CN109666689B

CN109666689B - Heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and application thereof

Info

Publication number: CN109666689B
Application number: CN201710962173.5A
Authority: CN
Inventors: 张以恒; 宋云洪; 刘美霞
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2017-10-15
Filing date: 2017-10-15
Publication date: 2022-11-15
Anticipated expiration: 2037-10-15
Also published as: CN109666689A

Abstract

The invention discloses a heterologous expression and purification method of recombinant high-temperature ferronickel hydrogenase and application thereof, belonging to the field of expression, purification and application of ferronickel hydrogenase. The high-temperature ferronickel hydrogenase disclosed by the invention is derived from extreme thermophilic anaerobic archaea Pyrococcus furiosus, a shuttle vector is utilized to carry out recombination overexpression on the other extreme thermophilic anaerobic archaea Thermococcus kodakarensis, and the purification process of the recombination hydrogenase is simplified and the yield of the hydrogenase is improved by the specific combination of a histidine tag and a nickel column; and is coupled with Diaphorase (DI) containing Flavin Mononucleotide (FMN) to form a new electron transfer path, and the regeneration of coenzyme NADH is realized by using hydrogen. The expression and purification method of the recombinant high-temperature ferronickel hydrogenase established by the invention has the characteristics of simple steps, high enzyme yield, low production cost and the like; in addition, the coenzyme regeneration system established by the invention takes hydrogen (gas) as a substrate, has small influence on the reaction system, does not change the pH value of the solution, and is easy to separate the product.

Description

Heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and application thereof

Technical Field

The invention relates to a heterologous expression and purification method of recombinant high-temperature ferronickel hydrogenase and coenzyme regeneration application thereof, belonging to the field of expression and purification of ferronickel hydrogenase and coenzyme regeneration.

Background

The hydrogenase catalyzes the reversible proton reduction hydrogen production reaction, which is a key enzyme in the relevant basic research of biological hydrogen production, hydrogen energy batteries and the like. Hydrogenases are classified into monoiron hydrogenases (Fe hases), biferro hydrogenases (FeFe hases), and ferronickel hydrogenases (NiFe hases) according to the metal ions contained in their active centers. Fe Hase is only found in a part of methane archaea, and the catalytic hydrogen production activity of FeFe hydrogenase is higher, but the FeFe hydrogenase is highly sensitive to oxygen; in contrast, the NiFe hydrogenase has wide distribution, slightly low sensitivity to oxygen, and is reversible when being inactivated by oxygen, and the high-temperature NiFe hydrogenase has better thermal stability and better industrial application prospect.

Soluble Hydrogenase I (SHI) derived from Thermus thermophilus Pyrococcus furiosus (optimum growth temperature is 100 ℃) is a bidirectional ferronickel hydrogenase, has good thermal stability, and has a half-life of 14 hours at 90 ℃ and a half-life of 208 hours at 40 ℃. SHI is active over a temperature range of 20 to 100 ℃. SHI is an heterotetrameric protein complex comprising a NiFe active center (α), two iron-sulfur clusters (β), one Flavonoid Adenine Dinucleotide (FAD) and one iron-sulfur cluster (γ), and three iron-sulfur clusters (γ), encoded by an independent gene operon (PF 0891-PF 0894). Heterologous expression of NiFe-hydrogenase is very difficult because the maturation process of the NiFe active center is very complex and is a precisely coordinated post-translational modification of proteins that require a series of accessory proteins (HypABCDEF and special endopeptidases). The present studies on the heterologous expression of SHI have been carried out only in e.coli, but the yields are very low, much lower than the results of purification of p.furiosus by homologous overexpression.

Thermococcus kodakarensis is a strictly anaerobically growing thermophilic archaea isolated from geothermal hot springs, which has an optimum growth temperature of 85 ℃ and belongs to the order Pyrococcales with P.furiosus, but the optimum growth temperature of the latter is up to 100 ℃. Kodakarensis can propagate and grow on culture medium containing polypeptide, starch, pyruvic acid or chitin, etc., and elemental sulfur or proton is used as final electron acceptor to respectively generate H ₂ S or H ₂ . In 2005, whole genome sequencing of t.kodakarensis was completed, and genetic manipulation systems of t.kodakarensis became mature due to natural competent cell characteristics and the use of shuttle vectors, and gene knockout and gene insertion by homologous recombination or expression of functional genes in t.kodakarensis by shuttle vectors were successfully performed. In addition, soluble hydrogenases having a sequence identity of up to 83.7% with SHI proteins were found in t.kodakarensis, and thus, it is presumed that hydrogenase helper proteins in t.kodakarensis and specific endopeptidases may be suitable for the maturation process of SHI.

Since genetic modification of most of the extreme thermophilic archaea is difficult to perform and development of a high-temperature expression platform is limited, a genetic modification operating system of T.kodakarensis gradually develops the T.kodakarensis into a platform for researching expression and screening of high-temperature anaerobic enzymes.

In addition, oxidoreductases have high stereoselectivity in mild liquid environments, and are therefore widely used in the biosynthesis of chiral compounds. However, redox-enzyme-catalyzed biohydrogenation reactions require a reduced coenzyme, NADH or NADPH as hydrogen donor, and therefore, efficient regeneration of the coenzyme is of great importance for the economic viability of the industry. There are many methods for coenzyme regeneration, but the coenzyme regeneration method using hydrogenase has its unique advantages: gaseous substrate hydrogen does not affect the liquid reaction system and the product is easily separated. The use of SHI for the regeneration of NADPH has been reported for a long time, but it has not been studied for the regeneration of NADH because its affinity for NAD is much lower than that of NADP.

Disclosure of Invention

The technical problem to be solved by the invention is a heterologous expression and purification method of recombinant high-temperature ferronickel hydrogenase and application of coenzyme regeneration thereof. The expression and purification method of the recombinant high-temperature ferronickel hydrogenase has the characteristics of simple steps, high enzyme yield, low production cost and the like, and in addition, the coenzyme regeneration system established by the invention takes hydrogen (gas) as a substrate, has small influence on a reaction system, cannot change the pH value of a solution, and is easy to separate products.

One of the purposes of the invention is to provide a high-temperature ferronickel hydrogenase heterologous expression method, which comprises the steps of;

(1) Inserting a high-temperature ferronickel hydrogenase encoding gene derived from extreme thermophilic anaerobic archaea (Pyrococcus furiosus) into a shuttle vector;

(2) Transforming the vector obtained in the step (1) into extreme thermophilic anaerobic archaea (Thermococcus kodakarensis) and expressing.

In a preferred embodiment, the method is characterized in that the sequence of the gene encoding the pyronickel iron hydrogenase derived from thermophilic anaerobic archaea (Pyrococcus furiosus) is (a) or (b) or (c) or (d): (a) SEQ ID NO:2; (b) a sequence similar to SEQ ID NO:2, a sequence having 90% or more, preferably 95% or more, more preferably 99% or more homology; (c) A nucleotide sequence encoding a protein of four subunits, wherein the amino acid sequence of the first subunit is SEQ ID NO:3, wherein the amino acid sequence of the second subunit is SEQ ID NO:4, wherein the amino acid sequence of the third subunit is SEQ ID NO:5, wherein the amino acid sequence of the fourth subunit is SEQ ID NO:6; (d) A nucleotide sequence encoding a protein of four subunits, wherein the amino acid sequence of the first subunit is identical to SEQ ID NO:3 has 90% or more, preferably 95% or more, more preferably 99% or more homology; wherein the amino acid sequence of the second subunit is identical to SEQ ID NO:4 has 90% or more, preferably 95% or more, more preferably 99% or more homology; wherein the amino acid sequence of the third subunit is identical to SEQ ID NO:5, wherein the amino acid sequence of the fourth subunit has 90% or more, preferably 95% or more, more preferably 99% or more homology to SEQ ID NO:6 has 90% or more, preferably 95% or more, more preferably 99% or more homology.

In a more preferred embodiment, the method is characterized in that the gene encoding ferronickel hydrogenase is linked to a histidine tag sequence.

In a most preferred embodiment, the method is characterized in that the histidine tag sequence encodes 9-12 histidines.

In a specific embodiment, the method is characterized in that the histidine tag sequence encodes 9 or 12 histidines.

In a preferred embodiment, the method is characterized in that the shuttle vector is pTE2.

In a preferred embodiment, the method is characterized in that the thermophilic anaerobic archaea (Thermococcus kodakarensis) is TS559.

In a preferred embodiment, the method is characterized in that the conditions for expression are: the culture temperature is 80-90 ℃, preferably 85 ℃; the incubation time is 1-20 hours, preferably 16 hours.

The other purpose of the invention is to provide the application of the bacterial liquid obtained by any method in the first purpose of the invention in the generation of lactic acid, which is characterized in that the bacterial liquid is crushed to obtain high-temperature ferronickel hydrogenase crude enzyme liquid, the crude enzyme liquid is coupled with diaphorase and lactate dehydrogenase, a reaction system contains pyruvic acid, and hydrogen is introduced and catalyzed.

The third purpose of the invention is to provide a purification method of high-temperature ferronickel hydrogenase, which comprises the steps of crushing and purifying a bacterial liquid obtained by any one of the heterologous expression methods of the high-temperature ferronickel hydrogenase.

The fourth purpose of the invention is to provide an application of the high-temperature ferronickel hydrogenase obtained by the purification method of the third purpose of the invention in the generation of lactic acid, which is characterized in that the high-temperature ferronickel hydrogenase, diaphorase and lactate dehydrogenase are coupled, a reaction system comprises pyruvic acid, oxidized Nicotinamide Adenine Dinucleotide (NAD) and oxidized Nicotinamide Adenine Dinucleotide Phosphate (NADP), and hydrogen is introduced and catalyzed.

The fifth purpose of the invention is to provide a method for generating reduced Nicotinamide Adenine Dinucleotide (NADH) by catalyzing hydrogen, which is characterized in that high-temperature nickel iron hydrogenase obtained by the purification method of the third purpose of the invention is coupled with diaphorase, a reaction system comprises oxidized Nicotinamide Adenine Dinucleotide (NAD) and oxidized Nicotinamide Adenine Dinucleotide Phosphate (NADP), and hydrogen is introduced and catalyzed.

The sixth purpose of the invention is to provide a method for generating reduced Nicotinamide Adenine Dinucleotide (NADH) by catalyzing hydrogen, which is characterized in that a reaction system comprises oxidized Nicotinamide Adenine Dinucleotide (NAD) and oxidized Nicotinamide Adenine Dinucleotide Phosphate (NADP), hydrogen is introduced, and high-temperature nickel iron hydrogenase and diaphorase are coupled and catalyzed.

The invention discloses a heterologous expression and purification method of high-temperature ferronickel hydrogenase SHI from extreme thermophilic anaerobic archaea P.furiosus, which utilizes a shuttle vector to carry out recombinant overexpression on the other extreme thermophilic anaerobic archaea T.kodakarensis, simplifies the purification process of recombinant hydrogenase and improves the yield of hydrogenase by the specific combination of histidine tag and nickel column; and is coupled with Diaphorase (DI) containing Flavin Mononucleotide (FMN) to form a new electron transfer way, and the regeneration of coenzyme NADH is realized by using hydrogen.

The four subunits of the high-temperature ferronickel hydrogenase SHI are respectively coded by four genes positioned on the same gene cluster: alpha-PF _ RS04500 (NCBI Gene ID: 1468756), beta-PF _ RS04485 (NCBI Gene ID: 1468753), gamma-PF _ RS04490 (NCBI Gene ID: 1468754), 6-PF _ RS04495 (NCBI Gene ID: 1468755).

The host strain for the SHI heterologous expression is an improved TK0149 deletion mutant strain TS559 (delta pyrF;: delta trpE;: pyrF;: delta TK0149, santangalo TJ,

Lu，Reeve JN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，new positive-selection protocol，and targeted and repetitive deletion technology.Appl.environ.microbiol.76 (4): 1044-52.). TK0149 encodes a pyruvoyl-dependent arginine decarboxylase which decarboxylates arginine to agmatine, and deletion of this gene results in agmatine-dependent growth of the strain, so TS559 cannot grow in medium without agmatine.

The map of the shuttle expression vector is shown in figure 1, and the sequence is shown in the attached SEQ ID NO: the method specifically comprises the following six parts:

1. all sequences of plasmid pTN1, including the gene sequences encoding Rep74 and p24, ensure that the shuttle vector is capable of autonomous replication at T.kodakarensis, referenced (Santangio TJ,

Lu，Reeve JN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，new positive-selection protocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)；

2. the elements expressing the TK0149 gene, enabling transformants to grow on medium without agmatine addition, are referred to as (Santangelo TJ,

3. the origin of replication and the ampicillin resistance gene are derived from the universal vector pUC19 of the escherichia coli, so that the shuttle vector can be replicated and screened in the common escherichia coli;

4. a gene cluster encoding high temperature ferronickel hydrogenase SHI;

5. a strong promoter Pcsg capable of promoting expression of the SHI gene cluster in T.kodakarensis, as referenced (Kanai T, simons JR, tsukamoto R, nakajima A, omori Y, matsuoka R, beppu H, imanaka T, atomi H.2015.Overproduction of the membrane-bound [ NiFe ] -hydrogenic in Thermococcuskodakraensis and bits effect on hydrogen production. Front.Microbiol.6: 847);

6. polyhistidine tags (9 or 12 histidines) to enable the SHI to bind to nickel columns for further purification, reference (Chandrayan SK, wu CH, mcTernan PM, adams MWW.2015.High yield purification of a labeled cytoplasma [ NiFe ] -hydrogene and a catalytic-active-free interfacial product for. Protein expression. Purification. 107: 90-94.).

A heterologous expression and purification method of recombinant high-temperature ferronickel hydrogenase comprises the following steps: after the construction of the shuttle expression vector in E.coli Top10 was completed, the whole plasmid was transformed into T.kodakarensis host strain TS559, and then the transformed strain was cultured and protein purification was performed by nickel column affinity chromatography to obtain recombinant high temperature ferronickel hydrogenase SHI.

The culture conditions of the t.kodakarensis expression strain are preferably: culturing at 85 deg.C under anaerobic condition for 16 hr.

The recombinant high-temperature ferronickel hydrogenase is applied to coenzyme NAD ⁺ And the application in NADH circulation regeneration system.

The recombinant high-temperature ferronickel hydrogenase disclosed by the invention is applied to the catalytic production of lactic acid by Lactate Dehydrogenase (LDH) taking NAD as a coenzyme.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

the expression and purification method of the recombinant high-temperature ferronickel hydrogenase, which is established by the invention, has the characteristics of simple steps, high enzyme yield, low production cost and the like.

The recombinant high-temperature ferronickel hydrogenase has good thermal stability and long service cycle.

The coenzyme regeneration system established by the invention takes hydrogen (gas state) as a substrate, has small influence on a reaction system, does not change the pH value of a solution, and is easy to separate products.

The TS559 provided by the invention has the meaning that the genotype is delta pyrF; Δ trpE: : pyrF; an extreme thermophilic anaerobic archaea (Thermococcus kodakarensis) of Δ TK0149, (Santangio TJ,

Lu，Reeve JN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，new positive-selection protocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)

drawings

FIG. 1A is a map of the shuttle expression vector of recombinant Thermalferronickel hydrogenase SHI with 12-His tag in T.kodakarensis. B is a structural mode diagram of the recombined SHI.

Fig. 2 shows the expression and purification of recombinant high temperature ferronickel hydrogenase SHI in t. A diagram shows the enzyme activity detection of Benzyl Viologen (BV) -based hydrogenase of the supernatant of the bacteria, wherein TS559 is an empty plasmid transformation strain, and OE-SHI is a recombinant SHI over-expression strain. And B, detecting the purification result of the recombinant SHI protein by SDS-PAGE. 1: supernatant fluid; 2: flowing out; 3:20mM imidazole elution; 4: elution with 50mM imidazole; 5:75mM imidazole; 6: elution with 100mM imidazole; 7: native SHI purified from wild strain p.furiosus; 8: a recombinant SHI with a 12-histidine tag purified from t.kodakarensis. .

FIG. 3 shows the basic property test of recombinant SHI. A is a result of detecting and purifying the recombinant SHI by a Superdex-200 chromatographic column; b is a protein sample of the position of the peak marked in the A picture detected by SDS-PAGE; c is the relative enzyme activity of the recombinant SHI within the temperature range of 30-90 ℃; d is the stability test of the recombinant SHI at 80 ℃.

FIG. 4 is a schematic diagram of the cyclic regeneration of coenzyme NADH using an artificial electron transport chain composed of recombinant SHI (rSHI), DI, LDH.

FIG. 5 shows the results of the LDH-catalyzed reaction of pyruvate with hydrogen to produce L-lactate in combination with the coenzyme NADPH and NADH regeneration system. A and B are reactions with different concentrations of hydrogen as substrate, respectively, and C and D are negative controls without DI and SHI, respectively.

Detailed Description

The invention is further described below in conjunction with specific embodiments, and the advantages and features of the invention will become more apparent as the description proceeds. It is to be understood that the described embodiments are exemplary only and are not limiting upon the scope of the invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

Experimental Material

Sodium pyruvate, the product of the Aladdin company, product number: s104174;

agmatine, product of Sigma company, product number: a7127;

high temperature agar (Phytagel), product of Sigma, product number: p8169;

benzyl Viologen (BV), product of Alfa corporation, product number: h66836;

the high-purity gas is purchased from air chemical products (Tianjin);

the pTS543 vector and the t.kodakarensiss ts559 strain were gifted by professor Thomas j.santangelo of colorado state university, usa;

furiosus genome was donated by professor Michael w.w.adams, university of georgia, usa;

pUC19 vector, invitrogen, carlsbad, CA, USA;

pET20b vector, novagen, madison, wis., USA;

coli expression strain BL21 (DE 3), invitrogen, carlsbad, CA, USA;

DI (GenBank accession number JQ 040550) in the present invention is derived from Geobacillus stearothermophilus, which expresses purification references Collins J, zhang T, huston S, sun FF, zhang Y-HP, fu JL.2016.A high moisture activity of a FMN-bound diaphorase unit and aerobic conditions Ploss One 11 (5): e0154865.

LDH is derived from Thermotoga maritima and is obtained by prokaryotic expression in BL21 (DE 3) by using pET20b expression vector encoded by Gene TM1867 (NCBI Gene ID: 897800) according to genetic engineering method, and references Ostendorp R, auerbach G, jaenicke R.1996. Expression therable L (+) -lactate dehydrogenase from Thermotoga maritima: cloning, characterization, and crystallization of the recombinant enzyme in peptides and acetic acid state. Protein Sci.5 (5): 862-873.

The basic medium of the T.kodakarensis strain in the invention is an artificial sea salt medium ASW-YT [ Sato T, fukui T, atomi H, imanaka T.2003.Targeted gene displacement by homologus recombination in the hyperthermophilic archan Thermococcus kodakarensis KOD1.J.Bacteriol.185 (1): 210-220.]The method specifically comprises the following steps: 0.8 × ASW [20g/L NaCl,6g/L MgSO ₄ ·7H ₂ O，3g/L MgCl ₂ ·6H ₂ O，1g/L(NH ₄ ) ₂ SO ₄ ，0.2g/L NaHCO ₃ ，0.3g/L CaCl ₂ ·2H ₂ O，0.5g/L KCl，0.42g/L KH ₂ PO ₄ ·H ₂ O，0.05g/L NaBr，0.02g/L SrCl ₂ -6H ₂ O，0.01g/L Fe(NH ₄ ) ₂ (SO ₄ ) ₄ -6H2O]，5mL/L modified Wolfe’s trace minerals[0.5g/L MnSO ₄ ·2H ₂ O，0.1g/L CoCl ₂ ，0.1g/L ZnSO ₄ ，0.01g/L CuSO ₄ ·5H ₂ O，0.01g/L AlK(SO ₄ ) ₂ ，0.01g/L H ₃ BO ₃ ，0.05g/L NiCl ₂ ·6H ₂ O，and 0.01g/L NaMoO ₄ ·2H ₂ O]5g/L peptone, 5g/L yeast extract; 10g/L sodium pyruvate was added and the culture was carried out at 85 ℃ under anaerobic conditions. Solid medium was supplemented with 1% high temperature agar and 0.2% polysulfide polymer (10 g Na) ₂ S·9H ₂ O and 3g of sulfur powder, and distilled water is added to make the volume to 15 mL).

Experimental example 1T.kodakarensis shuttle vector construction

The present invention utilizes shuttle vectors for overexpression SHI in t.

pTS543 (plasmid derived from the reference Santangalo TJ,

Lu，Reeve JN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，new positive-selection protocol，and targeted and repetitive deletion technology, appl, environ, microbiol.76 (4): 1044-52.), the amplification of the desired fragment comprising all the sequences of plasmid pTN1 autonomously replicated in T.kodakarensis and the genetic elements expressing the selection marker gene TK0149, with primer 1 and primer 2, the sequence of primer 1 being:

GAAGCTCAGGTGGTACTTCACTCCACAATGGTTTCTTAGACGTCAGGTGGC, primer 2 sequence is:

GAATTTGCCAAATTGCCAGAATTGGCCATAGCTGTTTCCTGTGTGAAATTG; further, the replication origin and the sequence expressing the ampicillin resistance gene were amplified using pUC19 as a template and

primers

3 and 4, the sequence of primer 3 used was:

CAATTTCACACAGGAAACAGCTATGGCCAATTCTGGCAATTTGGCAAATTC, primer 4 sequence is:

GCCACCTGACGTCTAAGAAACCATTGTGGAGTGAAGTACCACCTGAGCTTC; after obtaining the above fragments, T.kodakarensis-E.coli shuttle vector pTE1 was constructed by the method of Simple Cloning (You, C., et al. (2012). "Simple Cloning via Direct Transformation of PCR products (DNA Multimer) to Escherichia coli and Bacillus subtilis." Appl.environ.Microbiol.78 (5): 1593-1595.).

Experimental example 2 construction of expression vector for recombinant high-temperature ferronickel hydrogenase SHI

Consultation of the Strong promoter P by NCBI _csg Sequence, referred to as (Kanai T, simons JR, tsukamoto R, nakajima A, omori Y, matsuoka R, beppu H, imanaka T, atomi H.2015.Overproduction of the membrane-bound [ NiFe ]]-hydrogenase in thermochoccus kodakarensis and its effect on hydrogen production. Front. Microbiol.6:847. ) Primers 5 and 6 (primer 5:

GAATTCTGCAGATATCCATCACACTGCGGCAAAAGGCGAATTATGTGTAG, primer 6:

CGGCAGTCGACTTTTTTGCGGCCGCACAACACCTCCTTGGGTTGTTGGGG) and using T.kodakarensis genome (NC-006624.1) as template for PCR amplification to obtain P _csg A fragment; in addition, primer 7 was designed using pTE1 in Experimental example 1 as a template

(CCCCAACAACCCAAGGAGGTGTTGTGCGGCCGCAAAAAAGTCGACTGCCG) and primer 8

(CTACACATAATTCGCCTTTTGCCGCAGTGTGATGGATATCTGCAGAATTC) amplifying the plasmid backbone; then, the insertion strong promoter P is constructed by the method of Simple Cloning (You, C., et al. (2012) "Simple Cloning via Direct Transformation of PCR products (DNA Multimer)" to Escherichia coli and Bacillus subtilis. "appl. Environ. Microbiol.78 (5): 1593-1595.) _csg The vector pTE2.

In order to simplify the purification method of SHI, the invention fuses 9 histidine tags at the N-terminal of PF0891, utilizes the affinity of the histidine tags with a nickel column to purify SHI, and designs a primer 9

(CACCACCATCACCACGCGGCCGCAAAAAAGTCGACTGCCG) and primer 10 (GTGATGATGATGCATACAACACCTCCTTGGGTTGTTGGGGC) insert 9 histidine tags. The method comprises the following specific steps: after the primers were phosphorylated, PCR amplification was carried out using the vector pTE2 as a template, and the amplification products were recovered and ligated with T4 ligase to obtain a 9-His-containing vector pTE3.

Design of primer 11 by consulting the Gene sequence of SHI through NCBI

(CCATCACCATCACCACCATCACCACAGGTATGTTAAGTTACCCAAGGAAAAC) and primer 12

(CGGCAGTCGACTTTTTTGCGGCCGCGGCATTGTTATCATCTCCTCAAGAG) performing PCR amplification using P.furiosus genome (DSM 3638, AE009950) as a template to obtain a target fragment; and using the vector pTE3 as a template and the primer 13

(CTCTTGAGGAGATGATAACAATGCCGCGGCCGCAAAAAAGTCGACTGCCG) and primer 14

(GTTTTCCTTGGGTAACTTAACATACCTGTGGTGATGGTGGTGATGGTGATGG) amplifying the plasmid backbone; the recombinant SHI expression vector pTE4 was then constructed by the method of Simple Cloning (You, C., et al. (2012), "Simple Cloning via Direct Transformation of PCR products (DNA Multimer) to Escherichia coli and Bacillus subtilis." appl.environ.Microbiol.78 (5): 1593-1595.).

The expression vector pTE5 of 12 histidine tags is specifically constructed by the following steps: with phosphorylated primer 15

(CATCACCACCATCACCACGCGGCCGCAAAAAAGTCGACTGCCG) and primer 16

(GTGATGGTGATGATGATGCATACAACACCTCCTTGGGTTGTTGGGGC) and PCR amplification was carried out using the vector pTE4 as a template, and the amplification product was recovered and ligated with T4 ligase to obtain a 12-His-containing vector pTE5.

EXAMPLE 3 detection of hydrogenase enzyme Activity

The hydrogenase detection method based on benzyl viologen BV adopted in the invention is as follows: to a 3ml sealed cuvette was added 2ml of the reaction mixture (1mM BV,100mM EPPS, pH 8.4), and the anaerobic flask was filled with a 3% hydrogen gas mixture (nitrogen: hydrogen = 97: 3). After preheating the reaction solution and the enzyme sample at 85 ℃ respectively, the enzyme was added to start the reaction. The reaction was carried out in a temperature-controlled 100Cary UV-Vis spectrophotometer (Agilent), the temperature was maintained at 85 ℃ and the change in absorbance at 578nm, i.e., the amount of reduced BV produced, was detected in real time. The enzyme activity of 1U is equivalent to oxidizing 1. Mu. Mol of hydrogen or reducing 2. Mu. Mol of BV within 1 min.

As a method for detecting hydrogenase using another electron carrier (NADP, methyl viologen MV, etc.), the above-mentioned detection method is referred to.

Experimental example 4 obtaining of recombinant high-temperature Nickel-iron hydrogenase SHI-expressing Strain

The expression vectors pTE4 and pTE5 of the recombinant SHI described in Experimental example 2 and the control vector pTE3 were transferred into the host strain T.kodakarensis TS559 in the following manner (all performed under anaerobic conditions): TS559 was cultured in ASW-YT-Pyr medium supplemented with 1mM agmatine at 85 ℃ under anaerobic conditions until OD ≈ 0.6, 8000rpm, centrifuged for 5 minutes, and the cells were collected and the supernatant was discarded; then, the cells were resuspended in 0.8 × ASW buffer and kept on ice for 30 minutes; will be about 4X 10 ⁸ Subpackaging the cells into 1.5mL centrifuge tubes, adding 3ug of the SHI expression vector pTE4 or pTE5 described in Experimental example 2, and standing on ice for 1 hour; then, the cells were heat-shocked at 85 ℃ for 45 seconds, left on ice for 10 minutes, added with 1.3mL of a modified ASW-YT liquid medium (with 0.2% of a polysulfide polymer added), thawed at 85 ℃ for 2 hours, centrifuged at 8000rpm for 5 minutes, collected, discarded, resuspended in 200. Mu.L of 0.8 XASW, and spread on ASW-YT solid medium without agmatine. Anaerobic culture is carried out for 2-3 days at 85 ℃, and single colony is selected for PCR verification to obtain the expression strain of the recombinant SHI and an empty vector negative control strain.

Experimental example 5 expression purification of recombinant high-temperature ferronickel hydrogenase SHI

The protein expression and purification processes of the recombinant SHI are all carried out in an anaerobic environment.

The recombinant SHI-expressing strain obtained in Experimental example 4 was liquid-expanded, transferred to an anaerobic jar containing 5L of ASW-YT-Pyr medium at 1% inoculum size, and anaerobically cultured at 85 ℃ for about 16 hours at OD ₆₀₀ About 1.5;8000rpm, centrifuging for 20 minutes, collecting thalli, and discarding supernatant; phosphate buffer (50mM PBS, pH 8.0) was added to resuspend the cells, and the cells were frozen at-20 ℃.

And (3) melting the frozen thallus, adding 50ug/ml DnaseI and a proper amount of quartz sand, carrying out vortex oscillation for 20 minutes to break cells, centrifuging at 10000rpm for 1 hour, taking the supernatant, and carrying out hydrogenase activity detection and next protein purification.

According to the detection method in the experimental example 3, the supernatant enzyme activity of 9-His-SHI is 13.4U/mg, the supernatant enzyme activity of 12-His-SHI is 23.6U/mg, and the supernatant enzyme activity of the control bacterium transferred into the empty vector is 0.01U/mg.

And (3) taking the 12-His-SHI supernatant, and performing protein purification by using nickel column affinity chromatography. Gradient elution is carried out by using imidazole with different concentrations respectively. The protein purification buffer was 50mM PBS,300mM NaCl, pH8.0.

The results of 12-His-SHI purification are shown in FIG. 2, which are substantially identical to that of purified SHI from wild type P.furiosus, and the protein purity is better

Experimental example 6 basic Properties of recombinant high-temperature ferronickel hydrogenase SHI

The 12-His-SHI purified in Experimental example 5 was analyzed.

First, 12-His-SHI was analyzed by Superdex-200 column, and the results are shown in FIG. 3A, where most of the recombinant SHI was concentrated at a molecular weight of about 150kDa, which is consistent with the sum of the molecular weights of its four subunits (. Alpha. Beta. Gamma. Delta.). In addition, a small peak appears at the higher molecular weight position, indicating that a small portion of the recombinant SHI may form multimers with higher degree of polymerization.

The activity of recombinant SHI was measured at 30-90 ℃ by the method described in Experimental example 3. As shown in FIG. 3C, the enzyme activity was highest at about 80 ℃ but was still active at 30 ℃ and the half-life of recombinant SHI was about 80 hours at 80 ℃ (FIG. 3D).

Experimental example 7 application of recombinant high-temperature ferronickel hydrogenase SHI in lactic acid production

LDH (NCBI Gene ID: 897800) and DI (GenBank accession number JQ 040550) used for the reactions, each encoding Gene was inserted between NdeI and XholI of pET20b using the method of Simple Cloning (You, C., et al (2012) 'Simple Cloning via Direct Transformation of PCR Product (DNA Multi) to Escherichia coli and Bacillus subtilis.' Appl.Environ.Microbiol.78 (5): 1593-1595.), expressed in E.coli BL21 (DE 3) and protein purification.

The 12-His-SHI purified in Experimental example 5, and LDH and DI purified in E.coli were used to perform the lactic acid production from propionic acid, and the reaction process is shown in FIG. 4.

In a 2ml closed anaerobic reaction system, 100mM HEPES buffer (pH 7.4), 5mM MgCl ₂ ，1mM NAD ⁺ ，1mM NADP ⁺ 60mM pyruvic acid (sodium pyruvate), 0.1mg/mL LDH,0.1mg/mL SHI and 0.25mg/mL DI, and the gas composition in the reaction system was 3% hydrogen/97% nitrogen or filled with hydrogen entirely. The catalytic reaction was carried out at 50 ℃ for 18 hours.

The negative control group had no DI added, or no SHI added.

HPLC can be used to distinguish pyruvic acid from lactic acid in the reaction solution according to the retention time; and can quantify pyruvate and lactate; the mobile phase of the HPLC was 5mM dilute sulfuric acid.

After the reaction, the final lactic acid concentration reached 60mM in FIGS. 5A and 5B, the conversion was 100%, and 60 hydrogen transfers were carried out between NAD and NADP.

When all the introduced gas is hydrogen, the reaction rate is higher.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> heterologous expression and purification method of recombinant high-temperature ferronickel hydrogenase and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10757

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 60

tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 120

gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 180

tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 240

aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 300

cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 360

agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 420

ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 480

tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 540

tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 600

caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 660

accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 720

attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 780

ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 840

taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 900

taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 960

aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 1020

agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 1080

ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 1140

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 1200

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 1260

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 1320

tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 1380

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 1440

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 1500

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 1560

acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 1620

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 1680

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 1740

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 1800

ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 1860

taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 1920

cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc 1980

gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 2040

tgagcgcaac gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt 2100

tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 2160

cagctatggc caattctggc aatttggcaa attcgacaaa tttgccactg ttatggcact 2220

gttatggtat tgtgatacca attttttggg gtctggtacc ttactacttc ttgccaactt 2280

ctgccaagtt ctgccaattc ttgccagtgt tgatgtgtcc gttttgttcc taattctcca 2340

gttttctggt tcactgctta aatactcctc tgccgtagct ctgtctgacg gtgcctcacc 2400

gtctttgagc taaaatcagg ggtgagagtt gtggtcgagt tggtgagact ggacggttcg 2460

gtgaactttg gagacggtgc cgaggtagtg agtgtttggt tgaataagct tagtgatttc 2520

gagaagctga agtccacctt cggcggtatc ttttcaacgt cggagacgtc gaagggtgtt 2580

ctttactcgt tgtttgttcc gtctttccgt gtgaggttcc tttgtcttgt gcgaggtggt 2640

ggagatggaa agcggtgaga atacgccttt caagaagttt atttgcctac actgtgggca 2700

cgtctttgac agtgataggg acgcgccgaa gtgtccgaac tgtggccgta ggaaagttat 2760

tccgcttgag actcttggtg agtctctcag gaagcacaag gataagttaa aggaactcgg 2820

tgttcttcct gagcctgacc ctgagcctca ggagactgag gttggaaagg ctgaggttga 2880

gactgctggc cagaaggacc ctgagacttc gaagcctgag cctatccagg ttgagcagaa 2940

ggttgaggag ttaaaaccgg agtctgacca ggagcctcaa aactctgagt ctgtggactc 3000

tccagatgat gttcctgagt cagataagct tcttgctaaa tatctcgaag agcttgagga 3060

cgttcctgcg aaacctaagc ctaagaagtt gaggccaaag aaatctaaga ggtccatcac 3120

tgttcccgca ggtccttcct tcctcgaagt cctcatcatc atcggggcta tagtcctcat 3180

atggaagtgg ttatcttcga ggtcctcaaa gtctgatgat gagtccaacg ttccgaggcc 3240

ttctgagacc tattatcaga ttcagcggaa tctcggtcat cacgttcttg ggtgatggtt 3300

atggccgaag acaagaagaa atccaggagc tgggtagagg ttgctttcta ccttttcatc 3360

gctttggttg ttatctgggt gttcgtcagg gcactcaaga agtctcagaa cgtgatacta 3420

tggaaccctg agcttggcct cagactcctg gaaaaatctc tctcaaaact tggattcttg 3480

gggaaaagta taaatacgat ttgattctca ctactatttg cgggacgtgg taccgatgcc 3540

gaagccgacc aggagaccat cagaaatcct tcagtggttc cgggaacacc ctggcgaagt 3600

tacctctctc aaggctctat ctctcaatct caatatccct tacaacactg tattcgttgt 3660

tgttaagaag ctggttgaag agggtaagct taggaaggtt ggtcgtggtc tctacacttt 3720

ggctgatgaa gaatcagatg ctgacgataa tagaagggga ggcaccaacg cgggacgtgg 3780

taccgatgcc tccccttcct aaagaatccc aacaggaggg gattcgcgta tgaggttaag 3840

taattcctct ataaattctt tgctgtcatc ggggtcttgt gatgttgtgg gtagctcacc 3900

gagtggctca cccttcctac ctcagtctac tggttcgact cagaagacgc ttagcgttta 3960

tcttgatata tctccaacca atgaaaaggg tgagccatct gtaagaggtc ctactatccg 4020

ggtttcttct catcctctcc ctgcctatgc ctactatcgc tctgctactg gccatctcga 4080

acgccagaaa tttgaatccc agggtcgcgt caagattgac atctataaac ttcggaagaa 4140

actcttctgg attaggcgta gacttgagcg tgtggacctt actgatgagg agcgctcctc 4200

tcttgaggct gagcgagacc gtttggtttc tcttactgag aagttgctca ggaaaatcta 4260

ctccggttct gctctttatg gtgaccgctt tgttattgat gtccccgtag cttattctca 4320

actctgtaaa gctcttggga ttaatccgtc tgatgtaggg gtctctctat ttgttcggtc 4380

tgcagttatg gatttggaat ttgatgactc ctcccgttct gctcttaaaa ttagttatgt 4440

atcccgtctt tttgctggta aataccatcc tgctaagggt atatctaagg gctttaagga 4500

ggctcgtagg gtagttcgcg atttacttgt tctccaagaa tttctcgatg gttctctcct 4560

ttcctaccat aagggtgatt atgtcacctc taatagtctt ctacctatga ggttctttgt 4620

cctgactctt cccgaagaaa tcagctatta tatctggtcc aagcttcgtg agggggatga 4680

ttcagctcta aagctcttta agaaaattag ttctcaagcg attagagact tcctctttta 4740

ccttgctcaa aaagagggaa tcccaattaa caaatcctat tttgtccccg ggttccttca 4800

gaatattcat cccactggag acagggaccc gtttaagcct cacttccacg ctcacttctc 4860

tgttgttttc gttgtttatg ataagtcgtc tcatacgtgg taccgtttga atcctgtcct 4920

tgatgaggcg gatcttgaga agttgagaga aatctggaaa gctcttgtag ttgaggcttt 4980

ctctgaaatt ctttcggggg atactctcac aaaggacttc aatgtttggg tgggcgatag 5040

gtattactct cttcctcacg actacgttgg agttctcttc gaaataaagt ataatgctcg 5100

caagatgttt gtgaactatt cgagttacta tgagcgcaat tctttctccg atgactttga 5160

taggtccttt gtgagtttca tctttgatta taagaaccgg actgagaggt atggtttcct 5220

cacaaacatc aaacgttatc tctctcgtct ttcaatttct gctgtcaaga aacgtcttga 5280

ggaacttcgg gagcttttag atagaatcga ggctgatttg ctcgttgttg atagtggtag 5340

gttccctctc ctttatcagt ctctcttgga taaacgagag gctgttcaat ctgaaatttc 5400

ccgtcttgaa tctgtgttga acaatccgga tgatgctttc cgtgttctct atgatgaaat 5460

ctctcgtgat gttgagtcta tgctttctcc tcgtactgtt aaagagaatc ggattgtttc 5520

tttgttggag agtcttcacg gaaaacgggt tgttggtctc tctgttgagt atatccgtta 5580

ccttacccgt gacggtgaag aagttttgga tgttcctctt cacaaattcc ttgaggctcg 5640

tcgctcggta gttcttcttt cggatagaca taaaactgtg gagtttatgc tgtggtggga 5700

cccgttctgg gaggacccac cagatgtgtt agaactgaaa attccaaatt cctgaaaggg 5760

cgaattctgc agatatccat cacactgcgg caaaaggcga attatgtgta ggcattaggt 5820

taagccttct tttcattttt acggcaatca gcgagctttt tttggccgct gaaagggtct 5880

gaaagcgaaa agtatttaaa ccccaagtgg ccagataggt atgacaacac ttagtagggg 5940

ctaaagcccc aacaacccaa ggaggtgttg tatgcatcat catcaccatc accatcacca 6000

ccatcaccac aggtatgtta agttacccaa ggaaaacact tacgagtttt tggaaagact 6060

taaagactgg gggaagcttt acgctccagt aaaaatttcg gacaagttct atgacttcag 6120

ggagattgat gatgttagaa agatagaatt ccactacaac aggacaataa tgccacctaa 6180

gaagttcttc ttcaagccga gggaaaagct ctttgagttc gacatttcaa aaccagaata 6240

cagggaggta atagaggaag ttgaaccatt tattatattt ggagtccacg cgtgtgacat 6300

atatggccta aagatcctag acacggtata ccttgatgag ttccccgaca agtactacaa 6360

ggtgaggaga gagaagggga taatcattgg aataagctgt atgccagatg aatattgctt 6420

ctgtaactta agagaaacag acttcgctga tgatggtttt gacttgttct tccatgaact 6480

gcccgatgga tggttggtaa gggttggcac tccaactggg cacaggcttg ttgacaagaa 6540

cataaagctc tttgaagagg taacggacaa ggatatctgt gcatttagag attttgaaaa 6600

gaggagacag caagcattca aataccacga agactggggc aacttgaggt atcttctcga 6660

gttggaaatg gaacatccaa tgtgggatga ggaggcagat aagtgcttgg cttgtggaat 6720

atgtaacacc acatgcccaa cgtgtagatg ctatgaagtt caggatattg taaacctaga 6780

tggagttact ggatacaggg aaagaagatg ggattcttgt cagttcagaa gtcatggctt 6840

agttgctggg ggccacaact tcaggcccac aaagaaggat cgctttagga acagatacct 6900

ctgtaagaac gcatataacg aaaagcttgg attaagctac tgtgtcggtt gtggaaggtg 6960

tactgcattc tgtccagcca atataagttt tgtaggcaat cttagaagga ttttaggact 7020

tgaggagaac aaatgtcccc caacggttag tgaggagatt ccaaagagag gatttgcata 7080

ttcctctaac attagaggtg atggagtatg atgttgccaa aagagattat gatgccaaat 7140

gataatccgt atgcccttca tagagtcaaa gttctaaagg tttactcctt gacggaaacg 7200

gaaaagcttt tcctctttag atttgaggat cccgagttgg cagagaagtg gacgttcaaa 7260

cctggacagt ttgtccagct gacgatacct ggagttggag aggttcccat aagtatatgc 7320

tcttctccaa tgaggaaagg attctttgag ctctgtataa gaaaggcagg aagggtcaca 7380

actgttgtcc atagactaaa gcctggcgat actgttcttg tgagagggcc ttacggtaat 7440

ggattcccag tggatgagtg ggaaggaatg gatctactat taatagctgc tggccttgga 7500

actgcacctc ttaggagcgt ctttctctat gcaatggaca acaggtggaa gtatggaaac 7560

attaccttca taaacaccgc acgttatggg aaggatctcc tcttctacaa ggagctggag 7620

gcaatgaaag acctagctga ggctgaaaac gtgaaaatca tccagagcgt cactagggat 7680

ccaaactggc cgggcctaaa gggtaggcca cagcagttca tcgttgaggc caacacaaat 7740

ccaaagaaca ctgcagttgc aatctgtggg cctcctagaa tgtataagtc agtgtttgag 7800

gccctcatca actacggtta tcgcccagag aacatcttcg tgacattgga gagaagaatg 7860

aaatgtggaa tcgggaagtg cggccactgc aacgtcggaa cgagcacgag ctggaagtac 7920

atctgtaaag atggaccagt cttcacgtac ttcgacatag tttcaacccc aggactgctg 7980

gactgaggtg aggaaaatgg gaaaagttag gattggattt tacgcattaa cctcgtgcta 8040

cggctgtcaa ttgcagctag ctatgatgga cgagttatta caacttatcc caaatgctga 8100

aatagtttgc tggttcatga ttgatagaga tagcattgag gatgaaaagg tcgacatagc 8160

ttttatagaa ggaagcgttt caactgagga agaagttgaa ctcgtgaaaa aaattaggga 8220

gaatgcaaag atcgtcgttg cggttggagc ttgtgctgtt caaggaggag ttcagagctg 8280

gagtgaaaag ccattagaag agctctggaa gaaggtttat ggagacgcaa aagtcaagtt 8340

ccaaccgaag aaggctgaac cagtttcaaa atacataaaa gttgactaca acatctacgg 8400

ttgcccacca gagaagaagg acttcctcta cgccctggga acattcttga ttggttcatg 8460

gccagaggat atagattatc cagtttgtct agaatgtagg ctcaatggac atccatgtat 8520

ccttcttgag aaaggagaac cctgtctagg tccagtaaca agggcaggat gtaacgcgag 8580

atgtccagga tttggagttg cgtgtatagg atgcagaggg gcaatagggt acgatgtagc 8640

ttggttcgac tctctagcta aggtgttcaa ggagaagggg atgacaaaag aggagataat 8700

tgagagaatg aaaatgttca atggacatga tgagagggtt gagaaaatgg ttgaaaaaat 8760

attctcaggt ggtgaacaat gaagaacctc tatcttccaa tcaccattga tcatatagca 8820

agagttgagg ggaagggtgg tgtggagata ataattgggg atgatggagt caaggaggtc 8880

aagctaaaca taattgaagg gcccagattc tttgaggcca taactattgg gaagaagctt 8940

gaggaagctc tggccattta cccgagaata tgctcattct gttcagccgc ccacaagtta 9000

accgcattag aggctgcaga aaaggccgtc ggttttgtcc caagggaaga gatacaggcc 9060

cttagagaag tactatacat cggagacatg atagagagtc atgcccttca cctatatctt 9120

ctagttcttc ccgactacag gggctactcg agcccactta agatggtgaa tgaatacaag 9180

agggagatag agatagccct taagctgaag aaccttggca cctggatgat ggacattcta 9240

gggtcaagag ccatacacca agaaaatgcg gttttgggcg gattcggaaa gctccctgag 9300

aagagtgtcc ttgagaaaat gaaagccgag cttagggaag ccctaccact tgccgagtat 9360

acttttgagt tatttgcaaa gcttgagcag tacagcgaag ttgaagggcc aataacacac 9420

ttggccgtga agccgagggg agatgcttat ggaatttatg gagattacat aaaggcaagt 9480

gatggggagg agttcccaag tgaaaagtac agagattata taaaggagtt cgtcgttgaa 9540

cacagttttg caaagcacag tcactacaag ggcagaccct tcatggttgg ggctatatct 9600

agagttatta acaatgctga cctcctatac ggcaaggcca aggagctgta tgaggcaaac 9660

aaagacctat taaagggaac aaatccgttt gcaaataact tagcccaggc cctcgaaata 9720

gtttacttta tagagagggc aatagatctg ctcgacgagg ctctcgccaa gtggccaatt 9780

aagcccaggg atgaagttga gataaaggac ggctttggtg tctcaacgac tgaggctcca 9840

aggggaatct tagtctatgc cctcaaagtt gagaatggaa gggtttctta tgccgacata 9900

ataacaccta cagcattcaa cttggcaatg atggaagaac atgtaagaat gatggcagaa 9960

aagcactaca atgacgatcc agaaaggtta aagatactgg ctgagatggt tgttagggct 10020

tatgatccat gcatatcttg ctcagtccac gtggttagac tttaagtgag ggcgcggccg 10080

caaaaaagtc gactgccgca acgcgcattt tgctcacccg aaaattttta aatactaagg 10140

gttaatttaa tctcgagcgt ttgagtcctt ctgacggctc ttggagaggg ccgttaaaaa 10200

ggtgatgcat atgagctgga caaccccaaa gagagctttt ataggtgccg caaccgctga 10260

gggagggact aagctgaacg cctttgacaa cgcactcctc aagctgggca taggaaacgt 10320

taacctggtc aagctaagca gcgttattcc cgcacatatc gagtggatgg agaaggtaca 10380

cgacgttccg ataggaatgc tcctgccgac agtttacgcc cacatcgaga gcgacgagcc 10440

ggggatgacg ataagcgccg cactgggcgt cgggataagc aagaacaacg aaggcggtct 10500

gatctacgag tattcgggct actgcaccaa ggaagaagcc gaggaaatgg tcaggaagat 10560

ggtcgaagaa ggcttcaggc agaggggctg ggagctcggt gagttcaagg ttgcaagcgc 10620

cgagataacc gtcaaggaca agccagccgc cgcaatagcg gtcgtcgtca tgttccccta 10680

ctgaactttt tcttttctca ccaaagtgta ttcgtctttt cccgttcttt cgaagctcag 10740

gtggtacttc actccac 10757

<210> 2

<211> 4058

<212> DNA

<213> Pyrococcus furiosus

<400> 2

gtgaggtatg ttaagttacc caaggaaaac acttacgagt ttttggaaag acttaaagac 60

tgggggaagc tttacgctcc agtaaaaatt tcggacaagt tctatgactt cagggagatt 120

gatgatgtta gaaagataga attccactac aacaggacaa taatgccacc taagaagttc 180

ttcttcaagc cgagggaaaa gctctttgag ttcgacattt caaaaccaga atacagggag 240

gtaatagagg aagttgaacc atttattata tttggagtcc acgcgtgtga catatatggc 300

ctaaagatcc tagacacggt ataccttgat gagttccccg acaagtacta caaggtgagg 360

agagagaagg ggataatcat tggaataagc tgtatgccag atgaatattg cttctgtaac 420

ttaagagaaa cagacttcgc tgatgatggt tttgacttgt tcttccatga actgcccgat 480

ggatggttgg taagggttgg cactccaact gggcacaggc ttgttgacaa gaacataaag 540

ctctttgaag aggtaacgga caaggatatc tgtgcattta gagattttga aaagaggaga 600

cagcaagcat tcaaatacca cgaagactgg ggcaacttga ggtatcttct cgagttggaa 660

atggaacatc caatgtggga tgaggaggca gataagtgct tggcttgtgg aatatgtaac 720

accacatgcc caacgtgtag atgctatgaa gttcaggata ttgtaaacct agatggagtt 780

actggataca gggaaagaag atgggattct tgtcagttca gaagtcatgg cttagttgct 840

gggggccaca acttcaggcc cacaaagaag gatcgcttta ggaacagata cctctgtaag 900

aacgcatata acgaaaagct tggattaagc tactgtgtcg gttgtggaag gtgtactgca 960

ttctgtccag ccaatataag ttttgtaggc aatcttagaa ggattttagg acttgaggag 1020

aacaaatgtc ccccaacggt tagtgaggag attccaaaga gaggatttgc atattcctct 1080

aacattagag gtgatggagt atgatgttgc caaaagagat tatgatgcca aatgataatc 1140

cgtatgccct tcatagagtc aaagttctaa aggtttactc cttgacggaa acggaaaagc 1200

ttttcctctt tagatttgag gatcccgagt tggcagagaa gtggacgttc aaacctggac 1260

agtttgtcca gctgacgata cctggagttg gagaggttcc cataagtata tgctcttctc 1320

caatgaggaa aggattcttt gagctctgta taagaaaggc aggaagggtc acaactgttg 1380

tccatagact aaagcctggc gatactgttc ttgtgagagg gccttacggt aatggattcc 1440

cagtggatga gtgggaagga atggatctac tattaatagc tgctggcctt ggaactgcac 1500

ctcttaggag cgtctttctc tatgcaatgg acaacaggtg gaagtatgga aacattacct 1560

tcataaacac cgcacgttat gggaaggatc tcctcttcta caaggagctg gaggcaatga 1620

aagacctagc tgaggctgaa aacgtgaaaa tcatccagag cgtcactagg gatccaaact 1680

ggccgggcct aaagggtagg ccacagcagt tcatcgttga ggccaacaca aatccaaaga 1740

acactgcagt tgcaatctgt gggcctccta gaatgtataa gtcagtgttt gaggccctca 1800

tcaactacgg ttatcgccca gagaacatct tcgtgacatt ggagagaaga atgaaatgtg 1860

gaatcgggaa gtgcggccac tgcaacgtcg gaacgagcac gagctggaag tacatctgta 1920

aagatggacc agtcttcacg tacttcgaca tagtttcaac cccaggactg ctggactgag 1980

gtgaggaaaa tgggaaaagt taggattgga ttttacgcat taacctcgtg ctacggctgt 2040

caattgcagc tagctatgat ggacgagtta ttacaactta tcccaaatgc tgaaatagtt 2100

tgctggttca tgattgatag agatagcatt gaggatgaaa aggtcgacat agcttttata 2160

gaaggaagcg tttcaactga ggaagaagtt gaactcgtga aaaaaattag ggagaatgca 2220

aagatcgtcg ttgcggttgg agcttgtgct gttcaaggag gagttcagag ctggagtgaa 2280

aagccattag aagagctctg gaagaaggtt tatggagacg caaaagtcaa gttccaaccg 2340

aagaaggctg aaccagtttc aaaatacata aaagttgact acaacatcta cggttgccca 2400

ccagagaaga aggacttcct ctacgccctg ggaacattct tgattggttc atggccagag 2460

gatatagatt atccagtttg tctagaatgt aggctcaatg gacatccatg tatccttctt 2520

gagaaaggag aaccctgtct aggtccagta acaagggcag gatgtaacgc gagatgtcca 2580

ggatttggag ttgcgtgtat aggatgcaga ggggcaatag ggtacgatgt agcttggttc 2640

gactctctag ctaaggtgtt caaggagaag gggatgacaa aagaggagat aattgagaga 2700

atgaaaatgt tcaatggaca tgatgagagg gttgagaaaa tggttgaaaa aatattctca 2760

ggtggtgaac aatgaagaac ctctatcttc caatcaccat tgatcatata gcaagagttg 2820

aggggaaggg tggtgtggag ataataattg gggatgatgg agtcaaggag gtcaagctaa 2880

acataattga agggcccaga ttctttgagg ccataactat tgggaagaag cttgaggaag 2940

ctctggccat ttacccgaga atatgctcat tctgttcagc cgcccacaag ttaaccgcat 3000

tagaggctgc agaaaaggcc gtcggttttg tcccaaggga agagatacag gcccttagag 3060

aagtactata catcggagac atgatagaga gtcatgccct tcacctatat cttctagttc 3120

ttcccgacta caggggctac tcgagcccac ttaagatggt gaatgaatac aagagggaga 3180

tagagatagc ccttaagctg aagaaccttg gcacctggat gatggacatt ctagggtcaa 3240

gagccataca ccaagaaaat gcggttttgg gcggattcgg aaagctccct gagaagagtg 3300

tccttgagaa aatgaaagcc gagcttaggg aagccctacc acttgccgag tatacttttg 3360

agttatttgc aaagcttgag cagtacagcg aagttgaagg gccaataaca cacttggccg 3420

tgaagccgag gggagatgct tatggaattt atggagatta cataaaggca agtgatgggg 3480

aggagttccc aagtgaaaag tacagagatt atataaagga gttcgtcgtt gaacacagtt 3540

ttgcaaagca cagtcactac aagggcagac ccttcatggt tggggctata tctagagtta 3600

ttaacaatgc tgacctccta tacggcaagg ccaaggagct gtatgaggca aacaaagacc 3660

tattaaaggg aacaaatccg tttgcaaata acttagccca ggccctcgaa atagtttact 3720

ttatagagag ggcaatagat ctgctcgacg aggctctcgc caagtggcca attaagccca 3780

gggatgaagt tgagataaag gacggctttg gtgtctcaac gactgaggct ccaaggggaa 3840

tcttagtcta tgccctcaaa gttgagaatg gaagggtttc ttatgccgac ataataacac 3900

ctacagcatt caacttggca atgatggaag aacatgtaag aatgatggca gaaaagcact 3960

acaatgacga tccagaaagg ttaaagatac tggctgagat ggttgttagg gcttatgatc 4020

catgcatatc ttgctcagtc cacgtggtta gactttaa 4058

<210> 3

<211> 367

<212> PRT

<213> Pyrococcus furiosus

<400> 3

Met Arg Tyr Val Lys Leu Pro Lys Glu Asn Thr Tyr Glu Phe Leu Glu

1 5 10 15

Arg Leu Lys Asp Trp Gly Lys Leu Tyr Ala Pro Val Lys Ile Ser Asp

20 25 30

Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val Arg Lys Ile Glu Phe

35 40 45

His Tyr Asn Arg Thr Ile Met Pro Pro Lys Lys Phe Phe Phe Lys Pro

50 55 60

Arg Glu Lys Leu Phe Glu Phe Asp Ile Ser Lys Pro Glu Tyr Arg Glu

65 70 75 80

Val Ile Glu Glu Val Glu Pro Phe Ile Ile Phe Gly Val His Ala Cys

85 90 95

Asp Ile Tyr Gly Leu Lys Ile Leu Asp Thr Val Tyr Leu Asp Glu Phe

100 105 110

Pro Asp Lys Tyr Tyr Lys Val Arg Arg Glu Lys Gly Ile Ile Ile Gly

115 120 125

Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys Asn Leu Arg Glu Thr

130 135 140

Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Phe His Glu Leu Pro Asp

145 150 155 160

Gly Trp Leu Val Arg Val Gly Thr Pro Thr Gly His Arg Leu Val Asp

165 170 175

Lys Asn Ile Lys Leu Phe Glu Glu Val Thr Asp Lys Asp Ile Cys Ala

180 185 190

Phe Arg Asp Phe Glu Lys Arg Arg Gln Gln Ala Phe Lys Tyr His Glu

195 200 205

Asp Trp Gly Asn Leu Arg Tyr Leu Leu Glu Leu Glu Met Glu His Pro

210 215 220

Met Trp Asp Glu Glu Ala Asp Lys Cys Leu Ala Cys Gly Ile Cys Asn

225 230 235 240

Thr Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val Gln Asp Ile Val Asn

245 250 255

Leu Asp Gly Val Thr Gly Tyr Arg Glu Arg Arg Trp Asp Ser Cys Gln

260 265 270

Phe Arg Ser His Gly Leu Val Ala Gly Gly His Asn Phe Arg Pro Thr

275 280 285

Lys Lys Asp Arg Phe Arg Asn Arg Tyr Leu Cys Lys Asn Ala Tyr Asn

290 295 300

Glu Lys Leu Gly Leu Ser Tyr Cys Val Gly Cys Gly Arg Cys Thr Ala

305 310 315 320

Phe Cys Pro Ala Asn Ile Ser Phe Val Gly Asn Leu Arg Arg Ile Leu

325 330 335

Gly Leu Glu Glu Asn Lys Cys Pro Pro Thr Val Ser Glu Glu Ile Pro

340 345 350

Lys Arg Gly Phe Ala Tyr Ser Ser Asn Ile Arg Gly Asp Gly Val

355 360 365

<210> 4

<211> 292

<212> PRT

<213> Pyrococcus furiosus

<400> 4

Met Met Leu Pro Lys Glu Ile Met Met Pro Asn Asp Asn Pro Tyr Ala

1 5 10 15

Leu His Arg Val Lys Val Leu Lys Val Tyr Ser Leu Thr Glu Thr Glu

20 25 30

Lys Leu Phe Leu Phe Arg Phe Glu Asp Pro Glu Leu Ala Glu Lys Trp

35 40 45

Thr Phe Lys Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly Val Gly

50 55 60

Glu Val Pro Ile Ser Ile Cys Ser Ser Pro Met Arg Lys Gly Phe Phe

65 70 75 80

Glu Leu Cys Ile Arg Lys Ala Gly Arg Val Thr Thr Val Val His Arg

85 90 95

Leu Lys Pro Gly Asp Thr Val Leu Val Arg Gly Pro Tyr Gly Asn Gly

100 105 110

Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile Ala Ala

115 120 125

Gly Leu Gly Thr Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala Met Asp

130 135 140

Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala Arg Tyr

145 150 155 160

Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Met Lys Asp Leu

165 170 175

Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg Asp Pro

180 185 190

Asn Trp Pro Gly Leu Lys Gly Arg Pro Gln Gln Phe Ile Val Glu Ala

195 200 205

Asn Thr Asn Pro Lys Asn Thr Ala Val Ala Ile Cys Gly Pro Pro Arg

210 215 220

Met Tyr Lys Ser Val Phe Glu Ala Leu Ile Asn Tyr Gly Tyr Arg Pro

225 230 235 240

Glu Asn Ile Phe Val Thr Leu Glu Arg Arg Met Lys Cys Gly Ile Gly

245 250 255

Lys Cys Gly His Cys Asn Val Gly Thr Ser Thr Ser Trp Lys Tyr Ile

260 265 270

Cys Lys Asp Gly Pro Val Phe Thr Tyr Phe Asp Ile Val Ser Thr Pro

275 280 285

Gly Leu Leu Asp

290

<210> 5

<211> 261

<212> PRT

<213> Pyrococcus furiosus

<400> 5

Met Gly Lys Val Arg Ile Gly Phe Tyr Ala Leu Thr Ser Cys Tyr Gly

1 5 10 15

Cys Gln Leu Gln Leu Ala Met Met Asp Glu Leu Leu Gln Leu Ile Pro

20 25 30

Asn Ala Glu Ile Val Cys Trp Phe Met Ile Asp Arg Asp Ser Ile Glu

35 40 45

Asp Glu Lys Val Asp Ile Ala Phe Ile Glu Gly Ser Val Ser Thr Glu

50 55 60

Glu Glu Val Glu Leu Val Lys Lys Ile Arg Glu Asn Ala Lys Ile Val

65 70 75 80

Val Ala Val Gly Ala Cys Ala Val Gln Gly Gly Val Gln Ser Trp Ser

85 90 95

Glu Lys Pro Leu Glu Glu Leu Trp Lys Lys Val Tyr Gly Asp Ala Lys

100 105 110

Val Lys Phe Gln Pro Lys Lys Ala Glu Pro Val Ser Lys Tyr Ile Lys

115 120 125

Val Asp Tyr Asn Ile Tyr Gly Cys Pro Pro Glu Lys Lys Asp Phe Leu

130 135 140

Tyr Ala Leu Gly Thr Phe Leu Ile Gly Ser Trp Pro Glu Asp Ile Asp

145 150 155 160

Tyr Pro Val Cys Leu Glu Cys Arg Leu Asn Gly His Pro Cys Ile Leu

165 170 175

Leu Glu Lys Gly Glu Pro Cys Leu Gly Pro Val Thr Arg Ala Gly Cys

180 185 190

Asn Ala Arg Cys Pro Gly Phe Gly Val Ala Cys Ile Gly Cys Arg Gly

195 200 205

Ala Ile Gly Tyr Asp Val Ala Trp Phe Asp Ser Leu Ala Lys Val Phe

210 215 220

Lys Glu Lys Gly Met Thr Lys Glu Glu Ile Ile Glu Arg Met Lys Met

225 230 235 240

Phe Asn Gly His Asp Glu Arg Val Glu Lys Met Val Glu Lys Ile Phe

245 250 255

Ser Gly Gly Glu Gln

260

<210> 6

<211> 428

<212> PRT

<213> Pyrococcus furiosus

<400> 6

Met Lys Asn Leu Tyr Leu Pro Ile Thr Ile Asp His Ile Ala Arg Val

1 5 10 15

Glu Gly Lys Gly Gly Val Glu Ile Ile Ile Gly Asp Asp Gly Val Lys

20 25 30

Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile

35 40 45

Thr Ile Gly Lys Lys Leu Glu Glu Ala Leu Ala Ile Tyr Pro Arg Ile

50 55 60

Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu Ala Ala

65 70 75 80

Glu Lys Ala Val Gly Phe Val Pro Arg Glu Glu Ile Gln Ala Leu Arg

85 90 95

Glu Val Leu Tyr Ile Gly Asp Met Ile Glu Ser His Ala Leu His Leu

100 105 110

Tyr Leu Leu Val Leu Pro Asp Tyr Arg Gly Tyr Ser Ser Pro Leu Lys

115 120 125

Met Val Asn Glu Tyr Lys Arg Glu Ile Glu Ile Ala Leu Lys Leu Lys

130 135 140

Asn Leu Gly Thr Trp Met Met Asp Ile Leu Gly Ser Arg Ala Ile His

145 150 155 160

Gln Glu Asn Ala Val Leu Gly Gly Phe Gly Lys Leu Pro Glu Lys Ser

165 170 175

Val Leu Glu Lys Met Lys Ala Glu Leu Arg Glu Ala Leu Pro Leu Ala

180 185 190

Glu Tyr Thr Phe Glu Leu Phe Ala Lys Leu Glu Gln Tyr Ser Glu Val

195 200 205

Glu Gly Pro Ile Thr His Leu Ala Val Lys Pro Arg Gly Asp Ala Tyr

210 215 220

Gly Ile Tyr Gly Asp Tyr Ile Lys Ala Ser Asp Gly Glu Glu Phe Pro

225 230 235 240

Ser Glu Lys Tyr Arg Asp Tyr Ile Lys Glu Phe Val Val Glu His Ser

245 250 255

Phe Ala Lys His Ser His Tyr Lys Gly Arg Pro Phe Met Val Gly Ala

260 265 270

Ile Ser Arg Val Ile Asn Asn Ala Asp Leu Leu Tyr Gly Lys Ala Lys

275 280 285

Glu Leu Tyr Glu Ala Asn Lys Asp Leu Leu Lys Gly Thr Asn Pro Phe

290 295 300

Ala Asn Asn Leu Ala Gln Ala Leu Glu Ile Val Tyr Phe Ile Glu Arg

305 310 315 320

Ala Ile Asp Leu Leu Asp Glu Ala Leu Ala Lys Trp Pro Ile Lys Pro

325 330 335

Arg Asp Glu Val Glu Ile Lys Asp Gly Phe Gly Val Ser Thr Thr Glu

340 345 350

Ala Pro Arg Gly Ile Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg

355 360 365

Val Ser Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met

370 375 380

Met Glu Glu His Val Arg Met Met Ala Glu Lys His Tyr Asn Asp Asp

385 390 395 400

Pro Glu Arg Leu Lys Ile Leu Ala Glu Met Val Val Arg Ala Tyr Asp

405 410 415

Pro Cys Ile Ser Cys Ser Val His Val Val Arg Leu

420 425

Claims

1. A high-temperature ferronickel hydrogenase heterologous expression method comprises the following steps:

(1) Inserting a high-temperature ferronickel hydrogenase encoding gene derived from Pyrococcus furiosus into a shuttle expression vector;

(2) Transforming the shuttle expression vector obtained in the step (1) into Thermococcus kodakarensis and expressing;

the high-temperature nickel iron hydrogenase coding gene derived from Pyrococcus furiosus in the step (1) is (a) or (b) or (c) or (d): (a) SEQ ID NO:2; (b) a sequence similar to SEQ ID NO:2 has a sequence with homology of more than 98 percent, and the coded protein has high-temperature ferronickel hydrogenase activity; (c) Nucleotide sequences encoding the four subunit proteins, wherein the amino acid sequence of the first subunit is SEQ ID NO. 3, wherein the amino acid sequence of the second subunit is SEQ ID NO. 4, wherein the amino acid sequence of the third subunit is SEQ ID NO. 5, wherein the amino acid sequence of the fourth subunit is SEQ ID NO. 6; (d) The nucleotide sequence of the protein of the four subunits is coded, the coded protein has high-temperature ferronickel hydrogenase activity, wherein the amino acid sequence of the first subunit has more than 98 percent of homology with SEQ ID NO. 3, the amino acid sequence of the second subunit has more than 98 percent of homology with SEQ ID NO. 4, the amino acid sequence of the third subunit has more than 98 percent of homology with SEQ ID NO. 5, and the amino acid sequence of the fourth subunit has more than 98 percent of homology with SEQ ID NO. 6.

2. The high-temperature ferronickel hydrogenase heterologous expression method according to claim 1, wherein the shuttle expression vector obtained in step (1) in step (2) is pTE4 or pTE5, wherein the nucleotide sequence of pTE5 is shown in SEQ ID NO:1 is shown in the specification; compared with pTE5, the high-temperature ferronickel hydrogenase coding gene SEQ ID NO:2 front 3 less histidine encoding genes.

3. The high-temperature ferronickel hydrogenase heterologous expression method according to claim 1, wherein the shuttle expression vector of step (1) is pTE3, pTE2 or pTE1, wherein the sequence of pTE3 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO:3 histidine encoding genes before 2; the sequence of pTE2 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO: 12 histidine encoding genes before 2; the sequence of pTE1 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO: the 12 histidine encoding genes before 2 and the promoter Pcsg gene.

4. The method for the heterologous expression of pyroferronickel hydrogenase according to claim 1, wherein the Thermococcus kodakarensis is TS559, the TS559 genotype is DeltapyrF, deltatrpE:pyrF, deltaTK 0149.

5. A recombinant Thermococcus kodakarensis characterized by being constructed by the heterologous expression method of the high-temperature ferronickel hydrogenase according to any one of claims 1 to 4.

6.A method for purifying high-temperature ferronickel hydrogenase is characterized by comprising the steps of freezing a bacterial liquid of the recombinant Thermococcus kodakarensis of claim 5 at a low temperature, melting the bacterial liquid, adding DnaseI and a proper amount of quartz sand, performing vortex oscillation, performing cell disruption, and purifying by nickel column affinity chromatography.

7. Use of the recombinant Thermococcus kodakarensis of claim 5 for the preparation of lactic acid.