and rudimentary plant classification by mutagenesis for the plant classification in the present invention, including angiosperm (unifacial leaf and dicotyledon), gymnosperm, pteridophyte and multicellular algae.Therefore, " plant " includes dicotyledon And monocotyledon.Term " plant part " includes any part of plant, including is for example not limited to: seed (including maturation Seed and immature seed)；Plant cutting；Plant cell；Plant cell cultures；Plant organ (for example, pollen, plumule, Flower, fruit, bud, leaf, root, stem and explant).Plant tissue or plant organ can be seed, protoplast, callus or It is organized into any other plant cell group of structure or function unit.Plant cell or tissue culture, which can regenerate, to be had by it The plant physiology of cell or tissue and the plant of morphological feature are obtained, and can regenerate there is base substantially the same with the plant Because of the plant of type.In contrast, some plant cells can not regenerate and generate plant.In plant cell or tissue culture Regenerable cell can be plumule, protoplast, meristematic cell, callus, pollen, leaf, anther, root, the tip of a root, silk, flower, Kernel, fringe, cob, shell or stalk.

Plant part includes that can harvest part and the part suitable for progeny plant breeding.Plant portion suitable for breeding Divide includes for example being not limited to: seed, fruit, cutting, seedling, stem tuber and rhizome.The part that harvests of plant can be plant Any available part of object, including be for example not limited to: flower, pollen, seedling, stem tuber, leaf, stem, fruit, seed and root.

Plant cell is the structure and physiology unit of plant, including protoplast and cell wall.Plant cell can be point From unicellular or cell aggregation object (for example, fragile callus and culture cell) form, and can be high tissue A part of unit (for example, plant tissue, plant organ and plant).Therefore, plant cell can be protoplast, gamete produces Raw cell or renewable cell or cell aggregation at full plants.Therefore, it comprising multiple plant cells and can regenerate The seed of full plants is considered as " plant cell " in embodiments herein.

As used herein, term " tiny RNA " refers to the non-encoding ribonucleic acid (ncRNA) of many classifications.Term tiny RNA is retouched State the short chain ncRNA generated in bacterial cell, animal, plant and fungi.These short chain ncRNA can be naturally-produced in the cell Or it can be generated by introducing the exogenous sequence of the short chain of expression or ncRNA.Tiny RNA sequence not direct coding protein, and It is functionally different from other RNA, because tiny RNA sequence is only transcribed but is not translated.Tiny RNA sequence participates in other cell function Can, including gene expression and modification.Small RNA molecular is usually made of about 20 to 30 nucleotide.Tiny RNA sequence can from compared with Long precursor.Precursor is formed in the structure that self-complementary area is turned back each other；Then they pass through the nuclease Dicer in animal or plant Nuclease DCL1 processing in object.

The tiny RNA of many types exists in natural or artificially generated form, including microRNA (miRNA), short interfering rna (siRNA), antisense RNA, short hairpin RNA (shRNA) and little nucleolar RNA (snoRNA).Certain form of tiny RNA (such as microRNA And siRNA) be important in gene silencing and RNA interference (RNAi).Gene silencing is genetic regulation method, wherein usually answering The gene of expression is by intracellular elements (in the case, tiny RNA) " closing ".The albumen that should be usually formed by this hereditary information Matter is since interference is without forming, and the encoded information in gene is blocked by expression.

As used herein, term " tiny RNA ", which is covered, is known as " Microrna " (Storz, (2002) Science in document 296:1260-3；Illangasekare et al., (1999) RNA 5:1482-1489), protokaryon " tiny RNA " (sRNA) (Wassarman et al., (1999) Trends Microbiol.7:37-45), eukaryon " non-coding RNA (ncRNA) ", " microRNA (miRNA) ", " small non-mRNA (snmRNA) ", " functional r NA (fRNA) ", " transfer RNA (tRNA) ", " catalytic RNA " [example Such as, ribozyme, including itself be acylated ribozyme (Illangaskare et al., (1999) RNA 5:1482-1489)], " little nucleolar RNA (snoRNA) ", " tmRNA " (also referred to as " 10S RNA ", Muto et al., (1998) Trends Biochem Sci.23:25-29； And Gillet et al., (2001) Mol Microbiol.42:879-885) RNA molecule；RNAi molecule includes but is not limited to " siRNA (siRNA) ", the siRNA (e-siRNA) of preparation " endoribonuclease ", " short hairpin RNA (shRNA) " and " small time adjustment RNA (stRNA) ", " siRNA (d-siRNA) of cutting " and aptamer；Include at least one uracil base Oligonucleotides and other nucleic acids.

Unless in addition particularly explaining, otherwise whole technical terms and scientific terms used herein have and disclosure institute The identical meaning that the those of ordinary skill in category field is generally understood.The definition of the generic term of molecular biology is found in example Such as: Lewin, Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9)；Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9)；With Meyers (eds.), Molecular Biology and Biotechnology:A Comprehensive Desk Reference,VCH Publishers,Inc.,1995(ISBN 1-56081-569-8)。

As used herein, unless context clear and definite point out on the contrary, otherwise word " one/one " and " should/institute State " it include plural object.

III. -3 gene regulatory elements of rice ubiquitin and the nucleic acid comprising it

It provides and expresses non-- 3 base of rice ubiquitin in plant using promoter or the 3 ' UTR from -3 gene of rice ubiquitin Because of sample transgene method and composition.In one embodiment, 3 ' UTR can be -3 base of rice ubiquitin of SEQID NO:1 Because of 3 ' UTR.

Transgene expression can be adjusted by being located at the 3'- untranslated gene regions (that is, 3'-UTR) in gene coded sequence downstream Control.Promoter and the controllable transgene expression of 3 ' UTR.Although promoter is 3 ' UTR genes necessary to driving transcription Area can terminate transcription and cause the polyadenylation of resulting mRNA transcript, for translating and protein synthesis.3'UTR Gene regions help stablizing for transgenosis to express.In one embodiment, expression casette includes 3'-UTR.In an embodiment party In case, 3'-UTR can be 3 '-UTR of -3 gene of rice ubiquitin.In one embodiment, expression casette includes 3'-UTR, Wherein 3 '-UTR and SEQ ID NO:1 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% are identical.In one embodiment, expression casette includes and operationally connects It is connected to the 3 '-UTR of -3 gene of rice ubiquitin of transgenosis.In an exemplary embodiment, expression casette includes and can operate Ground is connected to 3 '-UTR of transgenosis, wherein the transgenosis can be insecticidal resistant transgenic, herbicide tolerant transgenosis, Nitrogen service efficiency transgenosis, water service efficiency transgenosis, nutritional quality transgenosis, DNA combination transgenosis, selected marker turn base Cause or their combination.

In one embodiment, expression casette includes 3 ' UTR and promoter from -3 gene of rice ubiquitin, Described in promoter and SEQ ID NO:2 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 100% are identical.In one embodiment, expression casette includes and comes from 3 ' the UTR and promoter of -3 gene of rice ubiquitin, wherein the promoter comes from -3 gene of rice ubiquitin.In an embodiment party In case, expression casette includes 3 ' UTR and promoter from -3 gene of rice ubiquitin, wherein the promoter is originated from plant (such as 1 promoter of Chlorophyll Concentration in Corn a/b combination gene promoter or maize ubiquitin), virus (such as cassava vein virus starting Son) or bacterium (such as Agrobacterium tumefaciems Δ mas).In an exemplary embodiment, expression casette includes operationally It is connected to the 3 ' UTR of -3 gene of rice ubiquitin of transgenosis, wherein it is resistance to can be insecticidal resistant transgenic, herbicide for the transgenosis By property transgenosis, nitrogen service efficiency transgenosis, water service efficiency transgenosis, nutritional quality transgenosis, DNA combination transgenosis, choosing Selecting property marks transgenosis or their combination.

In one embodiment, nucleic acid carrier includes expression casette as disclosed herein.In an embodiment In, carrier, which can be, is suitable for directly plasmid, clay, the bacterial artificial chromosome of conversion or gene target such as donor dna (BAC), bacteriophage, virus or shearing polynucleotide passage.

According to an embodiment, the nucleic acid carrier comprising recombinant gene expression box is provided, wherein the recombinant gene expression Box includes: be operably coupled to the 3 ' UTR of -3 gene of rice ubiquitin of poly joint sequence, non-- 3 gene of rice ubiquitin or its Combination.In one embodiment, recombination box includes the rice ubiquitin-for being operably coupled to non-- 3 gene of rice ubiquitin 3 gene, 3 ' UTR.In one embodiment, recombination box include be operably coupled to poly joint sequence as herein Disclosed 3 ' UTR of -3 gene of rice ubiquitin.Poly connector is operably coupled to -3 gene 3 ' of rice ubiquitin in a certain way UTR, coded sequence so that a restriction site of coded sequence insertion poly connector will be operably connected, to allow The coded sequence is expressed when carrier converts or transfects into host cell.

According to an embodiment, the nucleic acid carrier comprising box gene is provided, the box gene is by gene promoter, non-aqueous - 3 gene 3'-UTR of rice ubiquitin of -3 gene of rice ubiquitin and SEQ ID NO:1 composition.In one embodiment, SEQ ID - 3 gene 3'-UTR of rice ubiquitin of NO:1 is operably coupled to 3 ' ends of non-- 3 transgenosis of rice ubiquitin.In another reality Apply in scheme, 3' non-translated sequence include SEQ ID NO:1 or with SEQ ID NO:1 have 80%, 85%, 90%, 95%, The sequence of 99% or 100% sequence identity.According to an embodiment, the nucleic acid carrier comprising box gene is provided, the base Because box is made of promoter, non-- 3 gene of rice ubiquitin and 3'UTR, wherein it is general to be operably coupled to non-rice for the promoter The end 5' of plain -3 genes, and the 3'UTR of SEQ ID NO:1 is operably coupled to 3 ' ends of non-- 3 gene of rice ubiquitin End.In another embodiment, 3' non-translated sequence include SEQ ID NO:1 or with SEQ ID NO:1 have 80%, 85%, the sequence of 90%, 95%, 99% or 100% sequence identity.In another embodiment, 3' non-translated sequence by SEQ ID NO:1 or the 1001bp sequence with SEQ ID NO:1 with 80%, 85%, 90%, 95% or 99% sequence identity Column composition.

In one embodiment, provide nucleic acid construct, it includes promoter and non-- 3 gene of rice ubiquitin and One or more of optional following elements:

A) 5' non-translational region；

B) introne；And

C) 3' non-translational region,

Wherein,

The promoter is made of SEQ ID NO:2 or known promoter sequence such as -3 gene promoter of rice ubiquitin；

This includes sub-district and is made of known intron sequences；And

The 3' non-translational region by SEQ ID NO:1 or with SEQ ID NO:1 there is the sequence of 98% sequence identity to form； In addition wherein the promoter is operably coupled to the transgenosis, and each optional element (if present) can also operate Ground is connected to both promoter and transgenosis.In another embodiment, transgenic cell is provided, it includes public immediately above The nucleic acid construct opened.In one embodiment, transgenic cell is plant cell, and in another embodiment, Plant is provided, wherein the plant includes the transgenic cell.

In one embodiment, provide nucleic acid construct, it includes promoter and non-- 3 transgenosis of rice ubiquitin with And one or more of optional following elements:

A) introne；With

B) 3' non-translational region,

Wherein,

The promoter is made of SEQ ID NO:2 or known promoter sequence such as -3 gene promoter of rice ubiquitin；

This includes sub-district and is made of known intron sequences；

The 3' non-translational region by SEQ ID NO:1 or with SEQ ID NO:1 there is the sequence of 98% sequence identity to form； In addition wherein the promoter is operably coupled to the transgenosis, and each optional element (if present) can also operate Ground is connected to both promoter and transgenosis.In another embodiment, transgenic cell is provided, it includes public immediately above The nucleic acid construct opened.In one embodiment, transgenic cell is plant cell, and in another embodiment, Plant is provided, wherein the plant includes the transgenic cell.

According to an embodiment, nucleic acid carrier also includes the sequence of encoding selection markers.According to an embodiment, Recombination box is operably coupled to the boundary Agrobacterium T-DNA.According to an embodiment, recombination box also includes One and the 2nd boundary T-DNA, wherein the first boundary T-DNA is operably coupled to an end of gene construct, and 2nd boundary T-DNA is operably coupled to another end of gene construct.First and second sides Agrobacterium T-DNA Boundary can be selected from independently selected from the T-DNA border sequence for deriving from bacterium bacterial strain, the T-DNA border sequence: synthesize nopaline The boundary Agrobacterium T-DNA, the boundary Agrobacterium T-DNA for synthesizing octopine, the side Agrobacterium T-DNA for synthesizing mannopine Boundary, the boundary Agrobacterium T- of ambroin alkali or any combination of them.In one embodiment, it provides selected from nopaline The Agrobactehum strain for synthesizing bacterial strain, mannopine synthesis bacterial strain, amber alkali synthesis bacterial strain or octopine synthesis bacterial strain, wherein described Bacterial strain includes plasmid, wherein the plasmid include be operably coupled to sequence selected from SEQ ID NO:1 or with SEQ ID NO:1 Sequence with 80,85,90,95 or 99% sequence identity.

Transgenosis of interest suitable for construct disclosed by the invention includes but is not limited to assign (1) to pest or disease The resistance of disease；(2) to the tolerance of herbicide；(3) increase value Agronomic character, such as yield improvement, nitrogen service efficiency, Water service efficiency and nutritional quality；(4) protein and DNA with site-specific fashion in conjunction with；(5) tiny RNA and (6) choosing are expressed The coded sequence of selecting property label.According to an embodiment, transgenes encoding selected marker or imparting insecticidal resistance, weeding Agent tolerance, tiny RNA expression, nitrogen service efficiency, water service efficiency or nutritional quality gene product.

1. insect-resistant

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Exemplary insect-resistant coded sequence is known in the art.As the tune that can be operably coupled to the disclosure The embodiment for controlling the insect-resistant coded sequence of element, provides following character.Exemplary Lepidoptera is provided (Lepidopteran) coded sequence of insect-resistant include: cry1A, cry1A.105, cry1Ab, cry1Ab (truncation), Cry1Ab-Ac (fusion protein), cry1Ac (withSale), cry1C, cry1F (withPin Sell), cry1Fa2, cry2Ab2, cry2Ae, cry9C, mocry1F, pinII (protease inhibitors), vip3A (a) and vip3Aa20.There is provided exemplary coleoptera (Coleopteran) insect-resistant coded sequence include: cry34Ab1 (withSale), cry35Ab1 (withSale), cry3A, cry3Bb1, dvsnf7 and mcry3A.It provides The coded sequence of exemplary more insect-resistants includes ecry31.Ab.The list of the above insect-resistance gene is not intended to be restrictive. The disclosure covers any insect-resistance gene.

2. herbicide tolerant

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Exemplary herbicide tolerant coded sequence is known in the art.As the disclosure can be operably coupled to Controlling element herbicide tolerant coded sequence embodiment, following character is provided.Glyphosate herbicidal, which contains, to be passed through Inhibit the binding mode of EPSPS enzyme (5- enol pyruvylshikimate -3- phosphate synthase).The enzyme participates in plant growth and development must The biosynthesis of the aromatic amino acid needed.It is known in the art for can be used for inhibiting the various enzymatic mechanism of the enzyme.It encodes such The gene of enzyme can be operably coupled to the gene regulatory elements of the disclosure.In one embodiment, selected marker base Because including but is not limited to gene of the coding including Glyphosate resistance gene below: mutation EPSPS gene, such as 2mEPSPS base Cause, cp4EPSPS gene, mEPSPS gene, dgt-28 gene, aroA gene；And glyphosate degradation gene, such as glyphosate Acetyl transferase gene (gat) and glyphosate enzyme gene (gox).These characters are at present with Gly-Tol^TM、 GT and RoundupSale.Glufosinate-ammonium and/or Bi Lacao (bialaphos) chemical combination The resistant gene of object includes dsm-2, bar and pat gene.Bar and pat character is at present with LibertySale.Also wrap The genes conferring resistance provided to the resistance of 2,4-D is included, such as aad-1 gene is (it should be noted that aad-1 gene has to aryloxy group benzene oxygen Base propionic ester herbicide other activity) and aad-12 gene (it should be noted that aad-12 gene have to pyridine ethoxyacetic acid ester conjunction At other activity of auximone).These character conductsCrop protection technical selling.ALS inhibitor (sulfonylureas, Imidazolone, triazolo pyrimidine, pyrimidine radicals Thiobenzoate and sulfonyl amido-carbonyl-triazolin ketone) resistant gene be It is known in the art.These resistant genes are most often caused by the point mutation of ALS coding gene sequence.Other ALS inhibitor resistances Gene includes hra gene, csr1-2 gene, Sr-HrA gene and surB gene.Some characters are with trade markPin It sells.Inhibit HPPD herbicide include pyrazolone, such as pyrazoxyfen (pyrazoxyfen), benzofenap (benzofenap) and Benzene pyrazoles humulone (topramezone)；Triketone, such as mesotrione (mesotrione), sulphur humulone (sulcotrione), Tembotrions (tembotrione), the bicyclic ketone of benzo (benzobicyclon)；And diketone nitrile, such as isoxaflutole (isoxaflutole).These exemplary HPPD herbicides can be resistant to by known character.The example of HPPD inhibitor includes HppdPF_W336 gene (about the resistance to isoxaflutole) and avhppd-03 gene (resist about to mesotrione Property).The example of cyanophenyl herbicide tolerance trait includes bxn gene, shows imparting to herbicide/antibiotic Brominal (bromoxynil) resistance.The resistant gene for eliminating a gram grass (dicamba) includes such as International PCT publication number WO 2008/105890 Disclosed eliminates a gram careless monooxygenase gene (dmo).PPO or PROTOX inhibitor type herbicide (such as acifluorfen (acifluorfen), the careless ester (flupropazil) of butafenacil (butafenacil), fluorine third, pentoxazone (pentoxazone), azoles humulone (carfentrazone), fluazolate (fluazolate), pyraflufen-ethyl (pyraflufen), aclonifen (aclonifen), grass fragrant fixed (azafenidin), flumioxazin (flumioxazin), fluorine Alkene oxalic acid (flumiclorac), Bi Fennuo (bifenox), Oxyfluorfen (oxyfluorfen), lactofen (lactofen), fomesafen (fomesafen), fluoroglycofen-ethyl (fluoroglycofen) and sulfentrazone (sulfentrazone)) resistant gene is known in the art.Imparting includes wild to the Exemplary gene of the resistance of PPO Overexpression (Lermontova I and Grimm B, (2000) Overexpression of plastidic of type arabidopsis PPO enzyme protoporphyrinogen IX oxidase leads to resistance to the diphenyl-ether Herbicide acifluorfen.Plant Physiol 122:75-83.), bacillus subtilis (B.Subtilis)) PPO Gene (Li, X. and Nicholl D.2005.Development of PPO inhibitor-resistant cultures And crops.Pest Manag.Sci.61:277-285 and Choi KW, Han O, Lee HJ, Yun YC, Moon YH, Kim MK, Kuk YI, Han SU and Guh JO, (1998) Generation of resistance to the diphenyl ether herbicide,oxyfluorfen,via expression of the Bacillus subtilis protoporphyrinogen oxidase gene in transgenic tobacco plants.Biosci Biotechnol Biochem 62:558–560.).The resistant gene of pyridine oxygroup or phenoxy propionic acid and cyclohexanone includes ACC Enzyme inhibitor encoding gene (such as Acc1-S1, Acc1-S2 and Acc1-S3).It assigns to cyclohexanedione and/or aryloxy group benzene oxygen The Exemplary gene of the resistance of base propionic acid includes haloxyfop-P-methyl (haloxyfop), diclofop-methyl (diclofop), smart oxazole standing grain Careless spirit sour (fenoxyprop), fluazifop (fluazifop) and quizalofop-ethyl (quizalofop).Finally, can inhibit photosynthetic At herbicide (including triazine or benzonitrile) pass through psbA gene (to the tolerance of triazine), (tolerance to triazine of 1s+ gene Property) and nitrilase gene (to the tolerance of benzonitrile) offer tolerance.The list of the above herbicide tolerance gene is not intended to It is restrictive.The disclosure covers any herbicide tolerance gene.

3. Agronomic character

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Exemplary Agronomic character coded sequence is known in the art.As the disclosure can be operably coupled to The embodiment of the Agronomic character coded sequence of controlling element, provides following character.The fruit of the delay as provided by pg gene Real softening inhibits to be responsible for the generation of the polygalacturonase of pectin molecule fracture in cell wall, postpones so as to cause fruit soft Change.In addition, delay fruit curing/aging of acc gene is used to inhibit the normal expression of natural acc synthase gene, so as to cause Ethylene, which generates, to be reduced and fruit delayed maturation.However, accd gene makes the precursor metabolism of fruit curing hormone ethylene, so as to cause Fruit delayed maturation.Alternatively, sam-k gene by reduce generate ethylene substrate S-adenosylmethionine (SAM) cause it is ripe Change delay.The drought stress tolerance phenotype as provided by cspB gene is by keeping rna stability and translation to coerce in water Under the conditions of maintain normal cell function.Another example includes the sweet ammonia of osmotic protection compound that catalysis assigns water stress tolerance The EcBetA gene of the generation of sour glycine betaine.In addition, the catalysis of RmBetA gene assigns the osmotic protection chemical combination of water stress tolerance The generation of object glycinebetaine.By expression with the interaction of one or more endogenous transcription factors to adjust plant The bbx32 gene of the protein of day night physiology course improves to provide photosynthesis and yield.It can be by expressing encoding heat stable α- The amy797E gene of amylase increases ethanol production, which is used for the thermal stability of the amylase of degradable starch by increasing Improve bio-ethanol yield.Finally, can be by expressing the cordapA gene generation for encoding dihydropyridine dicarboxylic acid esters synthase through repairing The amino acid composition of decorations, the enzyme increase the yield of amino acid lysine.The list of the above Agronomic character coded sequence is not intended to It is restrictive.The disclosure covers any Agronomic character coded sequence.

4.DNA binding protein

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Exemplary DNA binding protein coded sequence is known in the art.As the disclosure can be operably coupled to The embodiment of the DNA binding protein coded sequence of controlling element, it may include following kind of DNA binding protein: zinc finger, Talen, CRISPR and meganuclease.The list of the above DNA binding protein coded sequence is not intended to be restrictive.The disclosure Cover any DNA binding protein coded sequence.

5. tiny RNA

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Exemplary tiny RNA character is known in the art.As the controlling element that can be operably coupled to the disclosure The embodiment of tiny RNA coded sequence provides following character.For example, the delay anti-efe tiny RNA of fruit curing/aging passes through volume The ACO gene silencing ethene suppressing that code ethylene forms enzyme generates to postpone to cure.The ccomt tiny RNA for changing lignin yield is logical Cross inhibition endogenous s-adenosyl-L-methionine: trans- coffee acyl CoA 3-O- transmethylase (CCOMT gene) is reduced The content of guaiacyl (G) lignin.In addition, the black spot bruise tolerance in Solanum verrucosum can be small by Ppo5 RNA triggering Ppo5 transcript degradation is reduced with blocking black spot bruise to occur.Further include and contains western corn rootworm Snf7 base The dsRNA of the 240bp segment of cause inhibits the dvsnf7 tiny RNA of western corn rootworm together.Modified starch/carbohydrate can be by Such as pPhL tiny RNA (degradation PhL transcript forms reduced sugar by starch degradation to limit) and (the degradation R1 transcription of pR1 tiny RNA Object with limit by starch degradation formed reduced sugar) tiny RNA generate.In addition, by triggering Asn1 degradation to weaken asparagine The asn1 tiny RNA for forming and reducing polyacrylamide generates the benefit of such as acrylamide reduction.Finally, pgas ppo inhibits small The non-browning phenotype of RNA causes to inhibit PPO, to generate the apple with non-browning phenotype.The list of the above tiny RNA is without meaning It is restrictive.The disclosure covers any tiny RNA coded sequence.

6. selected marker

The various selected markers of also referred to as reporter gene can be operably coupled to 3 ' UTR of -3 gene of rice ubiquitin, 3 ' the UTR includes SEQ ID NO:1 or has 80%, 85%, 90%, 95% or 99% sequence identity with SEQ ID NO:1 Sequence.Then the sequence being operably connected may be incorporated into selected carrier, to allow to identify and select the plant of conversion (" to turn Beggar ").Many methods can be used for confirming that expression of the selected marker in conversion plant, including such as DNA sequencing and PCR (gather Polymerase chain reaction), Southern blotting, RNA blotting, for detect by carrier express protein immunization method. However, generating the protein of color products when usually expressing by visual observations come visual report gene.Illustrative report gene It is known in the art and encoding p-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescence egg White (YFP, Phi-YFP), red fluorescent protein (DsRFP, RFP etc.), beta galactosidase etc. (referring to Sambrook et al., Molecular Cloning:A Laboratory Manual, the third edition, Cold Spring Harbor Press, N.Y., 2001, content, which is incorporated by reference, to be incorporated herein).

Transformed cells or tissue are selected using selected marker.Selected marker includes coding antibiotic resistance Gene, such as encoding neomycin phosphotransferase II (NEO), spectinomycin/streptomycin resistance (AAD) and hygromycin phosphoric acid turn It moves the gene of enzyme (HPT or HGR) and assigns the gene to the resistance of herbicides compounds.Herbicide resistance gene usually encodes pair Herbicide is insensitive to make through modification target proteins or before herbicide can act it degrade in plant or the enzyme of detoxification. For example, by using the gene acquisition pair of encoding mutant target enzymes 5- enol pyruvylshikimate -3- phosphate synthase (EPSPS) The resistance of glyphosate.The gene and mutant of EPSPS is well known, and is described further below.By using coding (each of them is to make the reality of the protein of its corresponding herbicide detoxification by PAT or DSM-2, nitrilase, AAD-1 or AAD-12 Example) bacterial gene obtain to the resistance of glufosinate-ammonium, Brominal and 2,4 dichloro benzene ethoxyacetic acid ester (2,4-D).

In one embodiment, herbicide can inhibit growing point or separate living tissue, including imidazolone or sulfonylureas, and It and about the acetohydroxyacid synthases of these herbicides (AHAS) and acetolactate synthase (ALS) resistance/genes conferring resistance is ripe Know.Glyphosate resistance gene respectively includes mutation 5- enol pyruvylshikimate -3- phosphate synthase (EPSP) and dgt-28 base Because of (by the various forms of living body mutagenesis for introducing recombinant nucleic acid and/or natural EPSP gene), aroA gene and glyphosate second Acyltransferase (GAT) gene.The resistant gene of other phosphono compounds includes from including streptomyces hygroscopicus (Streptomyces hygroscopicus) and green color-producing streptomycete (Streptomyces viridichromogenes) Streptomyces spec bar and pat gene and pyridine oxygroup or phenoxy propionic acid and cyclohexanone (ACC enzyme inhibitor coding Gene).It assigns to cyclohexanedione and/or aryloxyphenoxypropionic (including haloxyfop-P-methyl, diclofop-methyl, smart oxazole dogstail Clever acid, fluazifop, quizalofop-ethyl) resistance Exemplary gene include acetyl-CoA carboxylase (ACC enzyme) gene； Acc1-S1, Acc1-S2 and Acc1-S3.In one embodiment, herbicide can inhibit photosynthesis, including triazine (psbA and 1s+ gene) or benzonitrile (nitrilase gene).In addition, such selected marker may include positive selectable marker, such as phosphoric acid Mannose isomerase (PMI).

In one embodiment, selected marker includes but is not limited to encode gene below: 2,4-D, new mould Plain phosphotransferase II, cyanamide hydrase, aspartokinase, dihydropyridine dicarboxylic acid esters synthase, tryptophan decarboxylase, dihydro Pyridinedicarboxylic acid ester synthase and the aspartokinase of desensitization, bar gene, tryptophan decarboxylase, neomycin phosphotransferase (NEO), hygromix phosphotransferase (HPT or HYG), dihyrofolate reductase (DHFR), glufosinate transacetylase, 2,2- bis- Chloropropionic acid go halogen enzyme, acetohydroxyacid synthases, 5- enol pyruvylshikimate-phosphate synthase (aroA), halogen aryl nitrilase, Acetyl-CoA carboxylase, dihydrofolate synthase (sul I) and 32kD Photosystem I I polypeptide (psbA).One embodiment is also wrapped Coding is included to the selected marker of resistance below: chloramphenicol, methotrexate, hygromycin, spectinomycin, Brominal, grass Sweet phosphine and glufosinate.The list of property marker gene selected above is not intended to be restrictive.The disclosure cover any reporter gene or Selected marker.

In some embodiments, the coded sequence of synthesis optimum expression in plant.For example, in an embodiment In, the coded sequence of gene has been modified by codon optimization to enhance the expression in plant.Insecticidal resistant transgenic, Herbicide tolerant transgenosis, nitrogen service efficiency transgenosis, water service efficiency transgenosis, nutritional quality transgenosis, DNA, which are combined, to be turned Gene or selected marker transgenosis can be optimized to express in specified plant species, or can be modified with dicotyledonous or Optimum expression in monocotyledon.The preferred codon of plant can by specified plant species of interest with maximum expression Highest frequency codon in protein determines.In one embodiment, coded sequence, gene or transgenosis are designed as It is expressed in plant with higher level, to generate high conversion efficiency.The method that plant for gene optimizes is well known.It closes In the guidance of optimization and the generation of synthetic DNA sequence be found in the WO2013016546 being for example herein incorporated by reference, WO2011146524, WO1997013402, U.S. Patent number 6166302 and U.S. Patent number 5380831.

Conversion

Method suitable for Plant Transformation include can by DNA introduce cell any method, such as and be not limited to: electroporation (see, for example, United States Patent (USP) 5,384,253)；Microparticle bombardment (see, for example, United States Patent (USP) 5,015,580,5,550,318,5, 538,880,6,160,208,6,399,861 and 6,403,865)；Conversion that Agrobacterium mediates (see, for example, United States Patent (USP) 5, 635,055,5,824,877,5,591,616；5,981,840 and 6,384,301)；And protoplast transformation is (see, for example, beauty State's patent 5,508,184).

DNA construct can be used the technology that such as stirs together with silicon carbide fibre and be introduced directly into the gene of plant cell Such as DNA particle can be used to bombard for group DNA (see, for example, United States Patent (USP) 5,302,523 and 5,464,765) or DNA construct Ballistic methods and be introduced directly into plant tissue (see, for example, Klein et al. (1987) Nature 327:70-73).Alternatively, DNA construct can be converted by nanoparticle introduced plant cell (see, for example, U.S. Patent Publication No. 20090104700, It, which is incorporated by reference, is incorporated herein).

In addition, Non Agrobacterium bacterium or virus can be used to realize for gene transfer, such as rhizobium (Rhizobium Sp.) NGR234, Sinorhizobium meliloti (Sinorhizoboium meliloti), Mesorhizobium loti (Mesorhizobium Loti), Potyvirus X, cauliflower mosaic poison and cassava vein mosaic virus and/or tobacco mosaic virus (TMV), see, for example, Chung et al. (2006) Trends Plant Sci.11 (1): 1-4.

By the way that stable conversion, and these cells can be obtained using the cell of transformation technology, substantially any plant species Genetically modified plants can be developed by well known technology.For example, technology that can be particularly suitable in the background of Cotton Transformation such as beauty Described by state's patent 5,846,797,5,159,135,5,004,863 and 6,624,344；Particularly for converting Btassica (Brassica) technology of plant is as described by such as United States Patent (USP) 5,750,871；Technology for soybean transformation is such as example beautiful Described by state's patent 6,384,301；For converting the technology such as such as United States Patent (USP) 7,060,876 and 5,591,616 of maize And International PCT discloses described by WO 95/06722.

After Exogenous Nucleic Acid is effectively delivered to recipient cell, usually to identify transformed cells for further cultivating And plant regeneration.In order to improve the ability for identifying transformant, technical staff may need to use selected marker and use In the conversion carrier for generating transformant.In an exemplary embodiment, transformed cells group can be by being exposed to cell One or more selective pesticides and analyzed, or required marker gene character screening cell can be directed to.

It can will be exposed to the cell survived after selective agent or be rated as positive cell in screening test and be placed in It supports to cultivate in the culture medium of plant regeneration.In one embodiment, any suitable plant tissue culture media can pass through packet It includes other substances of such as growth regulator and modifies.Tissue can be maintained on the basal medium with growth regulator, Until when enough tissues can be obtained for starting plant regeneration work, or repeat take turns manually select after, (for example, at least 2 weeks) until when tissue morphology is suitable for regeneration, it is then transferred into the culture medium for being beneficial to bud formation. Periodically transfer culture, until when having there is the formation of sufficient bud.Bud once being formed, being just transferred into is beneficial to root shape At culture medium in.Enough once being formed, so that it may plant be transferred in soil, so as to further growth and maturation.

Molecule confirmation

Plant cell, callus, tissue or the plant of conversion can be by for the marker gene as present on conversion DNA The character determination of coding screens engineered plant to identify and separate.For example, can be by making engineered plant Object material is grown on the culture medium of the antibiotic containing amount of suppression or herbicide to be selected, and transformed gene construct assigns To the resistance of the antibiotic or herbicide.In addition, conversion plant and plant cell can also may be present in recombinant nucleic acid by screening The activity of any visible marker genes (for example, beta-Glucuronidase, luciferase or gfp gene) in construct identifies. Such selection and screening technique are well-known to those having ordinary skill in the art.It can be used for identifying the molecule confirmation method of genetically modified plants It is known to those skilled in the art.Many illustrative methods are described further below.

It is described in molecular beacon used in Sequence Detection.In brief, FRET oligonucleotide probe be designed to Flank genome and the overlapping of the insertion junction DNA.The unique texture of FRET probe makes it contain holding fluorescence part and portion is quenched Divide close secondary structure.(in insertion DNA sequence dna, a primer is flanking a primer for FRET probe and PCR primer In genome sequence) it is recycled there are heat-stabilised poly synthase and dNTP.After success PCR amplification, FRET Probe causes probe secondary structure to remove with hybridizing for target sequence, and fluorescence part is spatially separating with quencher moieties.Fluorescence Signal designation exists due to Successful amplification and hybridization and flanks genome/transgene insert sequence.For in the form of amplified reaction Such molecular beacon assays of detection are the embodiments of the disclosure.

Hydrolysis probes are analyzed or are(Life Technologies, Foster City, Calif.) is A kind of existing method of detection and quantitative DNA sequence dna.In brief, FRET oligonucleotide probe is designed to have transgenosis An interior oligonucleotides, and flank in genome sequence the oligonucleotides for event-specific detection.FRET Probe and PCR primer (for a primer in insertion DNA sequence dna, a primer is in flanking genome sequence) are there are thermostabilizations It is recycled in the case where polymerase and dNTP.The hybridization of FRET probe causes the fluorescence part on FRET probe to cut and discharge Far from quencher moieties.Fluorescence signal instruction exists due to Successful amplification and hybridization and flanks/transgene insert sequence.For to expand The such hydrolysis probes analysis for increasing reaction formation detection is the embodiment of the disclosure.

Analysis is the existing method of a kind of detection and quantitative DNA sequence dna.In brief, using referred to asThe Analysis and Screening based on polymerase chain reaction (PCR) of analysis system includes integrator gene expression cassette multicore glycosides The genome DNA sample of acid.For disclosure practiceAnalysis is using containing multiple primers PCR analysis of mixtures.Primer for PCR analysis of mixtures may include at least one forward primer and at least one reversely draws Object.Forward primer contains the sequence of the given zone corresponding to DNA polynucleotide, and reverse primer contains corresponding to genome sequence The sequence of the given zone of column.In addition, the primer for PCR analysis of mixtures may include at least one forward primer and at least one Reverse primer.For example,Two forward directions for corresponding to two not iso-alleles can be used to draw for PCR analysis of mixtures Object and a reverse primer.One forward primer contains the sequence of the given zone corresponding to endogenous genomic sequence.Second just Contain the sequence of the given zone corresponding to DNA polynucleotide to primer.Reverse primer contains corresponding to the specific of genome sequence The sequence in area.For detecting the such of amplified reactionAnalysis is an embodiment of the disclosure.

In some embodiments, fluorescence signal or fluorescent dye are selected from: HEX fluorescent dye, FAM fluorescent dye, JOE are glimmering Photoinitiator dye, TET fluorescent dye, 3 fluorescent dye of Cy, 3.5 fluorescent dye of Cy, 5 fluorescent dye of Cy, 5.5 fluorescent dye of Cy, Cy 7 fluorescent dyes and ROX fluorescent dye.

In other embodiments, using cell DNA capable of being made to contaminate in the concentration range that can pass through Flow cytometry Color and have suitable second fluorescent DNA dyes for the fluorescence emission spectrum that can be detected by real time thermocycler expand it is anti- It answers.It should be appreciated by those skilled in the art that other nucleic acid dyes are known and are constantly identified.It can be used Any suitable nucleic acid dye with appropriate excitation and emission spectra, such as YO-SYTOX SYBR Green WithIn one embodiment, the second fluorescent DNA dyes be less than 10 μM, less than 4 μM or less than 2.7 μM when make ?

In other embodiments, next-generation sequencing (NGS) can be used to be detected.Such as Brautigma et al., 2010 institutes It states, DNA sequence analysis can be used for measuring the nucleotide sequence of separation and amplified fragments.The segment of amplification is separable and is subcloned extremely Carrier, and be sequenced using chain terminator method (also referred to as Sanger sequencing) or dye-terminators PCR sequencing PCR.In addition, Next-generation PCR sequencing PCR can be used to be sequenced for amplicon.NGS technology does not need subcloning steps, and multiple sequencing reading process can It is completed in single reaction.Three NGS platforms are commercially available, i.e. the Genome from 454Life Sciences/Roche Sequencer FLX^TM, Illumina Genome Analyser from Solexa^TMWith Applied Biosystems's SOLiD^TM(' prefix of Sequencing by Oligo Ligation and Detection ').At present additionally, there are two kinds Single-molecule sequencing method being developed.These methods include coming from Helicos Bioscience^TMTrue Single Molecule Sequencing (tSMS) and Single Molecule Real from Pacific Biosciences Time^TMIt is sequenced (SMRT).

The Genome Sequencher FLX of 454Life Sciences/Roche sale^TMIt is long reading NGS, uses Emulsion-based PCR and pyrosequencing are read with generating sequencing.The DNA fragmentation of 300-800bp can be used or contain 3-20kb segment Library.Reaction each run can produce the reading more than 1,000,000 about 250 to 400 bases, generate 250 to 400,000,000 in total Base.This technology generates longest and reads, but total sequence output of each run is lower compared with other NGS technologies.

Solexa^TMThe Illumina Genome Analyser of sale^TMIt is short reading NGS, uses and utilize fluorescent dye The synthetic method sequencing of the reversible terminator nucleotides of label, and it is based on solid phase bridge-type PCR.It can be used containing most 10kb The paired end sequencing library construction of DNA fragmentation.Reaction generates the short reading more than 100,000,000 times, and reading length is 35-76 base. The data each run can produce 3-6 gigabit base.

Applied Biosystems^TMThe sequencing of (SOLiD) system that engaged and detected by oligonucleotides of sale is short Reading technology.The NGS technology is up to the fragmentation double-stranded DNA of 10kb using length.The system is used through dye marker Oligonucleolide primers connection and emulsion-based PCR generate 1,000,000,000 times short reading to be sequenced, and each run generates most 30 gigabit bases Total sequence output.

Helicos Bioscience^TMTSMS and Pacific Biosciences^TMSMRT using single DNA The distinct methods of molecule progress serial response.tSMS Helicos^TMSystem each run generates most 800,000,000 short readings, obtains 21 gigabit bases.These reactions are completed using the virtual terminator nucleotides of fluorochrome label, are spoken approvingly of as " synthesis is surveyed Sequence " method.

Pacific Biosciences^TMSMRT next generation's sequencing system of sale uses the real-time survey carried out by synthesis Sequence.The technology can produce the reading that length is most 1,000bp due to not limited by reversible terminator.It is daily using the technology It can produce the original reading flux for being equivalent to one times of coverage of diploid human genome.

In another embodiment, engram analysis can be used to complete detection, including western blot, Northern print Mark and Southern trace.Such engram analysis is the identification and quantitative common skill that biological sample is used in biological study Art.These analyses include that sample component is separated in gel by electrophoresis first, then by the electrophoretic separation component from gel Be transferred to transfer membrane, the transfer membrane by such as nitrocellulose, polyvinylidene fluoride (PVDF) or nylon (Nylon) material system At.Analyte can also directly point sample guide on these carriers or by applying vacuum, capillarity or pressure to carrier Specific region, without separating in advance.Then transfer membrane is made to be subjected to transfer post-processing, usually to enhance visually or by certainly Dynamicization reader is distinguished from each other and tests and analyzes the ability of object.

In another embodiment, elisa assay can be used to complete detection, which is come using solid phase EIA enzyme immunoassay Detect the presence of fluid sample or the substance (usually antigen) in wet sample.Antigen from sample is attached to planar surface. Then, another specific antibody is applied on surface so that it can be with antigen binding.The antibody is connected to enzyme, and most The substance containing zymolyte is added in whole step.Subsequent reactions generate detectable signal, the most commonly color change of substrate.

Genetically modified plants

In one embodiment, plant, plant tissue or plant cell include 3 ' UTR of -3 gene of rice ubiquitin.One In a embodiment, plant, plant tissue or plant cell include with selected from SEQ ID NO:1 sequence or be selected from SEQ The sequence of ID NO:1 has -3 gene of rice ubiquitin of the sequence of 80%, 85%, 90%, 95% or 99.5% sequence identity 3'UTR.In one embodiment, plant, plant tissue or plant cell include expression casette, which includes Sequence selected from SEQ ID NO:1, or with selected from be operably coupled to non-- 3 gene of rice ubiquitin SEQ ID NO:1 sequence Arrange the sequence with 80%, 85%, 90%, 95% or 99.5% sequence identity.In an exemplary embodiment, it plants Object, plant tissue or plant cell include expression casette, which includes the water for being operably coupled to transgenosis 3 ' UTR of -3 gene of rice ubiquitin, wherein the transgenosis can be insecticidal resistant transgenic, herbicide tolerant transgenosis, nitrogen and make With efficiency transgenosis, water service efficiency transgenosis, nutritional quality transgenosis, DNA combination transgenosis, selected marker transgenosis or Their combination.

According to an embodiment, plant, plant tissue or plant cell are provided, wherein the plant, plant tissue or plant Object cell includes the sequence from 3 ' UTR of -3 gene of rice ubiquitin for being operably coupled to transgenosis, and wherein this is derived from The sequence of 3 ' UTR of -3 gene of rice ubiquitin include sequence SEQ ID NO:1 sequence or with SEQ ID NO:1 have 80%, 85%, the sequence of 90%, 95% or 99.5% sequence identity.In one embodiment, plant, plant tissue or plant are provided Object cell, wherein the plant, plant tissue or plant cell include the SEQ for being operably coupled to non-- 3 gene of rice ubiquitin ID NO:1 or the sequence with SEQ ID NO:1 with 80%, 85%, 90%, 95% or 99.5% sequence identity.At one In embodiment, plant, plant tissue or plant cell be dicotyledonous monocotyledon or derive from dicotyledonous or unifacial leaf The cell or tissue of plant.In one embodiment, plant be selected from maize, wheat, rice, sorghum, oat, rye, banana, Sugarcane, soybean, cotton, sunflower and mustard.In one embodiment, plant is corn.According to an embodiment, it plants Object, plant tissue or plant cell include the SEQ ID NO:1 or and SEQ for being operably coupled to non-- 3 gene of rice ubiquitin ID NO:1 has the sequence of 80%, 85%, 90%, 95% or 99.5% sequence identity.In one embodiment, plant, Plant tissue or plant cell include the promoter for being operably coupled to transgenosis, and wherein the promoter is by SEQ ID NO:1 Or with SEQ ID NO:1 there is the sequence of 80%, 85%, 90%, 95% or 99.5% sequence identity to form.According to a reality Scheme is applied, the gene construct of the 3 ' UTR sequence of -3 gene of rice ubiquitin comprising being operably coupled to transgenosis is incorporated to plant In the genome of object, plant tissue or plant cell.

In one embodiment, it can be according to the plant of method disclosed herein, plant tissue or plant cell Dicotyledon.Dicotyledon, plant tissue or plant cell can be but not limited to clover, vegetable seed, mustard, India mustard Dish, Ethiopia leaf mustard, soybean, sunflower, cotton, Kidney bean, cabbage, Brussels sprouts, cauliflower, celery, cucumber, eggplant, lettuce Lettuce；Muskmelon, pea, pepper, peanut, potato, pumpkin, radish, spinach, beet, sunflower, tobacco, tomato and watermelon.

It is incorporated to genetically modified plants those skilled in the art will recognize that stablizing in exogenous sequence and confirms and can operate Later, it can be introduced into other plant by sexual hybridization.It can be used in many standard breeding techniques according to species to be hybridized Any one.

The disclosure also covers the seed of genetically modified plants described above, and wherein the seed has transgenosis or contains this public affairs The gene construct for the gene regulatory elements opened.The disclosure also covers the filial generation of genetically modified plants described above, clone, thin Born of the same parents system or cell, wherein the filial generation, clone, cell line or cell have transgenosis or the gene regulation member containing the disclosure The gene construct of part.

The disclosure also covers the cultivation of genetically modified plants described above, and wherein the genetically modified plants have transgenosis or contain There is the gene construct of the gene regulatory elements of the disclosure.Therefore, such genetically modified plants can be by using according to the disclosure Nucleic acid molecules conversion and it is engineered for especially with characters needed for one or more or the member of the gene regulation containing the disclosure The transgenic event of part, and can trim or cultivate by any method known to those skilled in the art.

The method of express transgenic

In one embodiment, it includes making comprising operationally connecting that at least one transgene method is expressed in plant It is connected to the plant growth of the 3 '-UTR of -3 gene of rice ubiquitin of at least one transgenosis or poly joint sequence.In an embodiment party In case, 3 ' UTR of -3 gene of rice ubiquitin has by the sequence selected from SEQ ID NO:1 or with the sequence selected from SEQ ID NO:1 80%, the sequence composition of 85%, 90%, 95% or 99.5% sequence identity.In one embodiment, it is expressed in plant At least one transgene method includes making comprising -3 gene promoter of rice ubiquitin and being operably coupled at least one turn The plant growth of the 3 ' UTR of -3 gene of rice ubiquitin of gene.In one embodiment, the table in plant tissue or plant cell It include rice ubiquitin -3 base of the culture comprising being operably coupled at least one transgenosis up at least one transgene method Because of the plant tissue or plant cell of 3 ' UTR.

In one embodiment, it includes making to operate comprising containing that at least one transgene method is expressed in plant Ground is connected to the plant growth of the expression casette of the 3 ' UTR of -3 gene of rice ubiquitin of at least one transgenosis.Implement at one In scheme, 3 ' UTR of -3 gene of rice ubiquitin has by the sequence selected from SEQ ID NO:1 or with the sequence selected from SEQ ID NO:1 It is made of the sequence of 80%, 85%, 90%, 95% or 99.5% sequence identity.In one embodiment, the table in plant It include making the plant growth comprising expression casette up at least one transgene method, which includes that rice is general Plain -3 gene promoters and the 3 ' UTR of -3 gene of rice ubiquitin for being operably coupled at least one transgenosis.Implement at one In scheme, it includes making to be operably coupled at least one turn comprising containing that at least one transgene method is expressed in plant The plant growth of the expression casette of the 3 ' UTR of -3 gene of rice ubiquitin of gene.In one embodiment, in plant tissue or It includes the plant tissue or plant cell that culture includes expression casette that at least one transgene method is expressed in plant cell, The plant tissue or plant cell include the 3 ' UTR of -3 gene of rice ubiquitin for being operably coupled at least one transgenosis.? In one embodiment, it includes that culture includes gene that at least one transgene method is expressed in plant tissue or plant cell Expression cassette, -3 gene promoter of rice ubiquitin and -3 gene 3 ' of rice ubiquitin for being operably coupled at least one transgenosis The plant tissue or plant cell of UTR.

Following embodiment is provided to illustrate certain specific features and/or embodiment.The embodiment is understood not to By the disclosure be confined to illustrated by specific features or embodiment.

Embodiment

Embodiment 1: the new design of the combination of the Optimum Regulation element from -3 gene of rice ubiquitin

The gene specific downstream polynucleotide sequence of referred to as 3 ' non-translational regions (3 ' UTR) is usually multi-functional in vivo 's.RNA processing and the mature post-transcriptional control for having been considered as eukaryotic gene expression critical control point (Szostak and Gebauer, 2012；Wilusz and Spector, 2010；Barrett et al., 2012；And Moore, 2005).These polynucleotides Sequence can influence core output rating, subcellular localization, transcript stability and translation.In addition, 3 ' UTR are for by small non-coding The crucial target spot of RNA control.Although many mechanism down-regulation of gene expression in these mechanism, such adjusting can also be used for turn Record object efficiently locates particular cell types, for stable accumulation and subsequent gene expression (Patel et al., 2006).Root According to -3 promoter of rice ubiquitin or with other known to the associated adjacent chromosome sequence of promoter assessment, identification is simultaneously 1001bp 3 ' UTR polynucleotide sequence (SEQ ID NO:1) of the separation for heterologous coding sequence's expression.

SEQ ID NO:1；gcgtgtgctgtggtgcagcattggacttcattatacctatgccgctcgtctgtcat atcatcgtgtcatggttgtgttgtgttctggtttagagtccctaagttgtgttgatactattatccatactagtac aatttgcttcactgtgcatcggtaccaatcgatgatattatcattctacttctgttaatgtttctgagatgtttga tccgagatgagattctgtttgtgcattgctcacatggtcgtaaccggccactgttgcgcgtgcctgttgatcaatc tgtttgcgcttgacggtttctgatgcttggaattggggtgtcgatgttggtttggttatctatcctggtatgtttg ttgatttcatgcgcatttcagtctttacggcttctgatgcttggaattctaatggtgttggttgatttcacaattg ggctggtgcggtttggtgcctaaaaaaaatgggagtacctatacatctttcgaaagattttgatgatcgtatcaca cagattttgatgatcgtatcacacagatttttaatctttgaattaaaatccgatagatataataaaaagtaaaaag taattaagaaacaccataatggacactaaattaccatatcctcgagaaaaagaccaaatccaataaaaaagaaaaa gaccaaatccaatacaaaatttaaaatttacatgcgaagattcaaaaattacagtgtaacttacaaaagttacaat gtaagtttcataaattacactgtaacttacaagaaaatgcactgtaaatttaagtgagaaaatcgagtgagagata agaaaaaatctttcgagtgagatatagcaaaattgaaaaaaaattggtttgggcccaaaaatggttgagggcccat tcggccattccccaatcccaaccatcgcgtcctactccagccgccgctgccacccacgtccgtcggcgccatggcc gccgccaaggagctccttcgccggctccagcga

Embodiment 2: vector construction (pDAB116099)

PDAB116099 carrier is constructed so that the Combination nova for flanking the regulation polynucleotide sequence of transgenosis to be incorporated to.Carrier structure It builds body pDAB116099 and contains expression casette, wherein cry34Ab1 transgenosis (reporter gene from bacillus thuringiensis) By -3 gene promoter of rice ubiquitin (- 3 promoter of rice ubiquitin of SEQ ID NO:2；Sivamani E,Qu R,(2006), Plant Mol Biol 60:225-239) driving, and flank the 3 ' UTR of-3 gene of rice ubiquitin of SEQ ID NO:1 (ZMEXP18544.1).The diagram of the expression casette is as shown in Figure 1, and with SEQ ID NO:3 offer.The carrier also contains Selected marker's expression cassette, the expression cassette contain by 1 promoter of maize ubiquitin (Zm Ubi1 promoter；Christensen Et al., (1992) Plant Molecular Biology 18；It 675-689) drives and by 3 ' UTR (Zm of maize lipase Lip 3'UTR；U.S. Patent number 7,179,902) sealing end aad-1 transgenosis (AAD-1；U.S. Patent number 7,838,733).It should The diagram of expression casette is as shown in Figure 1, and with SEQ ID NO:4 offer.The construct constructs in the following manner: synthesis Newly-designed 3 ' UTR (ZMEXP18544.1) from -3 gene of rice ubiquitin simultaneously clones promoter into GeneArt Seamless Cloning^TM(Life Technologies) entry vector (WO2014018512).Resulting entry vector includes 3 ' the UTR of -3 gene of rice ubiquitin of cry34Ab1 transgenosis is terminated, and uses Gateway^TMCloning system (Life Technologies) it is integrated into purpose carrier, and electroporation is to Agrobacterium tumefaciens strain DAt13192 (International Patent Publication No. WO2012016222 in).Obtain the clone of gained binary plasmid pDAB116099, and isolated plasmid dna and by restricted Enzyme cutting digestion and sequencing are confirmed.Resulting construct contains the combination of the controlling element of driving transgenosis constitutive expression.

Negative control construct pDAB113121 is assembled, it includes yellow fluorescence protein (PhiYFP；Shagin et al., (2004)Mol Biol Evol 21；841-50) reporter gene rather than cry34Ab1 gene (Fig. 2) and include maize ubiquitin 1 Promoter (ZmUbi1 promoter) and 3 ' UTR of potato proteinase inhibitor-II (3 ' UTR of StPinII；An et al., (1989) Plant Cell 1；115-22) controlling element.There are identical aad-1 expression cassettes with pDAB116099.Using with The control construct is transformed into plant by the identical reagent of pDAB116099 and scheme.

Embodiment 3: maize conversion

The conversion of Agrobacterium tumefaciems

Binary expression vector is converted (international special to Agrobacterium tumefaciens strain DAt13192 (RecA deficiency ternary bacterial strain) Sharp publication number WO2012016222).Selecting bacteria bacterium colony, separating binary Plasmid DNA are simultaneously confirmed by restriction Enzyme digestion.

Agrobacterium culture starting

By the Agrobacterium culture from glycerol stocks line AB minimal medium (Gelvin, S., 2006, Agrobacterium Virulence Gene Induction is loaded in Wang, and K. is compiled, Agrobacterium Protocols, The second edition, volume 1, Humana Press, page 79；Use the 5g/L glucose and 15g/L Bacto of no sucrose^TMAgar system It is standby) on and at 20 DEG C dark place incubate 3 days.Then by Agrobacterium culture line YEP culture medium flat plate (Gelvin, S., 2006, Agrobacterium Virulence Gene Induction is loaded in Wang, and K. is compiled, Agrobacterium Protocols, the second edition, volume 1, Humana Press, page 79) on and at 20 DEG C dark place incubate 1 day.

In experimental day, prepare volume be suitable for experimental size inoculation medium (2.2g/L MS salt, 68.4g/L sucrose, 36g/L glucose, 115mg/L L-PROLINE, 2mg/L glycine, 100mg/L inositol, 0.05mg/L niacin, 0.5mg/L pyrrole are trembled Alcohol hydrochloride, 0.5mg/L thiamine hydrochloride) and acetosyringone mixture.The 1M acetyl fourth of 100% dimethyl sulfoxide will be dissolved in Inoculation medium is added in ketone musk stock solution, and final concentration of 200 μM of acetosyringone is made.

For each construct, it is sterile primary that the Agrobacterium from YEP plate of 1-2 oese is suspended in 50ml Property centrifuge tube in 15ml inoculation medium/acetosyringone mixture in, and in light splitting luminance meter measure solution exist Optical density (OD) (O.D. under 600nm₆₀₀).Then using other inoculation medium/acetosyringone mixture that suspension is dilute It releases to 0.25-0.35O.D.₆₀₀.Then it is being set as about 75rpm, room using preceding be placed horizontally at Agrobacterium suspension liquid pipe 1 to 4 hour on platform shaker under temperature.

Maize conversion

It will be real by the conversion that the Agrobacterium of the prematurity plumule separated from inbred strais maize culture kind B104 mediates Construct is tested to convert into maize.Method used is similar to Ishida et al., (1996) Nature Biotechnol 14: 745-750 and Frame et al., (2006) Plant Cell Rep 25:1024-1034 those disclosed method, but there is many Modification and improvement are so that this method is able to carry out high-throughput conversion.Method for generating multiple transgenic events in maize Example provided in U.S. Patent Application Publication No. US 2013/0157369A1, this method from plumule infect and co-culture step It is rapid to start.

Embodiment 4: in T₀When copy number molecule confirmation

The transgenic maize plant of presumption is sampled, in the V2-3 leaf stage to use cry34Ab1 and AAD-1 quantitative PCR to survey The fixed presence to analyze transgenosis.It is used according to the explanation of manufacturerDNA extraction kit (Qiagen) from 4 blade punching sample extraction total DNAs.

In order to detect gene of interest, the fluorescence probe and needle marked containing the FAM for cry34Ab1 gene is used To endogenous invertase with reference to the HEX of the genetic contrast fluorescence probe markedPrimer/probe groups expand base Because of DNA fragment specific.Following primer refers to gene magnification for cry34Ab1 and invertase endogenous.

Cry34Ab1 primer/probe:

Forward primer: TQ.8v6.1.F:GCCATACCCTCCAGTTG (SEQ ID NO:6)

Reverse primer: TQ.8v6.1.R:GCCGTTGATGGAGTAGTAGATGG (SEQ ID NO:7)

Probe: TQ.8v6.1.MGB.P:5 ' -/56-FAM/CCGAATCCAACGGCTTCA/MGB (SEQ ID NO:8)

Invertase primer:

Forward primer: invertase F:TGGCGGACGACGACTTGT (SEQ ID NO:9)

Reverse primer: invertase R:AAAGTTTGGAGGCTGCCGT (SEQ ID NO:10)

Convert enzyme probe: 5 ' -/5HEX/CGAGCAGACCGCCGTGTACTT/3BHQ_1/-3 ' (SEQ ID NO:11)

Next, PCR reaction carries out in the reaction system that final volume is 10 μ l, the reaction system includes 5 μ l's Roche 480 probe main mixtures (Roche Applied Sciences, Indianapolis, IN), Every kind TQ.8v6.1.F, TQ.8v6.1.R, invertase F and invertase R primer of the 0.4 μ L from 10 μM of stock solutions are to 400nM's Every kind of TQ.8v6.1.MGB.P from 5 μM of stock solutions of ultimate density, 0.4 μ L and conversion enzyme probe to 200nM ultimate density, The genomic DNA and 0.5 μ of the ultimate density of the polyvinylpyrrolidone (PVP) to 0.1% of 0.1 μ l 10%, 2 μ l 10ng/ μ l The water of l.DNA is in RocheIt is expanded under the following conditions in 480 systems: 95 DEG C of 10 minutes 1 circulations； 40 of 3 steps circulations below: 95 DEG C 10 seconds, 58 DEG C 35 seconds and 72 DEG C 1 second；And 4 DEG C of 10 seconds final circulations. Cry34Ab1 copy number by comparing unknown sample target (gene of interest)/reference (invertase gene) value (by480 outputs) target/reference value for compareing with cry34Ab1 copy number determines.

As above for described in cry34Ab1 gene, the detection of AAD-1 gene is carried out with reference to gene using invertase endogenous. AAD-1 primer sequence is as follows；

AAD1 forward primer: TGTTCGGTTCCCTCTACCAA (SEQ ID NO:12)

AAD1 reverse primer: CAACATCCATCACCTTGACTGA (SEQ ID NO:13)

AAD1 probe: 5 '-FAM/CACAGAACCGTCGCTTCAGCAACA-MGB/BHQ-3 ' (SEQ ID NO:14)

Finally, sampling contains the T of gene of interest in V4-5₀Plant is to carry out cry34Ab1 and AAD-1 leaf ELISA survey It is fixed.Acquire four leaf punching samples.Another group of plant is sampled in V4-5, the entire root quality for protein ELISA measurement. Leaf and root Cry34Ab1 (Agdia, Inc., Elkart, IN) and AAD1 (Acadia BioScience) ELISA measurement are according to system Quotient is made to illustrate to carry out.Cry34Ab1ELISA measurement result is expressed as part (or albumen ng of the total vegetable protein of every mg in parts per million Number).Illustrate to carry out total radixin measurement according to manufacturer with Bradford detection method.

T₀Plant is selfed and hybridizes with maize culture mutation B104 non-transgenic transformation system to obtain T₁Seed.In order to carry out T₁Albumen research promotes five to six transgenosis systems of each test controlling element construct or event.Therefore, sowing is each The 30-40 grain T of event₁Seed；It is used in the V2-3 stage of developmentSeedling is sprayed to kill non-transgenic segregant.

Embodiment 5: the molecule confirmation of protein accumulation

Next, as follows multiple plant developing stages to genetically modified plants sample with for Cry34Ab1 (Agdia, Inc.；Catalog number (Cat.No.) 04500/4800) and AAD-1 (Envirologix；Catalog number (Cat.No.) 11638) ELISA: leaf (V4, V12 and R3) and Root (V4).It will separate in a organized way in the pipe being placed in insertion dry ice；It is then transferred to -80 DEG C.By the freezing group outside disleaf Freeze-drying is knitted, protein is then extracted and is used for ELISA.

In V4, V12 and R3 to the transgenosis T of the presumption comprising cry34Ab1 and aad-1 transgenosis₁Plant samples to be used for Leaf ELISA measurement.Acquire four leaf punching samples.Leaf punching sample is placed in pipe, by single 1/8 inch of stainless steel bead (Hoover Precision Products, Cumming, GA, USA) is added to extracting containing 300 μ l for every 1.2ml and buffers In the pipe of liquid (PBST for being supplemented with 0.5mM ETDA and 1.0mM DTT).By sample in Genogrinder^TM(SPEX SamplePrep, Metuchen, NJ) in 1,500rpm processing 4 minutes.By sample in Sorvall Legend XFR^TMCentrifugation With 4,000rpm centrifugation 2 minutes in machine.Then, additional 300 μ l Extraction buffer is added, and by sample in Genogrinder^TMIn It is reprocessed 2 minutes at 1,500rpm.By sample with 4,000rpm centrifugation 7 minutes.Finally, collecting supernatant, and using commercially available Cry34Ab1 (Agdia, Inc.) and AAD-1 (Envirologiz, Inc.) ELISA assay kit are according to Dow The scheme of AgroSciences exploitation completes ELISA measurement together with Protein standards under different dilutions.By existing In the case where eight 0.25 inch of ceramic beads (MP Biomedicals, USA, catalog number (Cat.No.) 6540-422) in paint shaker The tissue grinder 30 seconds of freeze-drying is subjected to the Protein Extraction for being used for various organization type ELISA.For needing further to grind The tissue of mill repeats grinding steps 30 seconds.Pomegranate mountain flour is added in 2ml pipe to cover the bending part of bottom of the tube.It will Rough lapping tissue is transferred in 2ml pipe, and is filled into 0.5ml graduation mark.One Ceramic Balls is added in every root canal, is added simultaneously 0.6ml extracting section buffer PBST (is supplemented with 5mM EDTA, 5mM DTT and 1% plant protease inhibitor mixture).It will All pipes are kept for 10 minutes on ice.Cold pipe is transferred to2ml pipe support in.Sample is ground 45 seconds. Then, by 40 μ l 10%- 20 and 300 μ l Extraction buffers are added in sample.Sample is ground again 45 seconds, Between cooling 5 minutes.Finally, by each sample with 13,000rpm centrifugation 7 minutes, and supernatant is carefully transferred to new pipe with Collect extract.Dilution extract for the ELISA of leaf texture as needed to measure.Similar measurement is used for other plant Tissue.

Embodiment 6: it is operably coupled to express spectra of the gene of -3 controlling element of rice ubiquitin in crop plants

3 ' the UTR controlling element of -3 gene of rice ubiquitin of the SEQ ID NO:1 as provided in pDAB116099 results in Constitutive expression of the cry34Ab1 gene in maize transgenic event.Table 1 summarizes cry34Ab1 gene in various tissues In type and the different stages of development steady expression.In the plant thing converted with negative control construct pDAB113121 In part almost without observe or detect Cry34Ab1 leaf expression.This construct pDAB113121 is free of cry34Ab1 transgenosis. All constructs express aad-1 gene in the tissue of measurement.

Table 1. is depicted in Cry34Ab1 the and AAD-1 egg generated in various types of maize tissues by transgene expression The ELISA result of white matter level.Indicated sample is obtained from the organization type of T1 genetically modified plants.

Therefore, it identifies and characterizes 3 ' UTR gene regulatory elements of -3 gene of novel rice ubiquitin (SEQ ID NO:1).The Once disclose novel 3 ' the UTR controlling element for gene expression construct.

Embodiment 7: it is operably coupled to the conversion that the Agrobacterium of the gene of 3 ' UTR of -3 gene of rice ubiquitin mediates

It is identical described in the embodiment #11 or embodiment #13 of patent application WO 2007/053482 before Technology, with the genetic transformation soybean for being operably coupled to 3 ' UTR of -3 gene of rice ubiquitin.

In the embodiment #14 or patent application WO 2007/053482 of U.S. Patent number 7,838,733 before Same technique described in the embodiment #12 of (Wright et al.), with being operably coupled to 3 ' UTR's of -3 gene of rice ubiquitin Genetic transformation cotton.

In the embodiment #26 or patent application WO 2007/053482 of U.S. Patent number 7,838,733 before Same technique described in the embodiment #22 of (Wright et al.), with being operably coupled to 3 ' UTR's of -3 gene of rice ubiquitin Genetic transformation mustard.

It is identical described in the embodiment #23 of patent application WO 2013/116700A1 (Lira et al.) before Technology, with the genetic transformation wheat for being operably coupled to 3 ' UTR of -3 gene of rice ubiquitin.

It is identical described in the embodiment #19 of patent application WO 2013/116700A1 (Lira et al.) before Technology, with the genetic transformation rice for being operably coupled to 3 ' UTR of -3 gene of rice ubiquitin.

Embodiment 8: it is operably coupled to turn that the Agrobacterium of the gene of -3 gene regulatory elements of rice ubiquitin mediates Change

According to the disclosure, crop in addition can be turned according to the embodiment of the disclosure using techniques known in the art Change.About the rye conversion that Agrobacterium mediates, see, for example, Popelka JC, Xu J, Altpeter F., " Generation of rye with low transgene copy number after biolistic gene transfer and production of(Secale cereale L.)plants instantly marker-free transgenic rye,” Transgenic Res.2003 October；12(5):587-96.The sorghum mediated about Agrobacterium converts, see, for example, Zhao et al., " Agrobacterium-mediated sorghum transformation, " Plant Mol Biol.2000 December in year；44(6):789-98.About the Barley transformation that Agrobacterium mediates, see, for example, Tingay et al., “Agrobacterium tumefaciens-mediated barley transformation,”The Plant Journal, (1997)11:1369–1376.About the Wheat Transformation that Agrobacterium mediates, see, for example, Cheng et al., " Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens,”Plant Physiol.1997 November；115(3):971-980.About the rice conversion that Agrobacterium mediates, see, for example, Hiei et al., “Transformation of rice mediated by Agrobacterium tumefaciens,”Plant Mol.Biol.1997 September；35(1-2):205-18.

The latin name of these and other plants is given below.It should be understood that other (Non Agrobacteriums) can be used to convert Technology will for example be operably coupled to the genetic transformation of 3 ' UTR of -3 gene of rice ubiquitin into these and other plants.It is real Example include but is not limited to: maize (corn), wheat (Triticum (Triticum spp.)), rice (Oryza (Oryza spp.) and Wild rice category (Zizania spp.)), barley (Hordeum (Hordeum spp.)), cotton (water fiber crops (Abroma augusta) and cotton Belong to (Gossypium spp.)), soybean (soybean (Glycine max)), sugar and table beet (Beta (Beta spp.)), (tomato (Lycopersicon esculentum) and other kinds glue for sugarcane (gomuti palm (Arenga pinnata)), tomato Tartaric acid starches (Physalis ixocarpa), yellow water eggplant (Solanum incanum) and other kinds and tree tomato (Cyphomandra betacea)), potato (potato (Solanum tuberosum)), sweet potato (sweet potato (Ipomoea Batatas)), rye (Secale (Secale spp.)), pepper (pimento (Capsicum annuum), Chinese Capsicum (Capsicum chinense) and millet starch (Capsicum frutescens)), lettuce (lettuce (Lactuca sativa), Fireweed (Lactuca perennis) and blue lettuce (Lactuca pulchella)), Brussels sprouts (Btassica (Brassica Spp.)), celery (celery (Apium graveolens)), eggplant (eggplant (Solanum melongena)), peanut (peanut (Arachis hypogea)), sorghum (sorghum (Sorghum spp.)), clover (alfalfa (Medicago Sativa)), carrot (cicely (Daucus carota)), Kidney bean (Phaseolus (Phaseolus spp.) and other Belong to), oat (oat (Avena sativa) and Mao Yanmai (Avena strigosa)), pea (Pisum (Pisum), cowpea Belong to (Vigna) and wing pod Pisum (Tetragonolobus spp.)), sunflower (sunflower (Helianthus Annuus)), pumpkin (Cucurbita (Cucurbita spp.)), cucumber (cucumber (Cucumis sativa)), tobacco (Nicotiana (Nicotiana spp.)), Arabidopsis (arabidopsis), (Lolium (Lolium) cuts chain grain husk category to sod grass (Agrostis), Poa L. (Poa), Cynodon (Cynodon) and other category), clover (Clover (Trifolium)), vetch (Vetch (Vicia)).For example, being contemplated in the embodiment of the disclosure with can operate Ground is connected to the such plant of genetic transformation of 3 ' UTR of -3 gene of rice ubiquitin.

Terminated using 3 ' UTR of -3 gene of rice ubiquitin the gene being operably connected can be used for many deciduous trees and often Blueness tree species.Such application is also in the range of disclosure embodiment.These species include but is not limited to: alder (Alnus (Alnus spp.)), ash wood (Chinese wax Pterostyrax (Fraxinus spp.)), aspen and white poplar species (white poplar category (Populus Spp.)), beech (beech (Fagus spp.)), birch (Betula (Betula spp.)), cherry (Prunus (Prunus spp.)), eucalyptus (eucalyptus category (Eucalyptus spp.)), Hickory (hickory (Carya spp.)), maple Set (Acer (Acer spp.)), Oak Tree (oak category (Quercus spp.)) and pine tree (Pinus (Pinus spp.)).

The gene being operably connected is terminated using 3 ' UTR of -3 gene of rice ubiquitin can be used for ornamental and fruiting tree Kind.Such application is also in the range of disclosure embodiment.Example includes but is not limited to: rose (Rosa (Rosa Spp.)), purple winged euonymus (Euonymus (Euonymus spp.)), petunia (Petunia (Petunia spp.)), begonia (autumn Malus spectabilis category (Begonia spp.)), azalea (Rhododendron (Rhododendron spp.)), calophyllum inophyllum or apple (Malus (Malus spp.)), pears (pear (Pyrus spp.)), peach (Prunus (Prunus spp.)) and pot marigold (Tagetes (Tagetes spp.))。

Although discussed above is multiple illustrative aspects and embodiments, those skilled in the art will recognize that they Certain modifications, arrangement, addition and sub-portfolio.Therefore, it is contemplated that following appended claims and the claim introduced later It should be interpreted that including all such modifications, arrangement, addition and the sub-portfolio in its true spirit and range.

Sequence table

<110> Dow AgroSciences, LLC.

Gupta, Manju

Beringer, Jeff

Marri, Pradeep

Sardesai, Nagesh

<120>plant promoter and 3 ' UTR of transgene expression are used for

<130> 77898

<160> 5

<170>PatentIn 3.5 editions

<210> 1

<211> 1001

<212> DNA

<213>rice

<400> 1

gcgtgtgctg tggtgcagca ttggacttca ttatacctat gccgctcgtc tgtcatatca 60

tcgtgtcatg gttgtgttgt gttctggttt agagtcccta agttgtgttg atactattat 120

ccatactagt acaatttgct tcactgtgca tcggtaccaa tcgatgatat tatcattcta 180

cttctgttaa tgtttctgag atgtttgatc cgagatgaga ttctgtttgt gcattgctca 240

catggtcgta accggccact gttgcgcgtg cctgttgatc aatctgtttg cgcttgacgg 300

tttctgatgc ttggaattgg ggtgtcgatg ttggtttggt tatctatcct ggtatgtttg 360

ttgatttcat gcgcatttca gtctttacgg cttctgatgc ttggaattct aatggtgttg 420

gttgatttca caattgggct ggtgcggttt ggtgcctaaa aaaaatggga gtacctatac 480

atctttcgaa agattttgat gatcgtatca cacagatttt gatgatcgta tcacacagat 540

ttttaatctt tgaattaaaa tccgatagat ataataaaaa gtaaaaagta attaagaaac 600

accataatgg acactaaatt accatatcct cgagaaaaag accaaatcca ataaaaaaga 660

aaaagaccaa atccaataca aaatttaaaa tttacatgcg aagattcaaa aattacagtg 720

taacttacaa aagttacaat gtaagtttca taaattacac tgtaacttac aagaaaatgc 780

actgtaaatt taagtgagaa aatcgagtga gagataagaa aaaatctttc gagtgagata 840

tagcaaaatt gaaaaaaaat tggtttgggc ccaaaaatgg ttgagggccc attcggccat 900

tccccaatcc caaccatcgc gtcctactcc agccgccgct gccacccacg tccgtcggcg 960

ccatggccgc cgccaaggag ctccttcgcc ggctccagcg a 1001

<210> 2

<211> 1990

<212> DNA

<213>rice

<400> 2

gatgtgaaga acaggtaaat cacgcagaag aacccatctc tgatagcagc tatcgattag 60

aacaacgaat ccatattggg tccgtgggaa atacttactg cacaggaagg gggcgatctg 120

acgaggcccc gccaccggcc tcgacccgag gccgaggccg acgaagcgcc ggcgagtacg 180

gcgccgcggc ggcctctgcc cgtgccctct gcgcgtggga gggagaggcc gcggtggtgg 240

gggcgcgcgc gcgcgcgcgc gcagctggtg cggcggcgcg ggggtcagcc gccgagccgg 300

cggcgacgga ggagcagggc ggcgtggacg cgaacttccg atcggttggt cagagtgcgc 360

gagttgggct tagccaatta ggtctcaaca atctattggg ccgtaaaatt catgggccct 420

ggtttgtcta ggcccaatat cccgttcatt tcagcccaca aatatttccc cagaggatta 480

ttaaggccca cacgcagctt atagcagatc aagtacgatg tttcctgatc gttggatcgg 540

aaacgtacgg tcttgatcag gcatgccgac ttcgtcaaag agaggcggca tgacctgacg 600

cggagttggt tccgggcacc gtctggatgg tcgtaccggg accggacacg tgtcgcgcct 660

ccaactacat ggacacgtgt ggtgctgcca ttgggccgta cgcgtggcgg tgaccgcacc 720

ggatgctgcc tcgcaccgcc ttgcccacgc tttatataga gaggttttct ctccattaat 780

cgcatagcga gtcgaatcga ccgaagggga gggggagcga agctttgcgt tctctaatcg 840

cctcgtcaag gtaactaatc aatcacctcg tcctaatcct cgaatctctc gtggtgcccg 900

tctaatctcg cgattttgat gctcgtggtg gaaagcgtag gaggatcccg tgcgagttag 960

tctcaatctc tcagggtttc gtgcgatttt agggtgatcc acctcttaat cgagttacgg 1020

tttcgtgcga ttttagggta atcctcttaa tctctcattg atttagggtt tcgtgagaat 1080

cgaggtaggg atctgtgtta tttatatcga tctaatagat ggattggttt tgagattgtt 1140

ctgtcagatg gggattgttt cgatatatta ccctaatgat gtgtcagatg gggattgttt 1200

cgatatatta ccctaatgat gtgtcagatg gggattgttt cgatatatta ccctaatgat 1260

ggataataag agtagttcac agttatgttt tgatcctgcc acatagtttg agttttgtga 1320

tcagatttag tttcacttat ttgtgcttag ttcggatggg attgttctga tattgttcca 1380

atagatgaat agctcgttag gttaaaatct ttaggttgag ttaggcgaca catagtttat 1440

ttcctctgga tttggattgg aattgtgttc ttagtttttt tcccctggat ttggattgga 1500

attgtgtgga gctgggttag agaattacat ctgtatcgtg tacacctact tgaactgtag 1560

agcttgggtt ctaaggtcaa tttaatctgt attgtatctg gctctttgcc tagttgaact 1620

gtagtgctga tgttgtactg tgttttttta cccgttttat ttgctttact cgtgcaaatc 1680

aaatctgtca gatgctagaa ctaggtggct ttattctgtg ttcttacata gatctgttgt 1740

cctgtagtta cttatgtcag ttttgttatt atctgaagat atttttggtt gttgcttgtt 1800

gatgtggtgt gagctgtgag cagcgctctt atgattaatg atgctgtcca attgtagtgt 1860

aatatgatgt gattgatatg ttcatctatt ttgagctgac agtaccgata tcgtaggatc 1920

tggtgccaac ttattctcca gctgcttttt tttacctatg ttaattccaa tcctttcttg 1980

cctcttccag 1990

<210> 3

<211> 3431

<212> DNA

<213>artificial sequence

<220>

<223>expression casette (pDAB116099)

<400> 3

gatgtgaaga acaggtaaat cacgcagaag aacccatctc tgatagcagc tatcgattag 60

aacaacgaat ccatattggg tccgtgggaa atacttactg cacaggaagg gggcgatctg 120

acgaggcccc gccaccggcc tcgacccgag gccgaggccg acgaagcgcc ggcgagtacg 180

gcgccgcggc ggcctctgcc cgtgccctct gcgcgtggga gggagaggcc gcggtggtgg 240

gggcgcgcgc gcgcgcgcgc gcagctggtg cggcggcgcg ggggtcagcc gccgagccgg 300

cggcgacgga ggagcagggc ggcgtggacg cgaacttccg atcggttggt cagagtgcgc 360

gagttgggct tagccaatta ggtctcaaca atctattggg ccgtaaaatt catgggccct 420

ggtttgtcta ggcccaatat cccgttcatt tcagcccaca aatatttccc cagaggatta 480

ttaaggccca cacgcagctt atagcagatc aagtacgatg tttcctgatc gttggatcgg 540

aaacgtacgg tcttgatcag gcatgccgac ttcgtcaaag agaggcggca tgacctgacg 600

cggagttggt tccgggcacc gtctggatgg tcgtaccggg accggacacg tgtcgcgcct 660

ccaactacat ggacacgtgt ggtgctgcca ttgggccgta cgcgtggcgg tgaccgcacc 720

ggatgctgcc tcgcaccgcc ttgcccacgc tttatataga gaggttttct ctccattaat 780

cgcatagcga gtcgaatcga ccgaagggga gggggagcga agctttgcgt tctctaatcg 840

cctcgtcaag gtaactaatc aatcacctcg tcctaatcct cgaatctctc gtggtgcccg 900

tctaatctcg cgattttgat gctcgtggtg gaaagcgtag gaggatcccg tgcgagttag 960

tctcaatctc tcagggtttc gtgcgatttt agggtgatcc acctcttaat cgagttacgg 1020

tttcgtgcga ttttagggta atcctcttaa tctctcattg atttagggtt tcgtgagaat 1080

cgaggtaggg atctgtgtta tttatatcga tctaatagat ggattggttt tgagattgtt 1140

ctgtcagatg gggattgttt cgatatatta ccctaatgat gtgtcagatg gggattgttt 1200

cgatatatta ccctaatgat gtgtcagatg gggattgttt cgatatatta ccctaatgat 1260

ggataataag agtagttcac agttatgttt tgatcctgcc acatagtttg agttttgtga 1320

tcagatttag tttcacttat ttgtgcttag ttcggatggg attgttctga tattgttcca 1380

atagatgaat agctcgttag gttaaaatct ttaggttgag ttaggcgaca catagtttat 1440

ttcctctgga tttggattgg aattgtgttc ttagtttttt tcccctggat ttggattgga 1500

attgtgtgga gctgggttag agaattacat ctgtatcgtg tacacctact tgaactgtag 1560

agcttgggtt ctaaggtcaa tttaatctgt attgtatctg gctctttgcc tagttgaact 1620

gtagtgctga tgttgtactg tgttttttta cccgttttat ttgctttact cgtgcaaatc 1680

aaatctgtca gatgctagaa ctaggtggct ttattctgtg ttcttacata gatctgttgt 1740

cctgtagtta cttatgtcag ttttgttatt atctgaagat atttttggtt gttgcttgtt 1800

gatgtggtgt gagctgtgag cagcgctctt atgattaatg atgctgtcca attgtagtgt 1860

aatatgatgt gattgatatg ttcatctatt ttgagctgac agtaccgata tcgtaggatc 1920

tggtgccaac ttattctcca gctgcttttt tttacctatg ttaattccaa tcctttcttg 1980

cctcttccag caggtacagt agttagttga ggtaccggat ccagaagaca ccatgtccgc 2040

ccgcgaggtg cacatcgacg tgaacaacaa gaccggccac accctccagc tggaggacaa 2100

gaccaagctc gacggcggca ggtggcgcac ctccccgacc aacgtggcca acgaccagat 2160

caagaccttc gtggccgaat ccaacggctt catgaccggc accgagggca ccatctacta 2220

ctccatcaac ggcgaggccg agatcagcct ctacttcgac aacccgttcg ccggctccaa 2280

caaatacgac ggccactcca acaagtccca gtacgagatc atcacccagg gcggctccgg 2340

caaccagtcc cacgtgacct acaccatcca gaccacctcc tcccgctacg gccacaagtc 2400

ctgagtagtt agcttaatca cctagagctc gcgtgtgctg tggtgcagca ttggacttca 2460

ttatacctat gccgctcgtc tgtcatatca tcgtgtcatg gttgtgttgt gttctggttt 2520

agagtcccta agttgtgttg atactattat ccatactagt acaatttgct tcactgtgca 2580

tcggtaccaa tcgatgatat tatcattcta cttctgttaa tgtttctgag atgtttgatc 2640

cgagatgaga ttctgtttgt gcattgctca catggtcgta accggccact gttgcgcgtg 2700

cctgttgatc aatctgtttg cgcttgacgg tttctgatgc ttggaattgg ggtgtcgatg 2760

ttggtttggt tatctatcct ggtatgtttg ttgatttcat gcgcatttca gtctttacgg 2820

cttctgatgc ttggaattct aatggtgttg gttgatttca caattgggct ggtgcggttt 2880

ggtgcctaaa aaaaatggga gtacctatac atctttcgaa agattttgat gatcgtatca 2940

cacagatttt gatgatcgta tcacacagat ttttaatctt tgaattaaaa tccgatagat 3000

ataataaaaa gtaaaaagta attaagaaac accataatgg acactaaatt accatatcct 3060

cgagaaaaag accaaatcca ataaaaaaga aaaagaccaa atccaataca aaatttaaaa 3120

tttacatgcg aagattcaaa aattacagtg taacttacaa aagttacaat gtaagtttca 3180

taaattacac tgtaacttac aagaaaatgc actgtaaatt taagtgagaa aatcgagtga 3240

gagataagaa aaaatctttc gagtgagata tagcaaaatt gaaaaaaaat tggtttgggc 3300

ccaaaaatgg ttgagggccc attcggccat tccccaatcc caaccatcgc gtcctactcc 3360

agccgccgct gccacccacg tccgtcggcg ccatggccgc cgccaaggag ctccttcgcc 3420

ggctccagcg a 3431

<210> 4

<211> 3307

<212> DNA

<213>artificial sequence

<220>

<223>expression casette

<400> 4

gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 60

taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 120

atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 180

gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 240

ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 300

caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 360

gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 420

ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaatagttt agatataaaa 480

tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540

aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 600

ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 660

cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 720

ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 780

gcggcctcct cctcctctca cggcaccggc agctacgggg gattcctttc ccaccgctcc 840

ttcgctttcc cttcctcgcc cgccgtaata aatagacacc ccctccacac cctctttccc 900

caacctcgtg ttgttcggag cgcacacaca cacaaccaga tctcccccaa atccacccgt 960

cggcacctcc gcttcaaggt acgccgctcg tcctcccccc ccccccccct ctctaccttc 1020

tctagatcgg cgttccggtc catgcatggt tagggcccgg tagttctact tctgttcatg 1080

tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac acggatgcga 1140

cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg gggaatcctg 1200

ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg tttcgttgca 1260

tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg tttgtcgggt 1320

catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt 1380

ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt ttggatctgt 1440

atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga aatatcgatc 1500

taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga tgctttttgt 1560

tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct agatcggagt 1620

agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca 1680

tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga taggtataca 1740

tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc tattcatatg 1800

ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat tatttcgatc 1860

ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt agccctgcct 1920

tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg 1980

tgttacttct gcaggtacag tagttagttg aggtaccgga tccacacgac accatggctc 2040

atgctgccct cagccctctc tcccaacgct ttgagagaat agctgtccag ccactcactg 2100

gtgtccttgg tgctgagatc actggagtgg acttgaggga accacttgat gacagcacct 2160

ggaatgagat attggatgcc ttccacactt accaagtcat ctactttcct ggccaagcaa 2220

tcaccaatga gcagcacatt gcattctcaa gaaggtttgg accagttgat ccagtgcctc 2280

ttctcaagag cattgaaggc tatccagagg ttcagatgat ccgcagagaa gccaatgagt 2340

ctggaagggt gattggtgat gactggcaca cagactccac tttccttgat gcacctccag 2400

ctgctgttgt gatgagggcc atagatgttc ctgagcatgg cggagacact gggttccttt 2460

caatgtacac agcttgggag accttgtctc caaccatgca agccaccatc gaagggctca 2520

acgttgtgca ctctgccaca cgtgtgttcg gttccctcta ccaagcacag aaccgtcgct 2580

tcagcaacac ctcagtcaag gtgatggatg ttgatgctgg tgacagagag acagtccatc 2640

ccttggttgt gactcatcct ggctctggaa ggaaaggcct ttatgtgaat caagtctact 2700

gtcagagaat tgagggcatg acagatgcag aatcaaagcc attgcttcag ttcctctatg 2760

agcatgccac cagatttgac ttcacttgcc gtgtgaggtg gaagaaagac caagtccttg 2820

tctgggacaa cttgtgcacc atgcaccgtg ctgttcctga ctatgctggc aagttcagat 2880

acttgactcg caccacagtt ggtggagtta ggcctgcccg ctgagtagtt agcttaatca 2940

cctagagctc ggtcgcagcg tgtgcgtgtc cgtcgtacgt tctggccggc cgggccttgg 3000

gcgcgcgatc agaagcgttg cgttggcgtg tgtgtgcttc tggtttgctt taattttacc 3060

aagtttgttt caaggtggat cgcgtggtca aggcccgtgt gctttaaaga cccaccggca 3120

ctggcagtga gtgttgctgc ttgtgtaggc tttggtacgt atgggcttta tttgcttctg 3180

gatgttgtgt actacttggg tttgttgaat tattatgagc agttgcgtat tgtaattcag 3240

ctgggctacc tggacattgt tatgtattaa taaatgcttt gctttcttct aaagatcttt 3300

aagtgct 3307

<210> 5

<211> 1146

<212> DNA

<213>rice

<400> 5

atgcagatat tcgttaagac cctcactggc aagaccatca ccttggaggt tgagttctcc 60

gatacgattg acaatgtgaa ggctaagatt caggacaagg agggcatccc tccggaccag 120

caacgcctta tcttcgctgg caagcagctt gaggatgggc gtactctcgc ggattataac 180

atccagaagg agtccacctt gcaccttgtc ctccgccttc gtggaggcat gcaaatattc 240

gtgaagaccc tcaccggcaa gaccattacc ctggaggtcg agtcctccga cacgatcgat 300

aatgtgaagg ccaagatcca ggacaaggag ggaatcccac cagaccagca gcgtctcatc 360

tttgctggga agcagctcga ggatggccgc acccttgcag actacaacat ccaaaaggaa 420

tccaccctgc accttgtcct gcgcctccgg ggcggtatgc agatctttgt gaagaccctt 480

actggcaaga cgatcacctt ggaggttgag tcctctgaca cgatcgacaa tgtgaaggcc 540

aagatccagg acaaggaggg tattccacca gaccagcagc ggctcatctt cgctggcaag 600

cagcttgagg acggccgcac ccttgctgac tataacatcc agaaggagtc caccttgcac 660

ttggtcctcc gccttcgtgg aggtatgcag atcttcgtga agaccctcac cggcaagacc 720

atcaccctgg aggttgagtc gtctgacacg atcgacaatg tgaaggccaa gatccaggac 780

aaggagggta ttccaccaga ccagcagcgc ctcatcttcg ctggcaagca gcttgaggat 840

ggtcgcaccc ttgcagatta caacatccag aaggagtcca ccctgcacct tgtcctgcgc 900

cttcgtggag gtatgcagat cttcgtgaag accctcactg gcaagaccat cactctggag 960

gttgagtcct ctgacaccat cgacaacgtg aaggccaaga tccaggataa ggagggcatc 1020

cctccagacc agcagcgcct catcttcgcc ggcaagcagc tcgaggatgg ccgcaccctt 1080

gccgactata acatccagaa ggagtccacc ctgcaccttg tcctgcgcct ccgtggtggt 1140

ctctga 1146

Claims (26)

1. a kind of nucleic acid carrier, it includes the 3 ' UTR for being operably coupled to following part:

A) poly connector or short polynucleotide sequence；

B) non-- 3 gene of rice ubiquitin；Or

C) combination a) and b) the, wherein 3 ' UTR includes the multicore for having at least 90% sequence identity with SEQ ID NO:1 Nucleotide sequence.

2. nucleic acid carrier according to claim 1, wherein the length of the 3 ' UTR is 1001bp.

3. nucleic acid carrier according to claim 1 the, wherein 3 ' UTR is by having at least 90% sequence with SEQ ID NO:1 The polynucleotide sequence of column identity forms.

4. nucleic acid carrier according to any one of claim 1-3 also includes the sequence of encoding selection markers.

5. nucleic acid carrier according to claim 1 the, wherein 3 ' UTR is operably coupled to transgenosis.

6. nucleic acid carrier according to claim 5, wherein the transgenes encoding assigns insecticidal resistance, herbicide tolerant Property, RNAi, miRNA, siRNA expression, nitrogen service efficiency, water service efficiency or nutritional quality selected marker or gene produce Object.

7. nucleic acid carrier described in any one of -3 or 5 according to claim 1 also includes to have at least with SEQ ID NO:2 The promoter polynucleotide sequence of 90% sequence identity connects wherein the promoter sequence is operably coupled to the poly Head or the transgenosis.

8. nucleic acid carrier described in any one of -3 or 5 according to claim 1, also includes intron sequences.

9. nucleic acid carrier according to claim 1 the, wherein 3 ' UTR has composing type or tissue specific expression.

10. a kind of plant, it includes with SEQ ID NO:1 there is at least being operably coupled to for 90% sequence identity to turn base The polynucleotide sequence of cause.

11. plant according to claim 10, wherein the plant is selected from: maize, wheat, rice, sorghum, oat, black Wheat, banana, sugarcane, soybean, cotton, Arabidopsis, tobacco, sunflower and mustard.

12. plant according to claim 10, wherein the plant is corn.

13. plant described in any one of 0-12 according to claim 1, wherein the transgenosis to be inserted into the gene of the plant In group.

14. plant according to claim 10, wherein 3 ' UTR include to have at least 90% sequence same with SEQ ID NO:1 The polynucleotide sequence of one property, and the length of the 3 ' UTR is 1001bp.

15. plant according to claim 14 also includes the promoter sequence containing SEQ ID NO:2, wherein described Promoter sequence is operably coupled to the transgenosis.

16. plant according to claim 15, wherein the transgenosis has composing type or tissue specific expression.

17. plant according to claim 15, wherein the promoter is -3 gene promoter of rice ubiquitin.

18. a kind of transgenic seed is generated by plant according to claim 10.

19. a kind of method for generating transgenic plant cells, the described method comprises the following steps:

A) plant cell is converted with expression casette, the expression casette is of interest comprising being operably coupled at least one Polynucleotide sequence 3 ' UTR of -3 gene of rice ubiquitin；

B) separation includes the transformed plant cell of the expression casette；And

C) it generates comprising -3 gene of rice ubiquitin for being operably coupled at least one polynucleotide sequence of interest The transgenic plant cells of 3 ' UTR.

20. according to the method for claim 19, wherein converting plant cell with methods for plant transformation.

21. according to the method for claim 19, wherein the polynucleotide sequence stable integration of interest is to described turn In the genome of gene plant cell.

22. according to the method for claim 19, the method also includes following steps:

D) make the transgenic plant cells regeneration genetically modified plants；And

E) genetically modified plants are obtained, wherein the genetically modified plants include expression casette, the expression casette includes Rice ubiquitin -3 gene according to claim 1 for being operably coupled at least one polynucleotide sequence of interest 3’UTR。

23. 3 ' UTR of -3 gene of rice ubiquitin according to claim 19, the 3 ' UTR of -3 gene of rice ubiquitin include SEQ The polynucleotides of ID NO:1.

24. a kind of isolated polynucleotides, it includes have at least 90% sequence identity with the polynucleotides of SEQ ID NO:1 Nucleic acid sequence.

25. isolated polynucleotides according to claim 24 also include the open reading frame multicore glycosides for encoding polypeptide Acid；And promoter sequence.

26. isolated polynucleotides according to claim 24, wherein the length of the polynucleotides of the SEQ ID NO:1 For 1001bp.