CN109666689B - A heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its application - Google Patents

Abstract

The invention discloses a heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its application, belonging to the field of expression, purification and application of nickel-iron hydrogenase. The high-temperature nickel-iron hydrogenase disclosed in the present invention is derived from the extreme thermophilic anaerobic archaea Pyrococcus furiosus, and is recombined and overexpressed in another extreme thermophilic anaerobic archaea Thermococcus kodakarensis by using a shuttle vector, through a histidine tag and a nickel column The specific binding of recombinant hydrogenase simplifies the purification process of recombinant hydrogenase and increases the yield of hydrogenase; and forms a new electron transport route by coupling with a diaphorase (DI) containing flavin mononucleotide (FMN). pathway, using hydrogen to achieve the regeneration of the coenzyme NADH. The expression and purification method of recombinant high-temperature nickel-iron hydrogenase established by the present invention has the characteristics of simple steps, high enzyme yield, and low production cost; in addition, the coenzyme regeneration system established by the present invention uses hydrogen (gas) as a substrate for the reaction The influence of the system is small, the pH value of the solution will not be changed, and the product is easily separated.

Description

A heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its application

technical field

The invention relates to a heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its coenzyme regeneration application, belonging to the field of expression purification and coenzyme regeneration of nickel-iron hydrogenase.

Background technique

Hydrogenase catalyzes the reversible proton reduction hydrogen production reaction, and is a key enzyme in basic research related to biological hydrogen production and hydrogen energy batteries. Hydrogenases can be divided into single-iron hydrogenase (Fe Hase), double-iron hydrogenase (FeFe Hase) and nickel-iron hydrogenase (NiFe Hase) according to the different metal ions contained in their active centers. Fe Hase has only been found in some methane archaea. FeFe hydrogenase has a relatively high catalytic hydrogen production activity, but is highly sensitive to oxygen. Relatively speaking, NiFe hydrogenase is widely distributed and slightly less sensitive to oxygen. The activity is reversible, and the high-temperature NiFe hydrogenase has better thermal stability, and has better industrial application prospects.

Soluble hydrogenase I (SHI) from the extreme thermophilic archaea Pyrococcus furiosus (optimum growth temperature of 100°C) is a bidirectional nickel-iron hydrogenase with good thermal stability and a half-life of 14 hours at 90°C. The half-life at 40°C is as long as 208 hours. SHI is active in the temperature range from 20 to 100 °C. SHI is a heterotetrameric protein complex, including NiFe active center (α), two iron-sulfur clusters (β), one flavone adenine dinucleoside (FAD) and one iron-sulfur cluster (γ), and three Iron-sulfur cluster (γ), encoded by a separate gene operon (PF0891-PF0894). Heterologous expression of NiFe-hydrogenase is very difficult, because the maturation process of the NiFe active center is very complex, a precisely coordinated protein post-translational modification process, requiring a series of auxiliary proteins (HypABCDEF and special endopeptidases) . At present, the heterologous expression of SHI has only been experimentally studied in Escherichia coli, but the yield is extremely low, far lower than the result of homologous overexpression and purification of P. furiosus.

Thermococcus kodakarensis is an extremely thermophilic archaea isolated from geothermal hot springs with strict anaerobic growth. Its optimum growth temperature is 85°C. It and P.furiosus both belong to the order Thermococcus, but the optimum growth temperature of the latter up to 100°C. T. kodakarensis can reproduce and grow on the medium containing polypeptide, starch, pyruvate or chitin, etc., and use elemental sulfur or proton as the final electron acceptor to generate H ₂ S or H ₂ respectively. In 2005, the entire genome sequencing of T.kodakarensis was completed. The characteristics of natural competent cells and the use of shuttle vectors have made the genetic manipulation system of T.kodakarensis more mature. Homologous recombination has been successfully used for gene knockout and gene insertion. Or use shuttle vectors to express functional genes in T. kodakarensis. In addition, a soluble hydrogenase with 83.7% sequence identity with SHI protein was found in T.kodakarensis. Therefore, it is speculated that the hydrogenase auxiliary protein and specific endopeptidase in T.kodakarensis may be suitable for the maturation process of SHI.

Since the genetic modification of most extreme thermophilic archaea is difficult, the development of high-temperature expression platforms is limited. Therefore, the genetic modification operating system of T. kodakarensis has gradually developed T. platform.

In addition, oxidoreductases have high stereoselectivity in mild liquid environment, so they are widely used in the biosynthesis of chiral compounds. However, oxidoreductase-catalyzed biohydrogenation reactions require reducing coenzymes, NADH or NADPH, as hydrogen donors, and thus efficient regeneration of coenzymes is crucial for the economic viability of the industry. There are many methods for coenzyme regeneration, but the coenzyme regeneration method using hydrogenase has its unique advantages: the gaseous substrate hydrogen will not affect the liquid reaction system, and the product is easy to separate. The application of SHI in the regeneration of NADPH has been reported for a long time, but because its affinity for NAD is much lower than that of NADP, there is no research on its application in the regeneration of NADH.

Contents of the invention

The technical problem to be solved by the invention is a method for heterologous expression and purification of recombinant high-temperature nickel-iron hydrogenase and the application of coenzyme regeneration. The expression and purification method of recombinant high-temperature nickel-iron hydrogenase established by the present invention has the characteristics of simple steps, high enzyme yield and low production cost. In addition, the coenzyme regeneration system established by the present invention uses hydrogen (gaseous) as a substrate to react The influence of the system is small, the pH value of the solution will not be changed, and the product is easily separated.

One of the objects of the present invention is to provide a method for heterologous expression of high-temperature nickel-iron hydrogenase, the steps of which include;

(1) Insert the high-temperature nickel-iron hydrogenase encoding gene derived from the extreme thermophilic anaerobic archaea (Pyrococcus furiosus) into the shuttle vector;

(2) The vector obtained in step (1) is transformed into an extreme thermophilic anaerobic archaea (Thermococcus kodakarensis) and expressed.

In a preferred embodiment, the method is characterized in that the sequence of the high-temperature nickel-iron hydrogenase coding gene derived from the extreme thermophilic anaerobic archaea (Pyrococcus furiosus) is (a) or (b) Or (c) or (d): (a) SEQ ID NO: 2; (b) sequence with SEQ ID NO: 2 having 90% or more, preferably more than 95%, more preferably more than 99% homology; ( c) The nucleotide sequence of a protein encoding four subunits, wherein the amino acid sequence of the first subunit is SEQ ID NO: 3, the amino acid sequence of the second subunit is SEQ ID NO: 4, and the third subunit is The amino acid sequence of the subunit is SEQ ID NO: 5, wherein the amino acid sequence of the fourth subunit is SEQ ID NO: 6; (d) the nucleotide sequence of the protein encoding four subunits, wherein the first subunit The amino acid sequence has 90% or more homology with SEQ ID NO:3, preferably more than 95%, more preferably more than 99% homology; wherein the amino acid sequence of the second subunit has 90% or more homology with SEQ ID NO:4, preferably More than 95%, more preferably more than 99% homology; wherein the amino acid sequence of the third subunit has 90% or more, preferably more than 95%, more preferably more than 99% homology with SEQ ID NO: 5, wherein the amino acid sequence of the third subunit The amino acid sequences of the four subunits have 90% or more homology with SEQ ID NO: 6, preferably more than 95%, more preferably more than 99%.

In a more preferred embodiment, the method is characterized in that the gene encoding high-temperature nickel-iron hydrogenase is linked to a histidine tag sequence.

In the most preferred embodiment, the method is characterized in that the histidine tag sequence encodes 9-12 histidines.

In a specific embodiment, the method is characterized in that the histidine tag sequence encodes 9 or 12 histidines.

In a preferred embodiment, the method is characterized in that the shuttle vector is pTE2.

In a preferred embodiment, the method is characterized in that the extreme thermophilic anaerobic archaea (Thermococcus kodakarensis) is TS559.

In a preferred embodiment, the method is characterized in that the expression conditions are: culture temperature 80-90 degrees, preferably 85 degrees; culture time 1-20 hours, preferably 16 hours.

The second object of the present invention is to provide the application of the bacterium liquid obtained by any method of one of the objects of the present invention in producing lactic acid, characterized in that, the bacterium liquid is crushed to obtain high-temperature nickel-iron hydrogenase crude enzyme liquid and diaphorase and The lactate dehydrogenase is coupled, the reaction system contains pyruvate, hydrogen gas is passed through and catalyzed.

The third object of the present invention is to provide a method for purifying high-temperature nickel-iron hydrogenase, the steps include crushing and purifying the bacterial liquid obtained by any one of the methods for heterologous expression of high-temperature nickel-iron hydrogenase described in one of the objects of the present invention.

The fourth object of the present invention is to provide an application of the high-temperature nickel-iron hydrogenase obtained by the purification method of the third object of the present invention in generating lactic acid, which is characterized in that the high-temperature nickel-iron hydrogenase, diaphorase and lactate dehydrogenase Coupled with each other, the reaction system includes pyruvic acid, oxidized nicotinamide adenine dinucleotide (NAD) and oxidized nicotinamide adenine dinucleotide phosphate (NADP), which is fed with hydrogen and catalyzed.

The fifth purpose of the present invention is to provide a method for catalyzing hydrogen to generate reduced nicotinamide adenine dinucleotide (NADH), which is characterized in that the high-temperature nickel-iron hydrogenase obtained by the purification method of the third purpose of the present invention and yellow The reaction system includes oxidized nicotinamide adenine dinucleotide (NAD) and oxidized nicotinamide adenine dinucleotide phosphate (NADP), and hydrogen gas is passed through and catalyzed.

The sixth object of the present invention is to provide a method for catalyzing hydrogen to generate reduced nicotinamide adenine dinucleotide (NADH), wherein the reaction system comprises oxidized nicotinamide adenine dinucleotide (NAD) and oxidized nicotinamide adenine dinucleotide (NADH). Type nicotinamide adenine dinucleotide phosphate (NADP) and pass through hydrogen to couple and catalyze high temperature nickel-iron hydrogenase with diaphorase.

The invention discloses a heterologous expression and purification method of high-temperature nickel-iron hydrogenase SHI derived from the extreme thermophilic anaerobic archaea P. furiosus, which is recombined in another extreme thermophilic anaerobic archaea T. kodakarensis by using a shuttle vector Expression, through the specific combination of histidine tag and nickel column, simplify the purification process of recombinant hydrogenase, improve the yield of hydrogenase; and through the diaphorase (diaphorase, DI) Coupled with each other, a new electron transfer pathway is formed, and hydrogen is used to realize the regeneration of the coenzyme NADH.

The four subunits of the high-temperature nickel-iron hydrogenase SHI are respectively encoded by four genes located in the same gene cluster: α-PF_RS04500 (NCBI Gene ID: 1468756), β-PF_RS04485 (NCBI Gene ID: 1468753), γ- PF_RS04490 (NCBI Gene ID: 1468754), 6-PF_RS04495 (NCBI Gene ID: 1468755).

Lu，Reeve JN.2010.Thermococcuskodakarensis genetics：TK1827-encoded β-glycosidase，new positive-selectionprotocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)。TK0149编码一个丙酮酰依赖的精氨酸脱羧酶，可将精氨酸脱羧生成胍丁胺，该基因的缺失将导致菌株胍丁胺依赖型生长，因此TS559无法在不添加胍丁胺的培养基中进行生长。The host bacteria for the heterologous expression of SHI is the modified TK0149 deletion mutant strain TS559 (△pyrF; △trpE::pyrF; △TK0149, Santangelo TJ,

Lu, Reeve JN. 2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, new positive-selection protocol, and targeted and repetitive deletion technology. Appl. Environ. Microbiol. 76(4): 1044-52.). TK0149 encodes a pyruvyl-dependent arginine decarboxylase, which can decarboxylate arginine to generate agmatine. The deletion of this gene will lead to agmatine-dependent growth of the strain, so TS559 cannot grow in the medium without agmatine grow in.

The map of the shuttle expression vector is shown in Figure 1, and the sequence is shown in the appendix SEQ ID NO: 1, which specifically includes the following six parts:

Lu，ReeveJN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，newpositive-selection protocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)；1. All the sequences of the plasmid pTN1, including the gene sequences encoding Rep74 and p24, ensure that the shuttle vector can replicate autonomously in T.kodakarensis, the reference is (Santangelo TJ,

Lu, ReeveJN.2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, newpositive-selection protocol, and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4):1044-52.);

Lu，Reeve JN.2010.Thermococcus kodakarensisgenetics：TK1827-encoded β-glycosidase，new positive-selection protocol，andtargeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)；2. Express the elements of the TK0149 gene, so that the transformant can grow on the medium without adding agmatine, and the references are (Santangelo TJ,

Lu, Reeve JN. 2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, new positive-selection protocol, and targeted and repetitive deletion technology. Appl. Environ. Microbiol. 76(4): 1044-52.);

3. Origin of replication and ampicillin resistance gene derived from the universal vector pUC19 of Escherichia coli to ensure that the shuttle vector can be replicated and screened in common Escherichia coli;

4. Gene cluster encoding high-temperature nickel-iron hydrogenase SHI;

5. The strong promoter Pcsg that can promote the expression of SHI gene cluster in T.kodakarensis, the reference is (Kanai T, Simons JR, Tsukamoto R, Nakajima A, Omori Y, Matsuoka R, Beppu H, ImanakaT, Atomi H.2015 .Overproduction of the membrane-bound[NiFe]-hydrogenase in Thermococcus kodakarensis and its effect on hydrogen production.Front.Microbiol.6:847.);

6. The polyhistidine tag (9 or 12 histidines) enables SHI to be combined with a nickel column for one-step purification. References are (Chandrayan SK, Wu CH, McTernan PM, Adams MWW.2015.High yield purification of a tagged cytoplasmic[NiFe]-hydrogenase and a catalytically-active nickel-free intermediate form. Protein Expres. Purif. 107:90-94.).

A heterologous expression and purification method for recombinant high-temperature nickel-iron hydrogenase, comprising the following steps: after the above-mentioned shuttle expression vector is constructed in Escherichia coli Top10, the complete plasmid is transformed into T.kodakarensis host strain TS559, and then the transformed strain is cultivated , the protein was purified by nickel column affinity chromatography to obtain recombinant high-temperature nickel-iron hydrogenase SHI.

The culture condition of the T. kodakarensis expression strain is preferably: 16 hours under anaerobic conditions at 85°C.

The application of the recombinant high-temperature nickel-iron hydrogenase described in the present invention in the coenzyme NAD ⁺ and NADH cycle regeneration system.

The application of the recombinant high-temperature nickel-iron hydrogenase described in the invention in the production of lactic acid catalyzed by lactate dehydrogenase (LDH) with NAD as coenzyme.

Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

The method for expressing and purifying recombinant high-temperature nickel-iron hydrogenase established by the invention has the characteristics of simple steps, high enzyme yield, low production cost and the like.

The recombinant high-temperature nickel-iron hydrogenase described in the invention has good thermal stability and long service life.

The coenzyme regeneration system established by the invention uses hydrogen (gas state) as a substrate, has little influence on the reaction system, does not change the pH value of the solution, and is easy to separate products.

Lu，ReeveJN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，newpositive-selection protocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)TS559 of the present invention means that its genotype is ΔpyrF; ΔtrpE::pyrF; ΔTK0149 extreme thermophilic anaerobic archaea (Thermococcus kodakarensis), (Santangelo TJ,

Lu, Reeve, JN. 2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, new positive-selection protocol, and targeted and repetitive deletion technology. Appl. Environ. Microbiol. 76(4): 1044-52.)

Description of drawings

Figure 1A is a map of the shuttle expression vector of recombinant high-temperature nickel-iron hydrogenase SHI with 12-His tag in T. kodakarensis. B is a schematic diagram of the structure of recombinant SHI.

Figure 2 shows the expression and purification of recombinant high-temperature nickel-iron hydrogenase SHI in T. kodakarensis. Figure A shows the benzyl viologen (BV)-based hydrogenase activity detection of the supernatant of the bacteria, in which TS559 is a strain transformed with an empty plasmid, and OE-SHI is a recombinant SHI overexpressed strain. B is the result of SDS-PAGE detection of recombinant SHI protein purification. 1: supernatant; 2: effluent; 3: eluted with 20mM imidazole; 4: eluted with 50mM imidazole; 5: eluted with 75mM imidazole; 6: eluted with 100mM imidazole; SHI; 8: recombinant SHI with 12-histidine tag purified from T. kodakarensis. .

Figure 3 is the detection of the basic properties of recombinant SHI. A is the result of detecting the purified recombinant SHI with a Superdex-200 chromatographic column; B is the SDS-PAGE detection of the protein sample at the peak position marked in Figure A; C is the relative enzyme activity of recombinant SHI in the temperature range of 30-90°C ; D is the stability test of recombinant SHI at 80°C.

Fig. 4 is a schematic diagram of recycling the coenzyme NADH by using the artificial electron transport chain composed of recombinant SHI (rSHI), DI, and LDH.

Fig. 5 is a regenerative system combined with coenzyme NADPH and NADH, the reaction result of generating L-lactic acid from pyruvate catalyzed by LDH and hydrogen catalyzed. A and B are the reactions with different concentrations of hydrogen as the substrate, and C and D are the negative controls without adding DI and SHI, respectively.

Detailed ways

The present invention will be further described below in conjunction with specific embodiments, and the advantages and characteristics of the present invention will become clearer along with the description. However, it should be understood that the described embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the details and forms of the technical solution of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

Experimental Materials

Sodium pyruvate, product of Aladdin company, product number: S104174;

Agmatine, product of Sigma Company, product number: A7127;

High-temperature agar (Phytagel), product of Sigma Company, product number: P8169;

Benzyl viologen dichloride (BV), product of Alfa Company, product number: H66836;

All high-purity gases are purchased from Air Products (Tianjin) Company;

The pTS543 vector and T.kodakarensis TS559 strain were donated by Professor ThomasJ.Santangelo of Colorado State University;

The P.furiosus genome was donated by Professor Michael W.W.Adams from the University of Georgia;

pUC19 vector, Invitrogen, Carlsbad, CA, USA;

pET20b vector, Novagen, Madison, WI, USA;

Escherichia coli expression strain BL21(DE3), Invitrogen, Carlsbad, CA, USA;

DI (GenBank accession number JQ040550) in the present invention is derived from Geobacillus stearothermophilus, its expression and purification references Collins J, Zhang T, Huston S, Sun FF, ZhangY-HP, Fu JL.2016.A hidden transhydrogen activity of a FMN-bound Diaphorase under anaerobic conditions. Plos One 11(5): e0154865.

LDH is derived from Thermotoga maritima and is encoded by gene TM1867 (NCBI Gene ID: 897800). According to the genetic engineering method, the pET20b expression vector is used to obtain it through prokaryotic expression in BL21(DE3). The references are Ostendorp R, Auerbach G, Jaenicke R.1996 .Extremely thermostable L(+)-lactatedehydrogenase from Thermotoga maritima: cloning, characterization, and crystallization of the recombinant enzyme in its tetrameric and octamericstate. Protein Sci.5(5):862-873.

The basic medium of T.kodakarensis bacterial strain among the present invention is artificial sea salt medium ASW-YT [Sato T, Fukui T, Atomi H, Imanaka T.2003.Targeted gene disruption by homologous recombination in the hyperthermophilic archaeon Thermococcus kodakaraensisKOD1.J.Bacteriol. 185(1):210-220.], including: 0.8×ASW [20g/L NaCl, 6g/L MgSO ₄ 7H ₂ O, 3g/L MgCl ₂ 6H ₂ O, 1g/L (NH ₄ ) ₂ SO ₄ , 0.2g/L NaHCO ₃ , 0.3g/L CaCl ₂ ·2H ₂ O, 0.5g/L KCl, 0.42g/L KH ₂ PO ₄ ·H ₂ O, 0.05g/L NaBr, 0.02g/ L SrCl ₂ -6H ₂ O, 0.01g/L Fe(NH ₄ ) ₂ (SO ₄ ) ₄ -6H2O], 5mL/L modified Wolfe's trace minerals [0.5g/L MnSO ₄ 2H ₂ O, 0.1g/L CoCl ₂ , 0.1g/L ZnSO ₄ , 0.01g/L CuSO ₄ 5H ₂ O, 0.01g/L AlK(SO ₄ ) ₂ , 0.01g/L H ₃ BO ₃ , 0.05g/L NiCl ₂ 6H ₂ O , and 0.01g/L NaMoO ₄ ·2H ₂ O], 5g/L peptone, 5g/L yeast extract; add 10g/L sodium pyruvate, and cultivate in an anaerobic environment at 85°C. Add 1% high temperature agar and 0.2% polysulfide polymer (10gNa ₂ S·9H ₂ O and 3g sulfur powder, dilute to 15mL with distilled water) for the solid medium.

Experimental example 1 T.kodakarensis shuttle vector construction

The present invention utilizes a shuttle vector to overexpress SHI in T. kodakarensis.

Lu，ReeveJN.2010.Thermococcus kodakarensis genetics：TK1827-encoded β-glycosidase，newpositive-selection protocol，and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4)：1044-52.)，用引物1和引物2进行目的片段扩增，该片段包含在T.kodakarensis中进行自主复制的质粒pTN1的所有序列以及表达筛选标记基因TK0149的基因元件，引物1序列为：Using pTS543 as a template (plasmid derived from reference Santangelo TJ,

Lu, ReeveJN.2010. Thermococcus kodakarensis genetics: TK1827-encoded β-glycosidase, newpositive-selection protocol, and targeted and repetitive deletion technology.Appl.Environ.Microbiol.76(4):1044-52.), with primers 1 and Primer 2 is used to amplify the target fragment, which contains all the sequences of the plasmid pTN1 autonomously replicating in T. kodakarensis and the genetic elements expressing the screening marker gene TK0149. The sequence of primer 1 is:

GAAGCTCAGGTGGTACTTCACTCCACAATGGTTTCTTAGACGTCAGGTGGC, primer 2 sequence is:

GAATTTGCCAAATTGCCAGAATTGGCCATAGCTGTTTCCTGTGTGAAATTG; In addition, using pUC19 as a template, use primer 3 and primer 4 to amplify its origin of replication and the sequence of expressing ampicillin resistance gene. The sequence of primer 3 used is:

CAATTTCACACAGGAAACAGCTATGGCCAATTCTGGCAATTTGGCAAATTC, the sequence of primer 4 is:

GCCACCTGACGTCTAAGAAACCATTGTGGAGTGAAGTACCACCTGAGCTTC; after obtaining the above fragments, through Simple Cloning (You, C., et al. (2012). "Simple Cloning via DirectTransformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis."Appl.Environ.Microbiol.78( 5): 1593-1595.) to construct the T.kodakarensis-E.coli shuttle vector pTE1.

Experimental example 2 Construction of expression vector of recombinant high-temperature nickel-iron hydrogenase SHI

Check the strong promoter P _csg sequence through NCBI, the reference is (Kanai T, Simons JR, Tsukamoto R, Nakajima A, Omori Y, Matsuoka R, Beppu H, Imanaka T, Atomi H.2015. Overproduction of the membrane-bound [NiFe ]-hydrogenase in Thermococcus kodakarensis and its effect on hydrogen production.Front.Microbiol.6:847.), design primer 5 and primer 6 (primer 5:

GAATTCTGCAGATATCCATCACACTGCGGCAAAAGGCGAATTATGTGTAG, Primer 6:

CGGCAGTCGACTTTTTTGCGGCCGCACAACACCTCCTTGGGTTGTTGGGG), using the T.kodakarensis genome (NC_006624.1) as a template PCR amplification to obtain the P _csg fragment; in addition, using pTE1 in Experimental Example 1 as a template, design primer 7

(CCCCAACAACCCAAGGAGGTGTTGTGCGGCCGCAAAAAAGTCGACTGCCG) and primer 8

(CTACACATAATTCGCCTTTTGCCGCAGTGTGATGGATATCTGCAGAATTC) amplified plasmid backbone; then by Simple Cloning (You, C., et al. (2012). "Simple Cloning via DirectTransformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis."Appl.Environ.Microbiol. 78(5): 1593-1595.) to construct the vector pTE2 inserted into the strong promoter P _csg .

In order to simplify the purification method of SHI, the present invention fuses 9 histidine tags at the N-terminus of PF0891, uses its affinity with nickel column to purify SHI, and designs primer 9

(CACCACCATCACCACGCGGCCGCAAAAAAGTCGACTGCCG) and primer 10 (GTGATGATGATGCATACAACACCTCCTTGGGTTGTTGGGGC) inserted nine histidine tags. The specific steps are as follows: after phosphorylation of the above primers, PCR amplification is carried out using the vector pTE2 as a template, and the amplified product is recovered and ligated with T4 ligase to obtain the vector pTE3 with 9-His.

Check the gene sequence of SHI through NCBI and design primers 11

(CCATCACCATCACCACCATCACCCAGGTATGTTAAGTTACCCCAAGGAAAAC) and primer 12

(CGGCAGTCGACTTTTTTGCGGCCGCGGCATTGTTATCATCTCCTCAAGAG), using P. furiosus genome (DSM 3638, AE009950) as a template for PCR amplification to obtain the target fragment; and using the vector pTE3 as a template, primer 13

(CTCTTGAGGAGATGATAACAATGCCGCGGCCGCAAAAAAGTCGACTGCCG) and primer 14

(GTTTTCCTTGGGTAACTTAACATACCTGTGGTGATGGTGGTGATGGTGATGG) amplified plasmid backbone; then by Simple Cloning (You, C., et al. (2012). "Simple Cloning via DirectTransformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis."Appl.Environ.Microbiol. 78(5): 1593-1595.) to construct recombinant SHI expression vector pTE4.

The expression vector pTE5 with 12 histidine tags, the specific construction steps are as follows: use phosphorylated primer 15

(CATCACCACCATCACCACGCGGCCGCAAAAAAGTCGACTGCCG) and primer 16

(GTGATGGTGATGATGATGCATACAACACCTCCTTGGGTTGTTGGGGC), the vector pTE4 was used as the template for PCR amplification, and the amplified product was recovered and ligated with T4 ligase to obtain the vector pTE5 with 12-His.

Experimental Example 3 Detection of Hydrogenase Enzyme Activity

The hydrogenase detection method based on benzyl viologen BV used in the present invention is as follows: add 2ml reaction mixture (1mM BV, 100mM EPPS, pH 8.4) in 3ml sealed cuvette, fill in the anaerobic bottle containing 3% A mixed gas of hydrogen (nitrogen:hydrogen=97:3). After preheating the reaction solution and the enzyme sample at 85°C, add the enzyme to start the reaction. The reaction was carried out in a temperature-controllable 100CaryUV-Vis spectrophotometer (Agilent), the temperature was maintained at 85°C, and the change in absorbance at 578nm was detected in real time, that is, the amount of reduced BV produced. 1 U of enzyme activity is equivalent to oxidizing 1 μmol of hydrogen or reducing 2 μmol of BV in 1 min.

For the method of detecting hydrogenase with other electron carriers (NADP or methyl viologen MV, etc.), refer to the above detection method.

Experimental Example 4 Obtaining of the Expression Strain of Recombinant High Temperature Nickel-iron Hydrogenase SHI

The expression vector pTE4 of recombinant SHI described in Experimental Example 2, pTE5 and the control vector pTE3 were transferred into the host strain T.kodakarensis TS559, and the specific process was as follows (both carried out under anaerobic conditions): - In YT-Pyr medium, cultivate to OD ≈ 0.6 in an anaerobic environment at 85°C, centrifuge at 8000rpm for 5 minutes, collect the cells, discard the supernatant; then resuspend the cells with 0.8×ASW buffer and place on ice Place for 30 minutes; put about ⁴ ×108 cells into a 1.5mL centrifuge tube, add 3ug of the SHI expression vector pTE4 or pTE5 described in Experimental Example 2, and continue to place on ice for 1 hour; then heat shock at 85°C for 45 Second, after placing it on ice for 10 minutes, add 1.3mL of modified ASW-YT liquid medium (added with 0.2% polysulfide polymer), recover at 85°C for 2 hours, then centrifuge at 8000rpm for 5 minutes, collect the bacteria, discard Clear, resuspend the cells with 200 μL 0.8×ASW, and spread on the ASW-YT solid medium without adding agmatine. After anaerobic culture at 85°C for 2-3 days, a single colony was picked for PCR verification to obtain recombinant SHI expression strains and empty vector negative control strains.

Experimental example 5 Expression and purification of recombinant high-temperature nickel-iron hydrogenase SHI

The protein expression and purification process of recombinant SHI was carried out in anaerobic environment.

The recombinant SHI expression strain obtained in Experimental Example 4 was subjected to liquid expansion culture, transferred to an anaerobic tank equipped with 5L ASW-YT-Pyr medium according to the inoculum size of 1%, and anaerobically cultivated at 85°C for about 16 hours, OD ₆₀₀ is about 1.5; 8000rpm, centrifuge for 20 minutes, collect the bacteria, discard the supernatant; add phosphate buffer (50mM PBS, pH 8.0) to resuspend the bacteria, and then freeze the bacteria at -20°C.

After thawing the above-mentioned frozen bacteria, add 50ug/ml DNaseI and an appropriate amount of quartz sand, vortex and shake for 20 minutes to break the cells, then centrifuge at 10000rpm for 1 hour, take the supernatant, and carry out hydrogenase activity detection and the next step protein purification.

According to the detection method in Experimental Example 3, the supernatant enzyme activity of 9-His-SHI was measured to be 13.4U/mg, and the supernatant enzyme activity of 12-His-SHI was 23.6U/mg. The supernatant enzyme activity is 0.01U/mg.

Take the 12-His-SHI supernatant and use nickel column affinity chromatography for protein purification. Gradient elution was carried out with different concentrations of imidazole. Protein purification buffer is 50mM PBS, 300mM NaCl, pH8.0.

The purification results of 12-His-SHI are shown in Figure 2, which is basically the same as that of SHI purified in wild-type P. furiosus, and the protein purity is better

Experimental Example 6 Detection of Basic Properties of Recombinant High Temperature Nickel-iron Hydrogenase SHI

The 12-His-SHI purified in Experimental Example 5 was analyzed.

First, 12-His-SHI was analyzed with a Superdex-200 chromatographic column, and the detection results are shown in Figure 3A. Most of the recombinant SHI is concentrated at a position with a molecular weight of about 150kDa, which is comparable to the molecular weight of its four subunits (αβγδ) The sum matches. In addition, there is also a small peak at the position of higher molecular weight, indicating that a small part of recombinant SHI may form a higher degree of polymerization.

Using the method in Experimental Example 3, the activity of the recombinant SHI was detected in the range of 30-90°C. As shown in Figure 3C, the enzyme activity was the highest at around 80°C, but it also had a certain activity at 30°C, and the half-life of recombinant SHI at 80°C was about 80 hours (Figure 3D).

Experimental example 7 Application of recombinant high-temperature nickel-iron hydrogenase SHI in lactic acid production

LDH (NCBI Gene ID: 897800) and DI (GenBank accession number JQ040550) used in the reaction were all encoded by the method of Simple Cloning (You, C., et al. (2012). "Simple Cloning via Direct Transformation of PCR Product ( DNA Multimer)to Escherichiacoli and Bacillus subtilis. "Appl.Environ.Microbiol.78(5):1593-1595.) was inserted between NdeI and XholI of pET20b, expressed and purified in Escherichia coli BL21 (DE3).

The 12-His-SHI purified in Experimental Example 5, and LDH and DI purified from common Escherichia coli were used for the experiment of producing lactic acid with propionic acid. The reaction process is shown in FIG. 4 .

In a 2ml closed anaerobic reaction system, containing 100mM HEPES buffer (pH7.4), 5mM MgCl ₂ , 1mM NAD ⁺ , 1mM NADP ⁺ , 60mM pyruvate (sodium pyruvate), 0.1mg/mL LDH, 0.1 mg/mL SHI and 0.25mg/mLDI, the gas composition in the reaction system is 3% hydrogen/97% nitrogen or completely filled with hydrogen. The catalytic reaction was carried out at 50°C for 18 hours.

The negative control group did not add DI, or did not add SHI.

Depending on the retention time, HPLC can be used to distinguish pyruvic acid and lactic acid in the reaction solution; and can quantify pyruvic acid and lactic acid; the mobile phase of HPLC is 5mM dilute sulfuric acid.

After the reaction, the final lactic acid concentration in Figures 5A and 5B both reached 60 mM, the conversion rate was 100%, and 60 hydrogen transfers were performed between NAD and NADP.

When all the gas fed is hydrogen, the reaction rate is faster.

sequence listing

<110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences

<120> A heterologous expression and purification method of recombinant high-temperature nickel-iron hydrogenase and its application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10757

<212>DNA

<213> Artificial Sequence

<400> 1

aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 60

tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 120

gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 180

tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 240

aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 300

cggtaagatc cttgagagttttcgccccga agaacgtttt ccaatgatga gcacttttaa 360

agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 420

ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 480

tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 540

tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 600

caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 660

accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 720

attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 780

ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 840

taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 900

taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 960

aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 1020

agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 1080

ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 1140

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 1200

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 1260

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 1320

tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 1380

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 1440

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 1500

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 1560

acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 1620

ggtaagcggc agggtcggaa caggagagcg cacgaggggag cttccagggg gaaacgcctg 1680

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 1740

ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 1800

ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 1860

taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 1920

cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc 1980

gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 2040

tgagcgcaac gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt 2100

tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 2160

cagctatggc caattctggc aatttggcaa attcgacaaa tttgccactg ttatggcact 2220

gttatggtat tgtgatacca attttttggg gtctggtacc ttactacttc ttgccaactt 2280

ctgccaagtt ctgccaattc ttgccagtgt tgatgtgtcc gttttgttcc taattctcca 2340

gttttctggt tcactgctta aatactcctc tgccgtagct ctgtctgacg gtgcctcacc 2400

gtctttgagc taaaatcagg ggtgagagtt gtggtcgagt tggtgagact ggacggttcg 2460

gtgaactttg gagacggtgc cgaggtagtg agtgtttggt tgaataagct tagtgatttc 2520

gagaagctga agtccacctt cggcggtatc ttttcaacgt cggagacgtc gaagggtgtt 2580

ctttactcgt tgtttgttcc gtctttccgt gtgaggttcc tttgtcttgt gcgaggtggt 2640

ggagatggaa agcggtgaga atacgccttt caagaagttt atttgcctac actgtgggca 2700

cgtctttgac agtgataggg acgcgccgaa gtgtccgaac tgtggccgta ggaaagttat 2760

tccgcttgag actcttggtg agtctctcag gaagcacaag gataagttaa aggaactcgg 2820

tgttcttcct gagcctgacc ctgagcctca ggagactgag gttggaaagg ctgaggttga 2880

gactgctggc cagaaggacc ctgagacttc gaagcctgag cctatccagg ttgagcagaa 2940

ggttgaggag ttaaaaccgg agtctgacca ggagcctcaa aactctgagt ctgtggactc 3000

tccagatgat gttcctgagt cagataagct tcttgctaaa tatctcgaag agcttgagga 3060

cgttcctgcg aaacctaagc ctaagaagtt gaggccaaag aaatctaaga ggtccatcac 3120

tgttcccgca ggtccttcct tcctcgaagt cctcatcatc atcggggcta tagtcctcat 3180

atggaagtgg ttatcttcga ggtcctcaaa gtctgatgat gagtccaacg ttccgaggcc 3240

ttctgagacc tattatcaga ttcagcggaa tctcggtcat cacgttcttg ggtgatggtt 3300

atggccgaag acaagaagaa atccaggagc tgggtagagg ttgctttcta ccttttcatc 3360

gctttggttg ttatctgggt gttcgtcagg gcactcaaga agtctcagaa cgtgatacta 3420

tggaaccctg agcttggcct cagactcctg gaaaaatctc tctcaaaact tggattcttg 3480

gggaaaagta taaatacgat ttgattctca ctactatttg cgggacgtgg taccgatgcc 3540

gaagccgacc aggagaccat cagaaatcct tcagtggttc cgggaacacc ctggcgaagt 3600

tacctctctc aaggctctat ctctcaatct caatatccct tacaacactg tattcgttgt 3660

tgttaagaag ctggttgaag agggtaagct taggaaggtt ggtcgtggtc tctacacttt 3720

ggctgatgaa gaatcagatg ctgacgataa tagaagggga ggcaccaacg cgggacgtgg 3780

taccgatgcc tccccttcct aaagaatccc aacaggaggg gattcgcgta tgaggttaag 3840

taattcctct ataaattctt tgctgtcatc ggggtcttgt gatgttgtgg gtagctcacc 3900

gagtggctca cccttcctac ctcagtctac tggttcgact cagaagacgc ttagcgttta 3960

tcttgatata tctccaacca atgaaaaggg tgagccatct gtaagaggtc ctactatccg 4020

ggtttcttct catcctctcc ctgcctatgc ctactatcgc tctgctactg gccatctcga 4080

acgccagaaa tttgaatccc agggtcgcgt caagattgac atctataaac ttcggaagaa 4140

actcttctgg attaggcgta gacttgagcg tgtggacctt actgatgagg agcgctcctc 4200

tcttgaggct gagcgagacc gtttggtttc tcttactgag aagttgctca ggaaaatcta 4260

ctccggttct gctctttatg gtgaccgctt tgttattgat gtccccgtag cttattctca 4320

actctgtaaa gctcttggga ttaatccgtc tgatgtaggg gtctctctat ttgttcggtc 4380

tgcagttatg gatttggaat ttgatgactc ctcccgttct gctcttaaaa ttagttatgt 4440

atcccgtctt tttgctggta aataccatcc tgctaagggt atatctaagg gctttaagga 4500

ggctcgtagg gtagttcgcg atttacttgt tctccaagaa tttctcgatg gttctctcct 4560

ttcctaccat aagggtgatt atgtcacctc taatagtctt ctacctatga ggttctttgt 4620

cctgactctt cccgaagaaa tcagctatta tatctggtcc aagcttcgtg agggggatga 4680

ttcagctcta aagctcttta agaaaattag ttctcaagcg attagagact tcctctttta 4740

ccttgctcaa aaagagggaa tcccaattaa caaatcctat tttgtccccg ggttccttca 4800

gaatattcat cccactggag acagggaccc gtttaagcct cacttccacg ctcacttctc 4860

tgttgttttc gttgtttatg ataagtcgtc tcatacgtgg taccgtttga atcctgtcct 4920

tgatgaggcg gatcttgaga agttgagaga aatctggaaa gctcttgtag ttgaggcttt 4980

ctctgaaatt ctttcggggg atactctcac aaaggacttc aatgtttggg tgggcgatag 5040

gtattactct cttcctcacg actacgttgg agttctcttc gaaataaagt ataatgctcg 5100

caagatgttt gtgaactatt cgagttacta tgagcgcaat tctttctccg atgactttga 5160

taggtccttt gtgagtttca tctttgatta taagaaccgg actgagaggt atggtttcct 5220

cacaaacatc aaacgttatc tctctcgtct ttcaatttct gctgtcaaga aacgtcttga 5280

ggaacttcgg gagcttttag atagaatcga ggctgatttg ctcgttgttg atagtggtag 5340

gttccctctc ctttatcagt ctctcttgga taaacgagag gctgttcaat ctgaaatttc 5400

ccgtcttgaa tctgtgttga acaatccgga tgatgctttc cgtgttctct atgatgaaat 5460

ctctcgtgat gttgagtcta tgctttctcc tcgtactgtt aaagagaatc ggattgtttc 5520

tttgttggag agtcttcacg gaaaacgggt tgttggtctc tctgttgagt atatccgtta 5580

ccttacccgt gacggtgaag aagttttgga tgttcctctt cacaaattcc ttgaggctcg 5640

tcgctcggta gttcttcttt cggatagaca taaaactgtg gagtttatgc tgtggtggga 5700

cccgttctgg gaggacccac cagatgtgtt agaactgaaa attccaaatt cctgaaaggg 5760

cgaattctgc agatatccat cacactgcgg caaaaggcga attatgtgta ggcattaggt 5820

taagccttct tttcattttt acggcaatca gcgagctttt tttggccgct gaaagggtct 5880

gaaagcgaaa agtatttaaa ccccaagtgg ccagataggt atgacaacac ttagtagggg 5940

ctaaagcccc aacaacccaa ggaggtgttg tatgcatcat catcaccatc accatcacca 6000

ccatcaccac aggtatgtta agttacccaa ggaaaacact tacgagtttt tggaaagact 6060

taaagactgg gggaagcttt acgctccagt aaaaatttcg gacaagttct atgacttcag 6120

ggagaattgat gatgttagaa agatagaatt cactacaac aggacaataa tgccacctaa 6180

gaagttcttc ttcaagccga gggaaaagct ctttgagttc gacatttcaa aaccagaata 6240

cagggaggta atagaggaag ttgaaccatt tattatattt ggagtccacg cgtgtgacat 6300

atatggccta aagatcctag acacggtata ccttgatgag ttccccgaca agtactacaa 6360

ggtgaggaga gagaagggga taatcattgg aataagctgt atgccagatg aatattgctt 6420

ctgtaactta agagaaacag acttcgctga tgatggtttt gacttgttct tccatgaact 6480

gcccgatgga tggttggtaa gggttggcac tccaactggg cacaggcttg ttgacaagaa 6540

cataaagctc tttgaagagg taacggaca ggatatctgt gcatttagag attttgaaaa 6600

gaggagacag caagcattca aataccacga agactggggc aacttgaggt atcttctcga 6660

gttggaaatg gaacatccaa tgtgggatga ggaggcagat aagtgcttgg cttgtggaat 6720

atgtaacacc acatgcccaa cgtgtagatg ctatgaagtt caggatattg taaacctaga 6780

tggagttact ggatacaggg aaagaagatg ggattcttgt cagttcagaa gtcatggctt 6840

agttgctggg ggccacaact tcaggcccac aaagaaggat cgctttagga acagatacct 6900

ctgtaagaac gcatataacg aaaagcttgg attaagctac tgtgtcggtt gtggaaggtg 6960

tactgcattc tgtccagcca atataagttt tgtaggcaat cttagaagga ttttaggact 7020

tgaggagaac aaatgtcccc caacggttag tgaggagatt ccaaagagag gatttgcata 7080

ttcctctaac attagaggtg atggagtatg atgttgccaa aagagattat gatgccaaat 7140

gataatccgt atgcccttca tagagtcaaa gttctaaagg tttactcctt gacggaaacg 7200

gaaaagcttt tcctctttag atttgaggat cccgagttgg cagagaagtg gacgttcaaa 7260

cctggacagt ttgtccagct gacgatacct ggagttggag aggttcccat aagtatatgc 7320

tcttctccaa tgaggaaagg attctttgag ctctgtataa gaaaggcagg aagggtcaca 7380

actgttgtcc atagactaaa gcctggcgat actgttcttg tgagagggcc ttacggtaat 7440

ggattcccag tggatgagtg ggaaggaatg gatctactat taatagctgc tggccttgga 7500

actgcacctc ttaggagcgt ctttctctat gcaatggaca acaggtggaa gtatggaaac 7560

attaccttca taaacaccgc acgttatggg aaggatctcc tcttctacaa ggagctggag 7620

gcaatgaaag acctagctga ggctgaaaac gtgaaaatca tccagagcgt cactagggat 7680

ccaaactggc cgggcctaaa gggtaggcca cagcagttca tcgttgaggc caacacaaat 7740

ccaaagaaca ctgcagttgc aatctgtggg cctcctagaa tgtataagtc agtgtttgag 7800

gccctcatca actacggtta tcgcccagag aacatcttcg tgacattgga gagaagaatg 7860

aaatgtggaa tcgggaagtg cggccactgc aacgtcggaa cgagcacgag ctggaagtac 7920

atctgtaaag atggaccagt cttcacgtac ttcgacatag tttcaaccccc aggactgctg 7980

gactgaggtg aggaaaatgg gaaaagttag gattggattt tacgcattaa cctcgtgcta 8040

cggctgtcaa ttgcagctag ctatgatgga cgagttatta caacttatcc caaatgctga 8100

aatagtttgc tggttcatga ttgatagaga tagcattgag gatgaaaagg tcgacatagc 8160

ttttatagaa ggaagcgttt caactgagga agaagttgaa ctcgtgaaaa aaattaggga 8220

gaatgcaaag atcgtcgttg cggttggagc ttgtgctgtt caaggaggag ttcagagctg 8280

gagtgaaaag ccattagaag agctctggaa gaaggtttat ggagacgcaa aagtcaagtt 8340

ccaaccgaag aaggctgaac cagtttcaaa atacataaaa gttgactaca acatctacgg 8400

ttgccccacca gagaagaagg acttcctcta cgccctggga aattcttga ttggttcatg 8460

gccagaggat atagattatc cagtttgtct agaatgtagg ctcaatggac atccatgtat 8520

ccttcttgag aaagggaac cctgtctagg tccagtaaca agggcaggat gtaacgcgag 8580

atgtccagga tttggagttg cgtgtatagg atgcagaggg gcaatagggt acgatgtagc 8640

ttggttcgac tctctagcta aggtgttcaa ggagaagggg atgacaaaag aggagataat 8700

tgagagaatg aaaatgttca atggacatga tgagagggtt gagaaaatgg ttgaaaaaat 8760

attctcaggt ggtgaacaat gaagaacctc tatcttccaa tcaccatga tcatatagca 8820

agagttgagg ggaagggtgg tgtggagata ataattgggg atgatggagt caaggaggtc 8880

aagctaaaca taattgaagg gcccagattc tttgaggcca taactattgg gaagaagctt 8940

gaggaagctc tggccatta cccgagaata tgctcattct gttcagccgc ccacaagtta 9000

accgcattag aggctgcaga aaaggccgtc ggttttgtcc caagggaaga gatacaggcc 9060

cttagagaag tactatacat cggagacatg atagagagtc atgcccttca cctatatctt 9120

ctagttcttc ccgactacag gggctactcg agccactta agatggtgaa tgaatacaag 9180

aggggagatag agatagccct taagctgaag aaccttggca cctggatgat ggacattcta 9240

gggtcaagag ccatacacca agaaaatgcg gttttgggcg gattcggaaa gctccctgag 9300

aagagtgtcc ttgagaaaat gaaagccgag cttagggaag ccctaccact tgccgagtat 9360

acttttgagt tatttgcaaa gcttgagcag tacagcgaag ttgaagggcc aataacacac 9420

ttggccgtga agccgagggg agatgcttat ggaatttatg gagattacat aaaggcaagt 9480

gatgggggagg agttcccaag tgaaaagtac agagattata taaaggagtt cgtcgttgaa 9540

cacagttttg caaagcacag tcactacaag ggcagaccct tcatggttgg ggctatatct 9600

agagttatta acaatgctga cctcctatac ggcaaggcca aggagctgta tgaggcaaac 9660

aaagacctat taaagggaac aaatccgttt gcaaataact tagcccaggc cctcgaaata 9720

gtttacttta tagagagggc aatagatctg ctcgacgagg ctctcgccaa gtggccaatt 9780

aagcccaggg atgaagttga gataaaggac ggctttggtg tctcaacgac tgaggctcca 9840

agggggaatct tagtctatgc cctcaaagtt gagaatggaa gggtttctta tgccgacata 9900

ataacaccta cagcattcaa cttggcaatg atggaagaac atgtaagaat gatggcagaa 9960

aagcactaca atgacgatcc agaaaggtta aagatactgg ctgagatggt tgttagggct 10020

tatgatccat gcatatcttg ctcagtccac gtggttagac tttaagtgag ggcgcggccg 10080

caaaaaagtc gactgccgca acgcgcattt tgctcacccg aaaattttta aatactaagg 10140

gttaatttaa tctcgagcgt ttgagtccctt ctgacggctc ttggagagggg ccgttaaaaa 10200

ggtgatgcat atgagctgga caaccccaaa gagagctttt ataggtgccg caaccgctga 10260

ggggagggact aagctgaacg cctttgacaa cgcactcctc aagctgggca taggaaacgt 10320

taacctggtc aagctaagca gcgttattcc cgcacatatc gagtggatgg agaaggtaca 10380

cgacgttccg ataggaatgc tcctgccgac agtttacgcc cacatcgaga gcgacgagcc 10440

ggggatgacg ataagcgccg cactgggcgt cgggataagc aagaacaacg aaggcggtct 10500

gatctacgag tattcgggct actgcaccaa ggaagaagcc gaggaaatgg tcaggaagat 10560

ggtcgaagaa ggcttcaggc agaggggctg ggagctcggt gagttcaagg ttgcaagcgc 10620

cgagataacc gtcaaggaca agccagccgc cgcaatagcg gtcgtcgtca tgttccccta 10680

ctgaactttt tcttttctca ccaaagtgta ttcgtctttt cccgttcttt cgaagctcag 10740

gtggtacttc actccac 10757

<210> 2

<211> 4058

<212> DNA

<213> Pyrococcus furiosus

<400> 2

gtgaggtatg ttaagttacc caaggaaaac acttacgagt ttttggaaag acttaaagac 60

tgggggaagc tttacgctcc agtaaaaatt tcggacaagt tctatgactt cagggagatt 120

gatgatgtta gaaagataga attccactac aacaggacaa taatgccacc taagaagttc 180

ttcttcaagc cgagggaaaa gctctttgag ttcgacattt caaaaccaga atacagggag 240

gtaatagagg aagttgaacc atttattata tttggagtcc acgcgtgtga catatatggc 300

ctaaagatcc tagacacggt ataccttgat gagttccccg acaagtacta caaggtgagg 360

agagagaagg ggataatcat tggaataagc tgtatgccag atgaatattg cttctgtaac 420

ttaagagaaa cagacttcgc tgatgatggt tttgacttgt tcttccatga actgcccgat 480

ggatggttgg taagggttgg cactccaact gggcacaggc ttgttgacaa gaacataaag 540

ctctttgaag aggtaacgga caaggatatc tgtgcattta gagattttga aaagaggaga 600

cagcaagcat tcaaatacca cgaagactgg ggcaacttga ggtatcttct cgagttggaa 660

atggaacatc caatgtggga tgaggaggca gataagtgct tggcttgtgg aatatgtaac 720

accacatgcc caacgtgtag atgctatgaa gttcaggata ttgtaaacct agatggagtt 780

actggataca gggaaagaag atgggattct tgtcagttca gaagtcatgg cttagttgct 840

gggggccaca acttcaggcc cacaaagaag gatcgcttta ggaacagata cctctgtaag 900

aacgcatata acgaaaagct tggattaagc tactgtgtcg gttgtggaag gtgtactgca 960

ttctgtccag ccaatataag ttttgtaggc aatcttagaa ggattttagg acttgaggag 1020

aacaaatgtc ccccaacggt tagtgaggag attccaaaga gaggatttgc atattcctct 1080

aacattagag gtgatggagt atgatgttgc caaaagagat tatgatgcca aatgataatc 1140

cgtatgccct tcatagagtc aaagttctaa aggtttactc cttgacggaa acggaaaagc 1200

ttttcctctt tagatttgag gatcccgagt tggcagagaa gtggacgttc aaacctggac 1260

agtttgtcca gctgacgata cctggagttg gagaggttcc cataagtata tgctcttctc 1320

caatgaggaa aggattcttt gagctctgta taagaaaggc aggaagggtc acaactgttg 1380

tccatagact aaagcctggc gatactgttc ttgtgagagg gccttacggt aatggattcc 1440

cagtggatga gtgggaagga atggatctac tattaatagc tgctggcctt ggaactgcac 1500

ctcttagag cgtctttctc tatgcaatgg acaacaggtg gaagtatgga aacattacct 1560

tcataaacac cgcacgttat gggaaggatc tcctcttcta caaggagctg gaggcaatga 1620

aagacctagc tgaggctgaa aacgtgaaaa tcatccagag cgtcactagg gatccaaact 1680

ggccggggcct aaagggtagg ccacagcagt tcatcgttga ggccaacaca aatccaaaga 1740

acactgcagt tgcaatctgt gggcctccta gaatgtataa gtcagtgttt gaggccctca 1800

tcaactacgg ttatcgccca gagaacatct tcgtgacatt ggagagaaga atgaaatgtg 1860

gaatcgggaa gtgcggccac tgcaacgtcg gaacgagcac gagctggaag tacatctgta 1920

aagatggacc agtcttcacg tacttcgaca tagtttcaac cccaggactg ctggactgag 1980

gtgaggaaaa tgggaaaagt taggatgga ttttacgcat taacctcgtg ctacggctgt 2040

caattgcagc tagctatgat ggacgagtta ttacaactta tcccaaatgc tgaaatagtt 2100

tgctggttca tgattgatag agatagcatt gaggatgaaa aggtcgacat agcttttata 2160

gaaggaagcg tttcaactga ggaagaagtt gaactcgtga aaaaaattag ggagaatgca 2220

aagatcgtcg ttgcggttgg agcttgtgct gttcaaggag gagttcagag ctggagtgaa 2280

aagccattag aagagctctg gaagaaggtt tatggagacg caaaagtcaa gttccaaccg 2340

aagaaggctg aaccagtttc aaaatacata aaagttgact acaacatcta cggttgccca 2400

ccagagaaga aggacttcct ctacgccctg ggaacattct tgattggttc atggccagag 2460

gatatagatt atccagtttg tctagaatgt aggctcaatg gacatccatg tatccttctt 2520

gagaaaggag aaccctgtct aggtccagta acaagggcag gatgtaacgc gagatgtcca 2580

ggatttggag ttgcgtgtat aggatgcaga ggggcaatag ggtacgatgt agcttggttc 2640

gactctctag ctaaggtgtt caaggagaag gggatgacaa aagaggagat aattgagaga 2700

atgaaaatgt tcaatggaca tgatgagagg gttgagaaaa tggttgaaaa aatattctca 2760

ggtggtgaac aatgaagaac ctctatcttc caatcaccat tgatcatata gcaagagttg 2820

agggggaaggg tggtgtggag ataataattg gggatgatgg agtcaaggag gtcaagctaa 2880

acataattga agggcccaga ttctttgagg ccataactat tgggaagaag cttgaggaag 2940

ctctggccat ttaacccgaga atatgctcat tctgttcagc cgcccacaag ttaaccgcat 3000

tagaggctgc agaaaaggcc gtcggttttg tcccaaggga agagatacag gcccttagag 3060

aagtactata catcggagac atgatagaga gtcatgccct tcacctatat cttctagttc 3120

ttcccgacta caggggctac tcgagcccac ttaagatggt gaatgaatac aagagggaga 3180

tagagatagc ccttaagctg aagaaccttg gcacctggat gatggacatt ctagggtcaa 3240

gagccataca ccaagaaaat gcggttttgg gcggattcgg aaagctccct gagaagagtg 3300

tccttgagaa aatgaaagcc gagcttaggg aagccctacc acttgccgag tatacttttg 3360

agttatttgc aaagcttgag cagtacagcg aagttgaagg gccaataaca cacttggccg 3420

tgaagccgag gggagatgct tatggaattt atggagatta cataaaggca agtgatgggg 3480

aggagttccc aagtgaaaag tacagagatt atataaagga gttcgtcgtt gaacacagtt 3540

ttgcaaagca cagtcactac aagggcagac ccttcatggt tggggctata tctagagtta 3600

ttaacaatgc tgacctccta tacggcaagg ccaaggagct gtatgaggca aacaaagacc 3660

tattaaaggg aacaaatccg tttgcaaata acttagccca ggccctcgaa atagtttact 3720

ttatagagag ggcaatagat ctgctcgacg aggctctcgc caagtggcca attaagccca 3780

gggatgaagt tgagataaag gacggctttg gtgtctcaac gactgaggct ccaaggggaa 3840

tcttagtcta tgccctcaaa gttgagaatg gaagggtttc ttatgccgac ataataacac 3900

ctacagcatt caacttggca atgatggaag aacatgtaag aatgatggca gaaaagcact 3960

acaatgacga tccagaaagg ttaaagatac tggctgagat ggttgttagg gcttatgatc 4020

catgcatatc ttgctcagtc cacgtggtta gactttaa 4058

<210> 3

<211> 367

<212> PRT

<213> Pyrococcus furiosus

<400> 3

Met Arg Tyr Val Lys Leu Pro Lys Glu Asn Thr Tyr Glu Phe Leu Glu

1 5 10 15

Arg Leu Lys Asp Trp Gly Lys Leu Tyr Ala Pro Val Lys Ile Ser Asp

20 25 30

Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val Arg Lys Ile Glu Phe

35 40 45

His Tyr Asn Arg Thr Ile Met Pro Pro Lys Lys Phe Phe Phe Lys Pro

50 55 60

Arg Glu Lys Leu Phe Glu Phe Asp Ile Ser Lys Pro Glu Tyr Arg Glu

65 70 75 80

Val Ile Glu Glu Val Glu Pro Phe Ile Ile Phe Gly Val His Ala Cys

85 90 95

Asp Ile Tyr Gly Leu Lys Ile Leu Asp Thr Val Tyr Leu Asp Glu Phe

100 105 110

Pro Asp Lys Tyr Tyr Lys Val Arg Arg Glu Lys Gly Ile Ile Ile Gly

115 120 125

Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys Asn Leu Arg Glu Thr

130 135 140

Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Phe His Glu Leu Pro Asp

145 150 155 160

Gly Trp Leu Val Arg Val Gly Thr Pro Thr Gly His Arg Leu Val Asp

165 170 175

Lys Asn Ile Lys Leu Phe Glu Glu Val Thr Asp Lys Asp Ile Cys Ala

180 185 190

Phe Arg Asp Phe Glu Lys Arg Arg Gln Gln Ala Phe Lys Tyr His Glu

195 200 205

Asp Trp Gly Asn Leu Arg Tyr Leu Leu Glu Leu Glu Met Glu His Pro

210 215 220

Met Trp Asp Glu Glu Ala Asp Lys Cys Leu Ala Cys Gly Ile Cys Asn

225 230 235 240

Thr Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val Gln Asp Ile Val Asn

245 250 255

Leu Asp Gly Val Thr Gly Tyr Arg Glu Arg Arg Trp Asp Ser Cys Gln

260 265 270

Phe Arg Ser His Gly Leu Val Ala Gly Gly His Asn Phe Arg Pro Thr

275 280 285

Lys Lys Asp Arg Phe Arg Asn Arg Tyr Leu Cys Lys Asn Ala Tyr Asn

290 295 300

Glu Lys Leu Gly Leu Ser Tyr Cys Val Gly Cys Gly Arg Cys Thr Ala

305 310 315 320

Phe Cys Pro Ala Asn Ile Ser Phe Val Gly Asn Leu Arg Arg Ile Leu

325 330 335

Gly Leu Glu Glu Asn Lys Cys Pro Pro Thr Val Ser Glu Glu Ile Pro

340 345 350

Lys Arg Gly Phe Ala Tyr Ser Ser Asn Ile Arg Gly Asp Gly Val

355 360 365

<210> 4

<211> 292

<212> PRT

<213> Pyrococcus furiosus

<400> 4

Met Met Leu Pro Lys Glu Ile Met Met Pro Asn Asp Asn Pro Tyr Ala

1 5 10 15

Leu His Arg Val Lys Val Leu Lys Val Tyr Ser Leu Thr Glu Thr Glu

20 25 30

Lys Leu Phe Leu Phe Arg Phe Glu Asp Pro Glu Leu Ala Glu Lys Trp

35 40 45

Thr Phe Lys Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly Val Gly

50 55 60

Glu Val Pro Ile Ser Ile Cys Ser Ser Pro Met Arg Lys Gly Phe Phe

65 70 75 80

Glu Leu Cys Ile Arg Lys Ala Gly Arg Val Thr Thr Val Val His Arg

85 90 95

Leu Lys Pro Gly Asp Thr Val Leu Val Arg Gly Pro Tyr Gly Asn Gly

100 105 110

Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile Ala Ala

115 120 125

Gly Leu Gly Thr Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala Met Asp

130 135 140

Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala Arg Tyr

145 150 155 160

Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Met Lys Asp Leu

165 170 175

Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg Asp Pro

180 185 190

Asn Trp Pro Gly Leu Lys Gly Arg Pro Gln Gln Phe Ile Val Glu Ala

195 200 205

Asn Thr Asn Pro Lys Asn Thr Ala Val Ala Ile Cys Gly Pro Pro Arg

210 215 220

Met Tyr Lys Ser Val Phe Glu Ala Leu Ile Asn Tyr Gly Tyr Arg Pro

225 230 235 240

Glu Asn Ile Phe Val Thr Leu Glu Arg Arg Met Lys Cys Gly Ile Gly

245 250 255

Lys Cys Gly His Cys Asn Val Gly Thr Ser Thr Ser Trp Lys Tyr Ile

260 265 270

Cys Lys Asp Gly Pro Val Phe Thr Tyr Phe Asp Ile Val Ser Thr Pro

275 280 285

Gly Leu Leu Asp

290

<210> 5

<211> 261

<212> PRT

<213> Pyrococcus furiosus

<400> 5

Met Gly Lys Val Arg Ile Gly Phe Tyr Ala Leu Thr Ser Cys Tyr Gly

1 5 10 15

Cys Gln Leu Gln Leu Ala Met Met Asp Glu Leu Leu Gln Leu Ile Pro

20 25 30

Asn Ala Glu Ile Val Cys Trp Phe Met Ile Asp Arg Asp Ser Ile Glu

35 40 45

Asp Glu Lys Val Asp Ile Ala Phe Ile Glu Gly Ser Val Ser Thr Glu

50 55 60

Glu Glu Val Glu Leu Val Lys Lys Ile Arg Glu Asn Ala Lys Ile Val

65 70 75 80

Val Ala Val Gly Ala Cys Ala Val Gln Gly Gly Val Gln Ser Trp Ser

85 90 95

Glu Lys Pro Leu Glu Glu Leu Trp Lys Lys Val Tyr Gly Asp Ala Lys

100 105 110

Val Lys Phe Gln Pro Lys Lys Ala Glu Pro Val Ser Lys Tyr Ile Lys

115 120 125

Val Asp Tyr Asn Ile Tyr Gly Cys Pro Pro Glu Lys Lys Asp Phe Leu

130 135 140

Tyr Ala Leu Gly Thr Phe Leu Ile Gly Ser Trp Pro Glu Asp Ile Asp

145 150 155 160

Tyr Pro Val Cys Leu Glu Cys Arg Leu Asn Gly His Pro Cys Ile Leu

165 170 175

Leu Glu Lys Gly Glu Pro Cys Leu Gly Pro Val Thr Arg Ala Gly Cys

180 185 190

Asn Ala Arg Cys Pro Gly Phe Gly Val Ala Cys Ile Gly Cys Arg Gly

195 200 205

Ala Ile Gly Tyr Asp Val Ala Trp Phe Asp Ser Leu Ala Lys Val Phe

210 215 220

Lys Glu Lys Gly Met Thr Lys Glu Glu Ile Ile Glu Arg Met Lys Met

225 230 235 240

Phe Asn Gly His Asp Glu Arg Val Glu Lys Met Val Glu Lys Ile Phe

245 250 255

Ser Gly Gly Glu Gln

260

<210> 6

<211> 428

<212> PRT

<213> Pyrococcus furiosus

<400> 6

Met Lys Asn Leu Tyr Leu Pro Ile Thr Ile Asp His Ile Ala Arg Val

1 5 10 15

Glu Gly Lys Gly Gly Val Glu Ile Ile Ile Gly Asp Asp Gly Val Lys

20 25 30

Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile

35 40 45

Thr Ile Gly Lys Lys Leu Glu Glu Ala Leu Ala Ile Tyr Pro Arg Ile

50 55 60

Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu Ala Ala

65 70 75 80

Glu Lys Ala Val Gly Phe Val Pro Arg Glu Glu Ile Gln Ala Leu Arg

85 90 95

Glu Val Leu Tyr Ile Gly Asp Met Ile Glu Ser His Ala Leu His Leu

100 105 110

Tyr Leu Leu Val Leu Pro Asp Tyr Arg Gly Tyr Ser Ser Pro Leu Lys

115 120 125

Met Val Asn Glu Tyr Lys Arg Glu Ile Glu Ile Ala Leu Lys Leu Lys

130 135 140

Asn Leu Gly Thr Trp Met Met Asp Ile Leu Gly Ser Arg Ala Ile His

145 150 155 160

Gln Glu Asn Ala Val Leu Gly Gly Phe Gly Lys Leu Pro Glu Lys Ser

165 170 175

Val Leu Glu Lys Met Lys Ala Glu Leu Arg Glu Ala Leu Pro Leu Ala

180 185 190

Glu Tyr Thr Phe Glu Leu Phe Ala Lys Leu Glu Gln Tyr Ser Glu Val

195 200 205

Glu Gly Pro Ile Thr His Leu Ala Val Lys Pro Arg Gly Asp Ala Tyr

210 215 220

Gly Ile Tyr Gly Asp Tyr Ile Lys Ala Ser Asp Gly Glu Glu Phe Pro

225 230 235 240

Ser Glu Lys Tyr Arg Asp Tyr Ile Lys Glu Phe Val Val Glu His Ser

245 250 255

Phe Ala Lys His Ser His Tyr Lys Gly Arg Pro Phe Met Val Gly Ala

260 265 270

Ile Ser Arg Val Ile Asn Asn Ala Asp Leu Leu Tyr Gly Lys Ala Lys

275 280 285

Glu Leu Tyr Glu Ala Asn Lys Asp Leu Leu Lys Gly Thr Asn Pro Phe

290 295 300

Ala Asn Asn Leu Ala Gln Ala Leu Glu Ile Val Tyr Phe Ile Glu Arg

305 310 315 320

Ala Ile Asp Leu Leu Asp Glu Ala Leu Ala Lys Trp Pro Ile Lys Pro

325 330 335

Arg Asp Glu Val Glu Ile Lys Asp Gly Phe Gly Val Ser Thr Thr Glu

340 345 350

Ala Pro Arg Gly Ile Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg

355 360 365

Val Ser Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met

370 375 380

Met Glu Glu His Val Arg Met Met Ala Glu Lys His Tyr Asn Asp Asp

385 390 395 400

Pro Glu Arg Leu Lys Ile Leu Ala Glu Met Val Val Arg Ala Tyr Asp

405 410 415

Pro Cys Ile Ser Cys Ser Val His Val Val Arg Leu

420 425

Claims (7)

1. A high-temperature ferronickel hydrogenase heterologous expression method comprises the following steps:

(1) Inserting a high-temperature ferronickel hydrogenase encoding gene derived from Pyrococcus furiosus into a shuttle expression vector;

(2) Transforming the shuttle expression vector obtained in the step (1) into Thermococcus kodakarensis and expressing;

the high-temperature nickel iron hydrogenase coding gene derived from Pyrococcus furiosus in the step (1) is (a) or (b) or (c) or (d): (a) SEQ ID NO:2; (b) a sequence similar to SEQ ID NO:2 has a sequence with homology of more than 98 percent, and the coded protein has high-temperature ferronickel hydrogenase activity; (c) Nucleotide sequences encoding the four subunit proteins, wherein the amino acid sequence of the first subunit is SEQ ID NO. 3, wherein the amino acid sequence of the second subunit is SEQ ID NO. 4, wherein the amino acid sequence of the third subunit is SEQ ID NO. 5, wherein the amino acid sequence of the fourth subunit is SEQ ID NO. 6; (d) The nucleotide sequence of the protein of the four subunits is coded, the coded protein has high-temperature ferronickel hydrogenase activity, wherein the amino acid sequence of the first subunit has more than 98 percent of homology with SEQ ID NO. 3, the amino acid sequence of the second subunit has more than 98 percent of homology with SEQ ID NO. 4, the amino acid sequence of the third subunit has more than 98 percent of homology with SEQ ID NO. 5, and the amino acid sequence of the fourth subunit has more than 98 percent of homology with SEQ ID NO. 6.

2. The high-temperature ferronickel hydrogenase heterologous expression method according to claim 1, wherein the shuttle expression vector obtained in step (1) in step (2) is pTE4 or pTE5, wherein the nucleotide sequence of pTE5 is shown in SEQ ID NO:1 is shown in the specification; compared with pTE5, the high-temperature ferronickel hydrogenase coding gene SEQ ID NO:2 front 3 less histidine encoding genes.

3. The high-temperature ferronickel hydrogenase heterologous expression method according to claim 1, wherein the shuttle expression vector of step (1) is pTE3, pTE2 or pTE1, wherein the sequence of pTE3 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO:3 histidine encoding genes before 2; the sequence of pTE2 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO: 12 histidine encoding genes before 2; the sequence of pTE1 is the vector sequence SEQ ID NO:1 lacks SEQ ID NO:2 and SEQ ID NO: the 12 histidine encoding genes before 2 and the promoter Pcsg gene.

4. The method for the heterologous expression of pyroferronickel hydrogenase according to claim 1, wherein the Thermococcus kodakarensis is TS559, the TS559 genotype is DeltapyrF, deltatrpE:pyrF, deltaTK 0149.

5. A recombinant Thermococcus kodakarensis characterized by being constructed by the heterologous expression method of the high-temperature ferronickel hydrogenase according to any one of claims 1 to 4.

6.A method for purifying high-temperature ferronickel hydrogenase is characterized by comprising the steps of freezing a bacterial liquid of the recombinant Thermococcus kodakarensis of claim 5 at a low temperature, melting the bacterial liquid, adding DnaseI and a proper amount of quartz sand, performing vortex oscillation, performing cell disruption, and purifying by nickel column affinity chromatography.

7. Use of the recombinant Thermococcus kodakarensis of claim 5 for the preparation of lactic acid.

Images