CN109666707A - Utilize method Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid and then synthesize synthesis oak moss - Google Patents
Utilize method Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid and then synthesize synthesis oak moss Download PDFInfo
- Publication number
- CN109666707A CN109666707A CN201811285482.4A CN201811285482A CN109666707A CN 109666707 A CN109666707 A CN 109666707A CN 201811285482 A CN201811285482 A CN 201811285482A CN 109666707 A CN109666707 A CN 109666707A
- Authority
- CN
- China
- Prior art keywords
- acid
- demethyl
- aspergillus terreus
- dihydroxy
- barbatic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Method Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid and then synthesize synthesis oak moss is utilized the invention discloses a kind of, it is related to new strains, microbial fermentation technology and chemosynthesis technical field, the Aspergillus terreus bacterial strain is Aspergillus terreus (Aspergillus terreus) MEFC06, Aspergillus terreus strain fermented and cultured；It isolates and purifies to obtain 4-O- demethyl barbatic acid, 4-O- demethyl barbatic acid is hydrolyzed to 2,4- dihydroxy -3,6- mesitylenic acid；Esterification reaction of organic acid is carried out using methylating reagent, 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester (synthesis oak moss) can be obtained in processing after reaction.It provides new microbial fermentation to be combined with chemical synthesis to produce the method for synthesizing oak moss, green ecological, synthetic route is short, simple process, and yield is high.
Description
Technical field
The present invention relates to new strains, microbial fermentation technology and chemosynthesis technical fields, and in particular to a kind of to utilize soil
The method that Aspergillus strain produces 4-O- demethyl barbatic acid and then synthesizes synthesis oak moss.
Background technique
Oak moss is a kind of rare Lichens Resources, refers generally to the Usneaceae Evernia being grown on Oak Tree trunk and branch
Oakmoss, oakmoss concrete and essential oil be widely used in the daily necessities such as perfume, skin care item, cigarette and stacte, meanwhile, oak moss
Also it is applied to beverage, bakery, pudding, soft sweets etc. as food additives.Natural oak moss is mainly produced in the European middle and south
With north African generation Mediterranean country, such as France, Italy.China's oak moss resource is extremely rare, only develops in Yunnan
It oak moss No. I and No. II, since lichens raw material difference makes a big difference fragrance, is used mainly as tobacco essence.
Oakmoss concrete and essential oil are as a kind of natural products product, and there are some inadequate natural endowments for market and application.Firstly,
Natural oak moss scarcity of resources, price are high.Secondly as the difference of raw material sources, extraction process makes oak moss quality different, and
And enterprise is to reduce cost to deploy product, so that market confusion.In addition, natural oakmoss concrete and essential oil are a kind of mixed
Object, complicated component are closed, part of compound has been identified as anaphylactogen, and European Union's cosmetics regulation is to these sensibiligen substances
It provides and limits using having made.Above-mentioned unfavorable factor all limits the market application of oak moss, therefore, identifies the master of natural oak moss
It in aroma compounds and to develop its production technology and receives enterprise and the concern of scientific research personnel.Research shows that dihydroxy -3 2,4-,
6- dimethylbenzoate methyl ester (1 CAS:4707-47-5) is the main note compound in oak moss, therefore the compound is referred to as conjunction
At oak moss.Chemical synthesis route about synthesis oak moss has had a document and patent report, in wherein most synthetic route all
It is that key intermediate 2,5- dimethyl resorcinol (2 CAS:488-87-9) and dihydroxy -3 2,4- are synthesized with different material,
6- mesitylenic acid (3 CAS:4707-46-4) ultimately produces 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester, prepares
Journey is as shown in Figure 1.But in actual production, the preparation process of the two key intermediates is complicated, and yield it is lower, at
This is higher, therefore is haveed the defects that in practical applications using the method for chemical method production synthesis oak moss certain, limits conjunction
At the development in oak moss market.
Summary of the invention
Method to solve the problems, such as above-mentioned chemical method production synthesis oak moss exists in practical applications, and the present invention provides
A kind of Aspergillus terreus bacterial strain of 4-O- demethyl barbatic acid (CAS:20372-89-8), the bacterial strain of generating is in fermenting and producing 4-
Application in O- demethyl barbatic acid, and using above-mentioned Aspergillus terreus bacterial strain fermenting and producing 4-O- demethyl Ba Erba
Method clothing acid and then synthesize 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester, while additionally providing and utilizing 4-O- demethyl
The method that barbatic acid synthesizes 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester (i.e. synthesis oak moss).
Firstly, the present invention provides a kind of Aspergillus terreus bacterial strain for generating 4-O- demethyl barbatic acid, the Aspergillus terreus
Bacterial strain is Aspergillus terreus (Aspergillus terreus) MEFC06, is preserved in Chinese microorganism strain on June 21st, 2018
Preservation administration committee common micro-organisms center, collection are registered on the books number are as follows: CGMCC No.15890.
Second, the present invention provides the Aspergillus terreus bacterial strain of above-mentioned generation 4-O- demethyl barbatic acid in fermenting and producing 4-
Application in O- demethyl barbatic acid, comprising the following steps:
(1) preparation of Aspergillus terreus seed liquor, seed liquor are inoculated into fermented and cultured in fermentation medium；
(2) separation of fermentative broth purifies to obtain 4-O- demethyl barbatic acid.
The preparation of seed liquor described in step (1), specifically: Aspergillus terreus MEFC06 is inoculated on PDA plate culture medium,
28 DEG C are cultivated 2-9 days, by the spore inoculating on plate into seed culture medium, inoculum concentration 106-108A/35mL, 28 DEG C,
220rpm shaking table culture culture 1-5 days, obtain seed liquor.
It is by the two volume ratio 3:35 that seed liquor, which is inoculated into the inoculum concentration of fermentation medium, in step (1).
Fermented and cultured described in step (1), fermentation temperature were 28 DEG C, 220rpm shaking table culture 6-12 days, and at the 4th day
50% glucose sugar juice of mass fraction is added into fermentation culture system, former fermentation system volume is the glucose solution body added
Long-pending 9 times.
Separating-purifying described in step (2), specifically: thallus is extracted with different organic solvents respectively from fermentation liquid, is closed
And all organic phases, concentration organic phase obtain crude extract, crude extract uses the isolated eluent of silica gel column chromatography, eluent weight
Crystallization obtains 4-O- demethyl barbatic acid.
The method by thallus and separation of fermentative broth are as follows: it is filtered using the nylon cloth of 200 mesh, taking filtrate is fermentation liquid,
Taking filter residue is thallus.
The thallus extraction are as follows: thallus is impregnated with methylene chloride/methanol mixed organic solvents, ultrasonic extraction, is separated organic
Phase, remaining thallus repeat aforesaid operations twice, merge organic phase；In the methylene chloride/methanol mixed organic solvents, dichloromethane
The volume ratio of alkane and methanol is 1:1；The ultrasonic extraction, supersonic frequency 40kHz-100kHz, each ultrasonic extraction time is
1-30min；The ratio of each ultrasonic extraction, mixed organic solvents and thallus is (5-500) mL:(1-5) g.
The fermentation liquid extraction are as follows: bacterium solution and ethyl acetate mix, stratification, separate organic phase, and remaining water phase repeats
Aforesaid operations twice, merge organic phase.
The concentration organic phase, for vacuum distillation concentration, temperature is 60 DEG C or less.The volume that concentration obtains crude extract is original
The 1%-90% of organic phase total volume.
The silica gel column chromatography specifically: crude extract and silica gel 1:(5-10 in mass ratio) mix sample, then with 200-300 mesh
Silica gel by height than 1:(3-5) dress column cross decompression silica gel column chromatography, eluant, eluent is ethyl acetate: petroleum ether volume ratio 1:9 is washed
Contain the formic acid or trifluoroacetic acid of 0.1% (volume fraction) in de- agent, elution amount is 3-5 column volume, and eluant, eluent flow velocity is 5-
20ml/min。
The recrystallization specifically: eluent is evaporated under reduced pressure under the conditions of 40 DEG C and is concentrated into hypersaturated state, and ice bath is cooling,
Crystallization and filtration, filter cake are rinsed 3-4 times with methylene chloride, 30 DEG C of dryings.
Third synthesizes 2,4- dihydroxy -3,6- bis- using 4-O- demethyl barbatic acid the present invention also provides a kind of
The method of methyl toluate, technical solution are as follows:
1) 4-O- demethyl Ba Erba acid 2,4- dihydroxy -3,6- diformazan is obtained by the method for sour water solution or basic hydrolysis
Yl benzoic acid；
2) 2,4- dihydroxy -3,6- mesitylenic acid obtains 2,4- dihydroxy -3,6- dimethyl by esterification reaction of organic acid
Methyl benzoate.
Above technical scheme specifically:
1) 4-O- demethyl barbatic acid is dissolved in the concentrated sulfuric acid and obtains reaction system, stirred in water bath reaction, reaction
After quench reaction, ethyl acetate extraction is collected organic phase and is concentrated under reduced pressure, obtains 2,4- dihydroxy -3,6- diformazan after dry
Yl benzoic acid；
2) 2,4- dihydroxy -3,6- mesitylenic acid and KHCO3It is dissolved in DMF, is heated under the conditions of nitrogen protection jointly
Stirring, after stirring, is slowly added dropwise CH at the same temperature3I continues stirring and reacts, after reaction quenching reaction, acetic acid
Organic phase is collected in ethyl ester extraction, and gained organic phase is concentrated under reduced pressure using saturation NaCl aqueous cleaning in organic phase, dry to obtain
2,4- dihydroxy -3,6- dimethylbenzoate methyl ester.
Step 1) the concentrated sulfuric acid is the aqueous sulfuric acid of mass fraction 95%-98%.
The ratio of step 1) the 4-O- demethyl barbatic acid and the concentrated sulfuric acid is 0.22g/mL.The bath temperature
It is 26 DEG C, the stirred in water bath reaction time is 10-40min.The method of the quenching reaction is that ice water is added in the reaction system,
Ice water volume is 5 times of reaction system volume.The ethyl acetate extraction, ethyl acetate volume are 5 times of reaction system volume,
Merge organic phase after extraction 3 times.The reduced pressure, temperature is 60 DEG C hereinafter, being concentrated into residual volume is 1-20mL.It is described
Drying is dried under the conditions of being 30-50 DEG C.
Step 2) 2,4- dihydroxy -3,6- the mesitylenic acid and KHCO3The ratio between the amount of substance be 9.2:13.8,
The ratio of 2,4- dihydroxy -3,6- mesitylenic acid and DMF are 0.084g/mL.The heating stirring, temperature are 40 DEG C, are stirred
Mixing the time is 10min.2,4- dihydroxy -3,6- mesitylenic acid and CH3The ratio between amount of substance of I is 9.2:9.5.It is described anti-
It is 85-120min between seasonable.The method of the quenching reaction is that ice water is added in the reaction system, and ice water volume is reaction system
5 times of volume.The ethyl acetate extraction, ethyl acetate volume are 5 times of reaction system volume, are merged after extraction 3 times organic
Phase.The saturation NaCl aqueous cleaning, cleaning is the 5 of reaction system volume using the volume of saturation NaCl aqueous solution every time
Times, it cleans 3 times altogether.The reduced pressure, temperature is 45 DEG C hereinafter, being concentrated into residual volume is 1-20mL.The drying is 30-
It is dried under the conditions of 50 DEG C.
4th, Aspergillus terreus bacterial strain fermenting and producing 4-O- demethyl barbatic acid is utilized in turn the present invention also provides a kind of
The method for synthesizing oak moss (i.e. 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester), the technical scheme comprises the following steps:
One, prepared by Aspergillus terreus seed liquor, and seed liquor is inoculated into fermented and cultured in fermentation medium；
Two, separation of fermentative broth purifies to obtain 4-O- demethyl barbatic acid；
Three, 4-O- demethyl Ba Erba acid 2,4- dihydroxy -3,6- two is obtained by the method for sour water solution or basic hydrolysis
Methyl benzoic acid；
Four, 2,4- dihydroxy -3,6- mesitylenic acid obtains 2,4- dihydroxy -3,6- dimethyl by esterification reaction of organic acid
Methyl benzoate.
Above-mentioned steps three specifically: 4-O- demethyl barbatic acid is dissolved in the concentrated sulfuric acid and obtains reaction system, water-bath
In be stirred to react, quenching reaction after reaction, ethyl acetate extraction is collected organic phase and is concentrated under reduced pressure, obtains 2,4- after dry
Dihydroxy -3,6- mesitylenic acid；
Above-mentioned steps four specifically: 2,4- dihydroxy -3,6- mesitylenic acid and KHCO3It is dissolved in DMF jointly, nitrogen
After stirring, CH is slowly added dropwise in heating stirring under protective condition at the same temperature3I continues stirring and reacts, and reaction terminates
Organic phase is collected in quenching reaction afterwards, ethyl acetate extraction, and gained is concentrated under reduced pressure using saturation NaCl aqueous cleaning in organic phase
Organic phase, it is dry to obtain 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester.
The preparation of seed liquor described in step 1, specifically: Aspergillus terreus MEFC06 is inoculated on PDA plate culture medium,
28 DEG C are cultivated 4-9 days, and spore is grown, by the spore inoculating on plate into seed culture medium, inoculum concentration 106-108A/
35mL.28 DEG C, 220rpm shaking table culture culture 1-5 days, obtain seed liquor.
It is by the two volume ratio 3:35 that seed liquor, which is inoculated into the inoculum concentration of fermentation medium, in step 1.
Fermented and cultured described in step 1, fermentation temperature be 28 DEG C, 220rpm shaking table culture 6-12 days, and on day 4 to
50% glucose sugar juice of mass fraction is added in fermentation culture system, former fermentation system volume is the glucose solution volume added
9 times.
Separating-purifying described in step 2, specifically: thallus is extracted with different organic solvents respectively from fermentation liquid, is merged
All organic phases, concentration organic phase obtain crude extract, and crude extract uses the isolated eluent of silica gel column chromatography, and eluent is tied again
Crystalline substance obtains 4-O- demethyl barbatic acid.
The method by thallus and separation of fermentative broth are as follows: it is filtered using the nylon cloth of 200 mesh, taking filtrate is fermentation liquid,
Taking filter residue is thallus.The thallus extraction are as follows: thallus is impregnated with methylene chloride/methanol mixed organic solvents, ultrasonic extraction, separation
Organic phase, remaining thallus repeat aforesaid operations twice, merge organic phase；In the methylene chloride/methanol mixed organic solvents, two
The volume ratio of chloromethanes and methanol is 1:1；The ultrasonic extraction, supersonic frequency 40kHz-100kHz, when each ultrasonic extraction
Between be 1-30min；The ratio of each ultrasonic extraction, mixed organic solvents and thallus is (5-500) mL:(1-5) g.The fermentation
Liquid extraction are as follows: bacterium solution and ethyl acetate mix, stratification, separate organic phase, and remaining water phase repeats aforesaid operations twice, merge
Organic phase.The concentration organic phase, for vacuum distillation concentration, temperature is 60 DEG C or less.The volume that concentration obtains crude extract is original
The 1%-90% of organic phase total volume.The silica gel column chromatography specifically: crude extract and silica gel 1:(5-10 in mass ratio) sample is mixed,
Then with the silica gel of 200-300 mesh by height than 1:(3-5) dress column cross decompression silica gel column chromatography, eluant, eluent is ethyl acetate: stone
Oily ether volume ratio 1:9, the formic acid or trifluoroacetic acid of 0.1% (volume fraction) are contained in eluant, eluent, and elution amount is 3-5 cylinder
Product, eluant, eluent flow velocity are 5-20ml/min.The recrystallization specifically: eluent is evaporated under reduced pressure under the conditions of 40 DEG C and was concentrated into
Saturation state, ice bath is cooling, crystallization and filtration, and filter cake is rinsed 3-4 times with methylene chloride, 30 DEG C of dryings.
The concentrated sulfuric acid described in step 3 is the aqueous sulfuric acid of mass fraction 95%-98%.
The ratio of 4-O- demethyl barbatic acid and the concentrated sulfuric acid described in step 3 is 0.22g/mL.The bath temperature
It is 26 DEG C, the stirred in water bath reaction time is 10-40min.The method of the quenching reaction is that ice is added in the reaction system
Water, ice water volume are 5 times of reaction system volume.The ethyl acetate extraction, ethyl acetate volume are the 5 of reaction system volume
Times, merge organic phase after extraction 3 times.The reduced pressure, temperature is 60 DEG C hereinafter, being concentrated into residual volume is 1-20mL.Institute
It states under the conditions of drying is 30-50 DEG C and dries.
2,4- dihydroxy -3,6- mesitylenic acid and KHCO described in step 43The ratio between the amount of substance be 9.2:13.8,
The ratio of 2,4- dihydroxy -3,6- mesitylenic acid and DMF are 0.084g/mL.The heating stirring, answering temperature is 40 DEG C,
Mixing time is 10min.2,4- dihydroxy -3,6- mesitylenic acid and CH3The ratio between amount of substance of I is 9.2:9.5.It is described
Reaction time is 85-120min.The method of the quenching reaction is that ice water is added in the reaction system, and ice water volume is reactant
It is 5 times of volume.The ethyl acetate extraction, ethyl acetate volume are 5 times of reaction system volume, are associated with after extraction 3 times
Machine phase.The saturation NaCl aqueous cleaning, cleaning is the 5 of reaction system volume using the volume of saturation NaCl aqueous solution every time
Times, it cleans 3 times altogether.The reduced pressure, temperature is 60 DEG C hereinafter, being concentrated into residual volume is 1-20mL.The drying is 30-
It is dried under the conditions of 50 DEG C.
The Aspergillus terreus bacterial strain is Aspergillus terreus (Aspergillus terreus) MEFC06, is protected on June 21st, 2018
It is hidden in China Committee for Culture Collection of Microorganisms's common micro-organisms center, collection is registered on the books number are as follows: CGMCC
No.15890。
Culture medium prescription involved in the present invention are as follows:
PDA plate culture medium: 39g/L potato potato agar medium PDA dry powder, surplus are deionized water, 121 DEG C of height
Pressure sterilizing 20 minutes, is cooled to about 60 DEG C and prepares plate.
PDB culture medium: 39g/L potato potato culture medium PDB dry powder, surplus are deionized water, 121 DEG C of high pressure sterilizations 20
Minute, it is cooled to about 60 DEG C and prepares plate.
Seed culture medium: 70g/L glucose, 40g/L sucrose, 1g/L yeast extract, 1g/L peptone, 1g/L acetic acid
Sodium, 0.04g/L KH2PO4, 0.1g/L MgSO4, 5g/L dregs of beans, 1.5g/L calcium carbonate, surplus is deionized water, 121 DEG C of high pressures
Sterilizing 20 minutes.
Fermentation medium: 70g/L glucose, 40g/L sucrose, 2.5g/L yeast extract, 20g/L peptone, 7g/L second
Sour sodium, 0.5g/L KH2PO4, 0.5g/L MgSO4, 5g/L dregs of beans, 5g/L calcium carbonate, 0.1mL/L GPE, pH6.6, surplus is to go
Ionized water, 121 DEG C high pressure sterilization 20 minutes.
Beneficial effect
For the existing disadvantage present in production synthesis oak moss, the present invention provides a kind of completely new microbial fermentations
It is combined with chemical synthesis to produce the method (Fig. 2) of synthesis oak moss.First by the screening of bacterial strain, one plant of production 4-O- has been obtained
The Aspergillus terreus of demethyl barbatic acid (4 CAS:20372-89-8), then by isolating and purifying acquisition monomeric compound,
Key intermediate 2 is obtained by the method for chemical hydrolysis again, 4- dihydroxy -3,6- mesitylenic acid (3) finally passes through methyl esters
Change reaction and obtain synthesis oak moss 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester (1), preparation process is as shown in Figure 2.First should
Method, which generates 4-O- demethyl barbatic acid using microbe fermentation method, realizes the environmentally protective metaplasia production of intermediate；Its
It is secondary by silica gel column chromatography method can largely recycle with the intermediate in purified fermentation broth, not only reduce costs but also improve effect
Rate；Carrying out two step chemical syntheses finally by intermediate can be obtained synthesis oak moss, simplify synthesis step and process flow.
Detailed description of the invention:
Fig. 1 is the production procedure of traditional chemical synthesis preparation synthesis oak moss；
Fig. 2 is the process for combining preparation synthesis oak moss in the present invention using microbial fermentation and chemical synthesis；
Fig. 3 is the crude extract secondary metabolite HPLC chromatogram analysis figure that ferments in one plant of aspergillus terreus MEFC06 of screening；
Fig. 4 is the HRESIMS and NMR spectra of 4-O- demethyl barbatic acid；
Fig. 5 is the chromatographic peak area of 4-O- demethyl barbatic acid and the concentration standard curve figure of solution；
Fig. 6 is the HPLC quantitative analysis method color of 4-O- demethyl barbatic acid in fungi MEFC06 fermentation crude extract
Spectrogram；
Fig. 7 is the yield and soluble sugar content curve graph of 4-O- demethyl barbatic acid during fermentation optimization；
Fig. 8 is anti-for the HPLC that 4-O- demethyl barbatic acid is hydrolyzed to 2,4- dihydroxy -3,6- mesitylenic acid
Chromatogram should be monitored；
Fig. 9 is the HRESIMS and NMR spectra of 2,4- dihydroxy -3,6- mesitylenic acid；
Figure 10 is that 2,4- dihydroxy -3,6- mesitylenic acid esterification generates 2,4- dihydroxy -3,6- dimethyl benzene
The HPLC reaction monitoring chromatogram of methyl formate；
Figure 11 is the HRESIMS and NMR spectra of 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester.
Specific embodiment
It is spare that culture medium is prepared by following culture medium prescription:
PDA plate culture medium: 39g/L potato potato agar medium PDA dry powder, surplus are deionized water, 121 DEG C of height
Pressure sterilizing 20 minutes, is cooled to about 60 DEG C and prepares plate.
PDB culture medium: 39g/L potato potato culture medium PDB dry powder, surplus are deionized water, 121 DEG C of high pressure sterilizations 20
Minute, it is cooled to about 60 DEG C and prepares plate.
Seed culture medium: 70g/L glucose, 40g/L sucrose, 1g/L yeast extract, 1g/L peptone, 1g/L acetic acid
Sodium, 0.04g/L KH2PO4, 0.1g/L MgSO4, 5g/L dregs of beans, 1.5g/L calcium carbonate, surplus is deionized water, 121 DEG C of high pressures
Sterilizing 20 minutes.
Fermentation medium: 70g/L glucose, 40g/L sucrose, 2.5g/L yeast extract, 20g/L peptone, 7g/L second
Sour sodium, 0.5g/L KH2PO4, 0.5g/L MgSO4, 5g/L dregs of beans, 5g/L calcium carbonate, 0.1mL/L GPE, pH6.6, surplus is to go
Ionized water, 121 DEG C high pressure sterilization 20 minutes.
The HPLC analysis method of fermentation crude extract: mobile phase A (100%H2O+0.05%FA) Mobile phase B (100% ACN+
0.05%FA), gradient elution, 0-5min 95%-76%A, 5-35min 76%-38%A, 35-50min 38%A, 50-
55min 38%-0%A, 55-60min 0-95%A, 60-65min 95%A.Chromatographic column (Agilent ZORBAX Eclipse
5 μm of XDB-C18 4.6mm × 150mm), flow velocity 1ml/min, Detection wavelength 250nm.
The HPLC analysis method of 4-O- demethyl barbatic acid: mobile phase A (100%H2O+0.05%FA) mobile phase
B (100%ACN+0.05%FA), isocratic elution, 23%A-77%B.Chromatographic column (Agilent ZORBAX Eclipse XDB-
5 μm of C18 4.6mm × 150mm), flow velocity 1ml/min, Detection wavelength 250nm.
The HPLC of 2,4- dihydroxy -3,6- mesitylenic acid and 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester points
Analysis method: mobile phase A (100%H2O+0.05%FA) Mobile phase B (100%MeOH), isocratic elution, 23%A-77%B.Chromatography
Column (5 μm of Agilent ZORBAX Eclipse XDB-C18 4.6mm × 150mm), flow velocity 1ml/min, Detection wavelength
250nm。
Embodiment 1
The screening of one plant of Aspergillus terreus bacterial strain that can generate 4-O- demethyl barbatic acid.
The sharp mouth houndfish (Ablennes from Yantai Mouping horse keeping island sea area under the conditions of -20 DEG C will be frozen
Anastomella surface sterilization) is carried out using 75% ethyl alcohol, aseptically takes the part internal organ of fish to be ground, so
The dilution (V/V%0,10,100,1000) for making different gradients of sterile water afterwards, the dilution of stoste and various concentration is coated on
On PDA plate containing ampicillin (0.05g/L) and streptomysin (0.03g/L) two kinds of antibiotic, 28 DEG C of cultures are being cultivated
During see whether growing for fungus colony, and picking single colonie every other day, purified.
By the different fungies for isolating and purifying acquisition respectively at being cultivated 7 days in PDA plate, after growing spore, using blood cell
Colony counting method calculates spore concentration, with spore inoculating amount 1-2 × 108A/bottle is inoculated in PDB culture medium (35ml culture medium
Loaded in 250ml conical flask), 28 DEG C of 220rpm shaking table cultures are fermented 7 days, after respectively with organic phase ethyl acetate and fermentation
Liquid by volume 1:1 ratio extract 3 times, merge organic phase simultaneously be concentrated acquisition fermentation crude extract, with methanol dissolve prepare
The solution of 100mg/ml, 0.22 μm of membrane filtration are analyzed using the analysis method of fermentation crude extract HPLC.
The tunning for comparing all bacterial strains finds that the metabolite type of one plant of bacterium (number MEFC06) is single and yield
Higher, the retention time of principal product is about after isolating and purifying, to be reflected using NMR and HRESIMS at 25.9min (Fig. 3)
Surely find that the compound is 4-O- demethyl barbatic acid, HRESIMS and NMR spectra are as shown in Fig. 4.Extract bacterial strain base
Because of group, using primer I TS1F (5 '-CTTGGTCATTTAGAGGAAGTAA-3 ') and ITS4 (5 '-
TCCTCCGCTTATTGATATGC-3 ') PCR amplification bacterial strain ITS rDNA sequence, and be sequenced, result inputted into the website NCBI ratio
It is right, identify that the bacterium is Aspergillus terreus.
It is named as Aspergillus terreus (Aspergillus terreus) MEFC06, the bacterial strain is in preservation on the 21st in 06 month in 2018
In China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number, middle institute of microbiology, the academy of sciences, 100101), collection is registered on the books number are as follows: CGMCC No.15890, it is proposed that point
Class names Aspergillus terreus Aspergillus terreus,.
Compound 4-O- demethyl barbatic acid structural analysis data are as follows:
4-O-Demethylbarbatic acid(4):HRESIMS m/z 345.0980[M-H]-(calcd for
C18H17O7, 345.0980).1H NMR(600MHz,acetone-d6,δ,ppm)11.64(1H,s),6.69(1H,s),
6.47(1H,s), 2.61(3H,s),2.60(3H,s),2.08(3H,s),2.07(3H,s).13C NMR(150MHz,DMSO-
d6,δ,ppm): 173.2(C),169.3(C),162.1(C),161.4(C),160.8(C),151.8(C),129.1(C),
129.0(C),116.1 (CH),115.8(C),111.4(C),111.0(CH),108.6(C),103.6(C),23.6(CH3),
22.9(CH3),9.1 (CH3),8.1(CH3).
Aspergillus MEFC06 (Aspergillus sp.MEFC06) ITS rDNA sequence result: TATGCTTAAGT
TCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAAAACA AGTTGCACAAAAAATGCGTCGGCGGGCGC
CGGCCGGGCCTACAGAGCGGAAGACG AAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGG
GCCCGTC CCCCGGGAGCCGGGGGACGAGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAA TGACGCTCGGAC
AGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAA GACTCGATGATTCACTGAATTCTGCAATTCA
CATTAGTTATCGCATTTCGCTGCGTTCT TCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGA
TTGCAAAGAA TCACAACTCAGACTGCAAGCTTTCAGAACAGGGTTCATGTTGGGGTCTCCGGCGGG CACGGGCC
CGGGGGCGTGACGCCCCCCGGCGGCCAGCAACGCTGGCGGGCCCGCC GAAGCAACAAGGTACAATAGTCACGGGT
GGGAGGTTGGGCCATAAAGACCCGCACT CGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGAC
TTTTACT。
Embodiment 2
The Aspergillus terreus bacterial strain Aspergillus terreus for the generation 4-O- demethyl barbatic acid that the screening of embodiment 1 obtains
Application of (Aspergillus terreus) MEFC06 in fermenting and producing 4-O- demethyl barbatic acid.
The following steps are included:
(1) preparation of Aspergillus terreus seed liquor, seed liquor are inoculated into fermented and cultured in fermentation medium；
(2) separation of fermentative broth purifies to obtain 4-O- demethyl barbatic acid.
The preparation of seed liquor described in step (1), specifically: Aspergillus terreus MEFC06 is inoculated on PDA plate culture medium,
28 DEG C are cultivated 4-9 days, and spore is grown, by the spore inoculating on plate into seed culture medium, inoculum concentration 106-108A/
35mL, 28 DEG C, the culture of 220rpm shaking table culture 2 days, obtains seed liquor.
It is by the two volume ratio 3:35 that seed liquor, which is inoculated into the inoculum concentration of fermentation medium, in step (1).
Fermented and cultured described in step (1), fermentation temperature are 28 DEG C, 220rpm shaking table culture 10 days, and on day 4 to hair
50% glucose sugar juice of mass fraction is added in ferment cultivating system, former fermentation system volume is the glucose solution volume added
9 times.
Separating-purifying described in step (2), specifically: thallus is extracted with different organic solvents respectively from fermentation liquid, is closed
And all organic phases, concentration organic phase obtain crude extract, crude extract uses the isolated eluent of silica gel column chromatography, eluent weight
Crystallization obtains 4-O- demethyl barbatic acid.
The method by thallus and separation of fermentative broth are as follows: it is filtered using the nylon cloth of 200 mesh, taking filtrate is fermentation liquid,
Taking filter residue is thallus.The thallus extraction are as follows: thallus is impregnated with methylene chloride/methanol mixed organic solvents, ultrasonic extraction, separation
Organic phase, remaining thallus repeat aforesaid operations twice, merge organic phase；In the methylene chloride/methanol mixed organic solvents, two
The volume ratio of chloromethanes and methanol is 1:1；The ultrasonic extraction, supersonic frequency 90kHz, each ultrasonic extraction time is
20min；The ratio of each ultrasonic extraction, mixed organic solvents and thallus is 100mL/g.Fermentation liquid extraction are as follows: bacterium solution with
Ethyl acetate mixes, stratification, separates organic phase, and remaining water phase repeats aforesaid operations twice, merges organic phase.The concentration
Organic phase, for vacuum distillation concentration, temperature is 40 DEG C.The volume that concentration obtains crude extract is the 10% of former organic phase total volume.
The silica gel column chromatography specifically: crude extract and silica gel 1:5 in mass ratio mix sample, then with the silica gel of 200-300 mesh by height
Decompression silica gel column chromatography is crossed than 1:5 dress column, eluant, eluent is ethyl acetate: petroleum ether volume ratio 1:9, contains 0.1% in eluant, eluent
The formic acid of (volume fraction), eluant, eluent flow velocity are 10ml/min, and elution amount is 5 column volumes.The recrystallization specifically: wash
De- liquid is evaporated under reduced pressure under the conditions of 40 DEG C is concentrated into hypersaturated state, and ice bath is cooling, and crystallization and filtration, filter cake is rushed with methylene chloride
It washes 4 times, 30 DEG C of dryings.Through detecting, products therefrom purity is 98.9%, and the process for separation and purification rate of recovery is 88%, is eventually passed through
The yield of fermentation 4-O- demethyl barbatic acid can achieve 2.12g/L.
Embodiment 3 is raw material using the method for chemical synthesis preparation synthesis oak moss using 4-O- demethyl barbatic acid
1) 4-O- demethyl Ba Erba acid 2,4- dihydroxy -3,6- diformazan is obtained by the method for sour water solution or basic hydrolysis
Yl benzoic acid；
2) 2,4- dihydroxy -3,6- mesitylenic acid obtains 2,4- dihydroxy -3,6- dimethyl by esterification reaction of organic acid
Methyl benzoate.
The present embodiment specifically:
The solid crystal of 2.2g (6.3mmol) 4-O- demethyl barbatic acid is added into there-necked flask, is then added
The concentrated sulfuric acid of the mass fraction 98% of 10ml catalytic amount (being completely dissolved solid crystal) is stirred to react at 26 DEG C of water-bath, and adopts
With the HPLC analysis method of 2,4- dihydroxy -3,6- mesitylenic acid and 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester
Reaction monitoring, as the result is shown fully reacting after 10min, generation of the late phase reaction monitoring up to 40min and no coupling product, reaction prison
Control is as shown in Figure 8.The ice water quenching reaction of 50ml is used after reaction, and ethyl acetate extracts (3 times, each 50ml), is associated with
Machine is mutually concentrated under reduced pressure, dry, obtains white solid 2.17g, yield 94.6%.It is tested and analyzed through NMR and HRESIMS,
HRESIMS and NMR spectra are as shown in figure 9, determine that the compound is target compound 2,4- dihydroxy -3,6- dimethyl benzene first
Acid.
Compound 2,4- dihydroxy -3,6- mesitylenic acid structural analysis data are as follows:
2,4-dihydroxy-3,6-dimethyl-Benzoic acid(3):HRESIMS m/z 181.0509[M-H]-
(calcd for C9H9O4,181.0506).1H NMR(600MHz,acetone-d6,δ,ppm)6.33(1H,s),2.47
(3H,s),2.20 (3H,s).13C NMR(150MHz,acetone-d6,δ,ppm):174.9(C),164.7(C),161.0
(C),141.0(C), 111.2(CH),109.2(C),104.4(C),24.1(CH3),8.0(CH3).
1.68g (9.2mmol) dry 2,4- dihydroxy -3,6- mesitylenic acid solid is separately added into there-necked flask
Crystallization, 1.38g (13.8mmol) KHCO3, dissolved with 20ml dry DMF, nitrogen protection, slowly dripped after 40 DEG C of stirring 10min
Add 1.35g (0.59ml, 9.5mmol) CH3I, using 2,4- dihydroxy -3,6- mesitylenic acid and 2,4- dihydroxy -3,6-
The HPLC analysis method reaction monitoring of dimethylbenzoate methyl ester reacts raw material almost fully reacting after 85min, instead as the result is shown
It should monitor as shown in Figure 10.100ml water quenching reaction is added after reaction, ethyl acetate extracts (3 times, each 100ml),
Organic phase saturation NaCl aqueous cleaning (3 times, each 100ml), organic phase are concentrated under reduced pressure, dry, obtain white solid
1.63g, yield 90.4%.It is tested and analyzed through NMR and HRESIMS, HRESIMS and NMR spectra are as shown in figure 11, determine the change
Conjunction object is target compound 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester (synthesis oak moss).
Compound 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester structural analysis data are as follows:
Methyl 2,4-dihydroxy-3,6-dimethylbenzoate(1):HRESIMS m/z 195.0664[M-
H]-(calcd for C10H11O4,195.0663).1H NMR(400MHz,DMSO-d6,δ,ppm)11.68(1H,s),
10.08(1H, s),6.28(1H,s),3.83(3H,s)2.35(3H,s),1..95(3H,s).13C NMR(100MHz,DMSO-
d6,δ, ppm):172.0(C),161.9(C),160.1(C),138.9(C),110.6(CH),108.2(C),103.9(C),
51.9(CH3), 23.6(CH3),8.0(CH3).
Embodiment 4
Using Aspergillus terreus bacterial strain fermenting and producing 4-O- demethyl barbatic acid and then synthesize oak moss (and 2,4- dihydroxy
Base -3,6- dimethylbenzoate methyl ester):
One, the preparation of Aspergillus terreus fermentation seed liquid, seed liquor are inoculated into fermented and cultured in fermentation medium；
Two, separation of fermentative broth purifies to obtain 4-O- demethyl barbatic acid；
Three, 4-O- demethyl Ba Erba acid 2,4- dihydroxy -3,6- two is obtained by the method for sour water solution or basic hydrolysis
Methyl benzoic acid；
Four, 2,4- dihydroxy -3,6- mesitylenic acid obtains 2,4- dihydroxy -3,6- dimethyl by esterification reaction of organic acid
Methyl benzoate.
Above-mentioned steps three specifically: 4-O- demethyl barbatic acid is dissolved in the concentrated sulfuric acid and obtains reaction system, water-bath
In be stirred to react, quenching reaction after reaction, ethyl acetate extraction is collected organic phase and is concentrated under reduced pressure, obtains 2,4- after dry
Dihydroxy -3,6- mesitylenic acid；
Above-mentioned steps four specifically: 2,4- dihydroxy -3,6- mesitylenic acid and KHCO3It is dissolved in DMF jointly, nitrogen
After stirring, CH is slowly added dropwise in heating stirring under protective condition at the same temperature3I continues stirring and reacts, and reaction terminates
Organic phase is collected in quenching reaction afterwards, ethyl acetate extraction, and gained is concentrated under reduced pressure using saturation NaCl aqueous cleaning in organic phase
Organic phase, it is dry to obtain 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester.
In the present embodiment specifically:
The preparation of seed liquor described in step 1 in the present embodiment, specifically: Aspergillus terreus MEFC06 is inoculated into PDA plate
On culture medium, 28 DEG C are cultivated 4-9 days, grow spore, by the spore inoculating on plate into seed culture medium, inoculum concentration 106-
108A/35mL, 28 DEG C, the culture of 220rpm shaking table culture 2 days, obtains seed liquor.
The inoculum concentration that seed liquor is inoculated into fermentation medium in step 1 in the present embodiment is by the two volume ratio 3:35.
Fermented and cultured described in step 1 in the present embodiment, fermentation temperature be 28 DEG C, 220rpm shaking table culture 10 days, and
50% glucose sugar juice of mass fraction is added within 4th day into fermentation culture system, former fermentation system volume is the glucose added
9 times of liquor capacity.
Separating-purifying described in step 2 in the present embodiment, specifically: thallus is used different organic molten respectively from fermentation liquid
Agent extraction merges all organic phases, and concentration organic phase obtains crude extract, and crude extract uses the isolated elution of silica gel column chromatography
Liquid, eluent are recrystallized to give 4-O- demethyl barbatic acid.The method by thallus and separation of fermentative broth are as follows: use
The nylon cloth of 200 mesh filters, and taking filtrate is fermentation liquid, and taking filter residue is thallus.Thallus extraction are as follows: thallus with methylene chloride/
Methanol mixed organic solvents impregnate, ultrasonic extraction, separate organic phase, and remaining thallus repeats aforesaid operations twice, merge organic phase；
In the methylene chloride/methanol mixed organic solvents, the volume ratio of methylene chloride and methanol is 1:1；The ultrasonic extraction, ultrasound
Frequency is 90kHz, and each ultrasonic extraction time is 10min；The ratio of each ultrasonic extraction, mixed organic solvents and thallus is
100mL/g.The fermentation liquid extraction are as follows: bacterium solution and ethyl acetate mix, stratification, separate organic phase, and remaining water phase repeats
Aforesaid operations twice, merge organic phase.The concentration organic phase, for vacuum distillation concentration, temperature is 40 DEG C.Concentration is obtained and is slightly mentioned
The volume of object is the 10% of former organic phase total volume.The silica gel column chromatography specifically: crude extract is mixed with silica gel 1:5 in mass ratio
Then sample crosses decompression silica gel column chromatography by height ratio 1:5 dress column with the silica gel of 200-300 mesh, eluant, eluent is ethyl acetate: petroleum
Ether volume ratio 1:9 contains the formic acid or trifluoroacetic acid of 0.1% (volume fraction) in eluant, eluent, and eluant, eluent flow velocity is 10ml/min,
Elution amount is 5 column volumes.The recrystallization specifically: eluent is evaporated under reduced pressure under the conditions of 40 DEG C and is concentrated into supersaturated shape
State, ice bath is cooling, crystallization and filtration, and filter cake is rinsed 4 times with methylene chloride, 30 DEG C of dryings.Through detecting, products therefrom purity is
98.9%, the process for separation and purification rate of recovery is 88%, and the yield for eventually passing through fermentation 4-O- demethyl barbatic acid can be with
Reach 2.12g/L.
Step 3 in the present embodiment specifically: 2.2g (6.3mmol) 4-O- demethyl Ba Erba is added into there-necked flask
Then the concentrated sulfuric acid of the mass fraction 98% of 10ml catalytic amount (being completely dissolved solid crystal) is added in the solid crystal of clothing acid,
It is stirred to react at 26 DEG C of water-bath, and uses 2,4- dihydroxy -3,6- mesitylenic acid and 2,4- dihydroxy -3,6- dimethyl benzene
The HPLC analysis method reaction monitoring of methyl formate, fully reacting after 10min as the result is shown, late phase reaction monitoring is until 40min
And the generation of no coupling product, reaction monitoring are as shown in Figure 8.The ice water quenching reaction of 50ml, ethyl acetate extraction are used after reaction
It takes (3 times, each 50ml), merges organic pressure of subtracting each other and be concentrated, it is dry, obtain white solid 2.17g, yield 94.6%.Through NMR and
HRESIMS is tested and analyzed, and HRESIMS and NMR spectra are as shown in figure 9, determine that the compound is target compound 2,4- dihydroxy-
3,6- mesitylenic acid.
Step 4 in the present embodiment specifically: 1.68g (9.2mmol) dry 2,4- dihydroxy is separately added into there-necked flask
Base -3,6- mesitylenic acid solid crystal, 1.38g (13.8mmol) KHCO3, dissolved with 20ml dry DMF, nitrogen is protected
It protects, 1.35g (0.59ml, 9.5mmol) CH is slowly added dropwise after 40 DEG C of stirring 10min3I, using 2,4- dihydroxy -3,6- diformazan
Yl benzoic acid and 2, the HPLC analysis method reaction monitoring of 4- dihydroxy -3,6- dimethylbenzoate methyl ester, reacts as the result is shown
Raw material almost fully reacting, reaction monitoring are as shown in Figure 10 after 85min.100ml water quenching reaction, acetic acid are added after reaction
Ethyl ester extracts (3 times, each 100ml), organic phase saturation NaCl aqueous cleaning (3 times, each 100ml), organic phase decompression
Concentration, it is dry, obtain white solid 1.63g, yield 90.4%.It is tested and analyzed through NMR and HRESIMS, HRESIMS and NMR figure
Spectrum as shown in figure 11, determines that the compound is target compound 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester (synthesis rubber
Tongue fur).
Claims (10)
1. it is a kind of using method Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid and then synthesize synthesis oak moss, it is special
Sign is: the following steps are included:
One, prepared by Aspergillus terreus seed liquor, and seed liquor is inoculated into fermented and cultured in fermentation medium；
Two, separation of fermentative broth purifies to obtain 4-O- demethyl barbatic acid；
Three, 4-O- demethyl Ba Erba acid 2,4- dihydroxy -3,6- dimethyl is obtained by the method for sour water solution or basic hydrolysis
Benzoic acid；
Four, 2,4- dihydroxy -3,6- mesitylenic acid obtains 2,4- dihydroxy -3,6- dimethyl benzene first by esterification reaction of organic acid
Sour methyl esters.
2. according to claim 1 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: the step 3 specifically: 4-O- demethyl barbatic acid is dissolved in the concentrated sulfuric acid and is obtained
Reaction system, stirred in water bath reaction, after reaction quenching reaction, ethyl acetate extraction are collected organic phase and are concentrated under reduced pressure, do
2,4- dihydroxy -3,6- mesitylenic acid is obtained after dry；The step 4 specifically: 2,4- dihydroxy -3,6- dimethyl benzene
Formic acid and KHCO3It is dissolved in DMF jointly, heating stirring under the conditions of nitrogen protection after stirring, is slowly added dropwise at the same temperature
CH3I continues stirring and reacts, after reaction quenching reaction, and organic phase is collected in ethyl acetate extraction, and organic phase is using full
With NaCl aqueous cleaning, gained organic phase is concentrated under reduced pressure, it is dry to obtain 2,4- dihydroxy -3,6- dimethylbenzoate methyl ester.
3. according to claim 1 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: the Aspergillus terreus bacterial strain be Aspergillus terreus (Aspergillusterreus) MEFC06, in
Be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on June 21st, 2018, collection register into
Volume number are as follows: CGMCCNo.15890；The preparation of seed liquor described in step 1, specifically: Aspergillus terreus MEFC06 is inoculated into PDA
On plating medium, 28 DEG C are cultivated 4-9 days；By the Aspergillus terreus spore inoculating on PDA plate culture medium into seed culture medium, 28
DEG C, 220rpm shaking table culture culture 1-5 days, obtain seed liquor, inoculum concentration 106-108A/35mL.
4. according to claim 1 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: it is by the two volume ratio 3 that seed liquor, which is inoculated into the inoculum concentration of fermentation medium, in step 1:
35；Fermented and cultured described in step 1, fermentation temperature are 28 DEG C, 220rpm shaking table culture 6-12 days, and are trained on day 4 to fermentation
50% glucose sugar juice of mass fraction is added in the system of supporting, former fermentation system volume is 9 times of the glucose solution volume added.
5. according to claim 1 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: separating-purifying described in step 2, specifically: thallus has with different respectively from fermentation liquid
Solvent extraction merges all organic phases, and concentration organic phase obtains crude extract, and crude extract is washed using silica gel column chromatography is isolated
De- liquid, eluent are recrystallized to give 4-O- demethyl barbatic acid.
6. according to claim 5 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: the thallus extraction are as follows: thallus is impregnated with methylene chloride/methanol mixed organic solvents, ultrasound
Extraction separates organic phase, and remaining thallus repeats aforesaid operations twice, merges organic phase；The methylene chloride/methanol mixing is organic
In solvent, the volume ratio of methylene chloride and methanol is 1:1；The ultrasonic extraction, supersonic frequency 40kHz-100kHz are super every time
Sound extraction time is 1-30min；The ratio of each ultrasonic extraction, mixed organic solvents and thallus is (5-500) mL:(1-5) g；
The fermentation liquid extraction are as follows: bacterium solution and ethyl acetate mix, stratification, separate organic phase, and remaining water phase repeats aforesaid operations
Twice, merge organic phase.
7. according to claim 5 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: the silica gel column chromatography specifically: crude extract and silica gel 1:(5-10 in mass ratio) sample is mixed,
Then with the silica gel of 200-300 mesh by height than 1:(3-5) dress column cross decompression silica gel column chromatography, eluant, eluent is ethyl acetate: stone
Oily ether volume ratio 1:9, the formic acid or trifluoroacetic acid for being 0.1% containing volume fraction in eluant, eluent, elution amount are 3-5 cylinder
Product, eluant, eluent flow velocity are 5-20ml/min；The recrystallization specifically: eluent is evaporated under reduced pressure under the conditions of 40 DEG C and was concentrated into
Saturation state, ice bath is cooling, crystallization and filtration, and filter cake is rinsed 3-4 times with methylene chloride, 30 DEG C of dryings.
8. according to claim 2 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: the concentrated sulfuric acid described in step 3 is the aqueous sulfuric acid of mass fraction 95%-98%；Step 3
The ratio of the 4-O- demethyl barbatic acid and the concentrated sulfuric acid is 0.22g/mL；The bath temperature is 26 DEG C, in water-bath
Being stirred to react the time is 10-40min.
9. according to claim 2 synthesize synthesis using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid in turn
The method of oak moss, it is characterised in that: 2,4- dihydroxy -3,6- mesitylenic acid and KHCO described in step 43Substance amount
The ratio between be 9.2:13.8, the ratio of 2,4- dihydroxy -3,6- mesitylenic acids and DMF are 0.084g/mL；The heating is stirred
It mixes, answering temperature is 40 DEG C, mixing time 10min.
10. according to claim 2 synthesized in turn using Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid
At the method for oak moss, it is characterised in that: 2,4- dihydroxy -3,6- mesitylenic acid and CH in step 43The amount of the substance of I it
Than for 9.2:9.5；The reaction time is 85-120min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811285482.4A CN109666707B (en) | 2018-10-31 | 2018-10-31 | Method for synthesizing oak moss by producing 4-O-demethyl barba lichenicacid with aspergillus terreus strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811285482.4A CN109666707B (en) | 2018-10-31 | 2018-10-31 | Method for synthesizing oak moss by producing 4-O-demethyl barba lichenicacid with aspergillus terreus strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109666707A true CN109666707A (en) | 2019-04-23 |
| CN109666707B CN109666707B (en) | 2022-04-26 |
Family
ID=66141755
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811285482.4A Active CN109666707B (en) | 2018-10-31 | 2018-10-31 | Method for synthesizing oak moss by producing 4-O-demethyl barba lichenicacid with aspergillus terreus strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109666707B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112592837A (en) * | 2020-12-21 | 2021-04-02 | 中国科学院微生物研究所 | Aspergillus terreus with inhibition effect on root nematodes and application thereof |
| CN113604448A (en) * | 2021-08-09 | 2021-11-05 | 中南民族大学 | Polyketide synthase Preu3 and application thereof in preparation of 2,4-dihydroxy-3,6-dimethylbenzoic acid |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018352A (en) * | 2015-07-23 | 2015-11-04 | 云南大学 | Fungal strain capable of producing kojic acid and preparation method of fungal strain |
| CN108165500A (en) * | 2018-02-26 | 2018-06-15 | 广东海洋大学深圳研究院 | One plant of marine fungi Aspergillus terreus C23-3, zymotic fluid activity extract and its preparation method and application |
-
2018
- 2018-10-31 CN CN201811285482.4A patent/CN109666707B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018352A (en) * | 2015-07-23 | 2015-11-04 | 云南大学 | Fungal strain capable of producing kojic acid and preparation method of fungal strain |
| CN108165500A (en) * | 2018-02-26 | 2018-06-15 | 广东海洋大学深圳研究院 | One plant of marine fungi Aspergillus terreus C23-3, zymotic fluid activity extract and its preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| 许楚旋等: "1株产生洛伐他汀杂色曲霉的筛选、鉴定和发酵优化条件", 《生物技术通报》 * |
| 韦苏慧等: "洛伐他汀工业菌株土曲霉HZ01的次级代谢产物合成分析", 《微生物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112592837A (en) * | 2020-12-21 | 2021-04-02 | 中国科学院微生物研究所 | Aspergillus terreus with inhibition effect on root nematodes and application thereof |
| CN112592837B (en) * | 2020-12-21 | 2022-02-18 | 中国科学院微生物研究所 | Aspergillus terreus with inhibition effect on root nematodes and application thereof |
| CN113604448A (en) * | 2021-08-09 | 2021-11-05 | 中南民族大学 | Polyketide synthase Preu3 and application thereof in preparation of 2,4-dihydroxy-3,6-dimethylbenzoic acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109666707B (en) | 2022-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JPH0285296A (en) | Fr901228 substance and preparation thereof | |
| CN102433364A (en) | Process for preparing rapamycin by using microbial fermentation method | |
| CN108299462A (en) | Mixed source terpene compound and its separation method and application | |
| CN110527629A (en) | A kind of brefeldin A in marine fungi source, preparation method and its application in terms of anti-agriculture pathogenic bacteria | |
| CN109666707A (en) | Utilize method Aspergillus terreus bacterial strain production 4-O- demethyl barbatic acid and then synthesize synthesis oak moss | |
| CN104726347B (en) | One plant of fox excrement mould fungal bacterial strain and the method for preparing left-handed 7 hydroxyl butylphenyl phthaleine using the bacterial strain | |
| CN111117893B (en) | Aspergillus terreus strain for producing 4-O-demethylbarbituric acid and application thereof | |
| CN111116370B (en) | Method for synthesizing 2, 4-dihydroxy-3, 6-dimethyl methyl benzoate by using 4-O-demethylbarbituric acid | |
| CN109321608B (en) | Application of aureobasidium pullulans in co-production of pullulan polysaccharide and phenethyl alcohol | |
| CN113337432B (en) | Methylophilus for producing pyrroloquinoline quinone and application thereof | |
| CN109456899A (en) | A kind of method of Penicillium notatum and its fermenting and producing penicillic acid | |
| CN109370919B (en) | Bacterial strain for producing penicillic acid and application thereof | |
| CN106957881B (en) | Preparation method of curcumin derivative | |
| CN110218744A (en) | A method of bent ground acid is prepared by microbial fermentation | |
| CN115385878B (en) | Natural active compound moenofuran and preparation method and application thereof | |
| CN113337433B (en) | Pseudomonas capable of producing pyrroloquinoline quinone and application thereof | |
| CN112341412B (en) | Preparation method and application of polyketide with tyrosinase inhibitory activity | |
| CN102559510B (en) | Halophilic aspergillus sp.F1 and application thereof | |
| CN102154126A (en) | Strain and method for producing mannitol by strain | |
| CN110218750B (en) | Application of aspergillus versicolor strain in fermentation production of kojic acid | |
| CN108218884B (en) | Huperzine B derivative and preparation method thereof | |
| CN107460226B (en) | Method for producing ergosterol with high yield by fermenting straw through neurospora crassa | |
| CN106119305A (en) | A kind of preparation method of phenoxy propionic acid | |
| JPS5831992A (en) | Novel physiologically active substance k-4 and its preparation | |
| US3557151A (en) | The compound(+)-5'-hydroxygriseofulvin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |