CN109652581B

CN109652581B - Application of pseudo-ginseng SSR marker in determination of saponin Rd content

Info

Publication number: CN109652581B
Application number: CN201811590515.6A
Authority: CN
Inventors: 杨生超; 张广辉; 卢迎春; 刘冠泽; 赵艳; 范伟; 掲应碧; 李莹
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2018-12-25
Filing date: 2018-12-25
Publication date: 2022-04-12
Anticipated expiration: 2038-12-25
Also published as: CN109652581A

Abstract

The invention relates to the technical field of molecules, in particular to application of a panax notoginseng SSR marker in determination of saponin Rd content, wherein the ginsenoside Rd is related to loci SSR35, SSR9, SSR42 and SSR 2-57. The invention researches the relevance of SSR marker and saponin Rd, and is beneficial to the development of pseudo-ginseng breeding with high content of saponin Rd.

Description

Application of pseudo-ginseng SSR marker in determination of saponin Rd content

Technical Field

The invention relates to the technical field of molecules, in particular to application of an SSR marker in determination of the content of saponin Rd.

Background

Notoginseng (Panax notoginseng (Burk.) f.h.chen) is a perennial herb of Panax ginseng (Panax) of Araliaceae, and is distributed in the southwest region of china. The Notoginseng radix contains Notoginseng radix total saponin (PNS), dencichine (dencichine), flavone, volatile oil, amino acids, and saccharides, and has hemostatic, myocardial cell protecting, brain tissue protecting, blood lipid reducing, antithrombotic, immunity enhancing, antiinflammatory, fibrosis resisting, antitumor, oxygen free radical scavenging, and antioxidant effects. The spindle root of pseudo-ginseng is a famous specific medicine for traumatic injury, has good effects of stopping bleeding, removing blood stasis, relieving pain and reducing swelling, and leaves, fruits and rhizomes can be used as medicines, and is one of effective components of Yunnan white medicine and anti-inflammatory and analgesic bolus.

The pseudo-ginseng is mainly distributed in high-altitude areas of Yunnan and Guangxi near the northern Return to the Retto the Return to the Retto the Return to the Retto the Return to the Retto the Return to the Retto the Return to the Retto the Return to the Retto the Return to the Retto the. The wenshan and its peripheral regions in the southeast of Yunnan are the main producing area and the region of the land where the pseudo-ginseng is produced, and the germplasm area and the yield account for 98 percent of the whole country. At present, the panax notoginseng has a cultivation history of more than 400 years, but the panax notoginseng germplasm mixing phenomenon still exists. In addition, the panax notoginseng has weak ecological adaptability, narrow geographical distribution area, long growth cycle, low propagation coefficient, short seed life and short seed life, and the frequent use of pesticides and chemical fertilizers in the planting process causes continuous cropping obstacles of the panax notoginseng, so that the land area for planting the panax notoginseng is gradually reduced, mainly because the current knowledge of the genetic diversity of the panax notoginseng is not enough, and the utilization of genetic resources is lack of theoretical guidance; the genetic background of the morphological type is not clear, and new variety breeding cannot be performed specifically. The development of molecular markers provides a basis for the utilization and genetic improvement of panax notoginseng germplasm resources.

Research on pseudo-ginseng molecular markers:

at present, the research on the panax notoginseng at home and abroad mainly focuses on the correlation among chemical components, saponin content, pharmacological efficacy, the heavy metal sensitivity of the panax notoginseng, soil bacteria and fungus community dynamics in a continuous cropping system and the death rate of the panax notoginseng. With the rapid development of DNA molecular marker technology, markers such as SNP, RAPD, AFLP, EST and the like are used in ginseng plants in succession.

Hongmei Luo et al obtain a large amount of EST data from the root of Panax notoginseng by using the second generation sequencing technology, and find the SSR marker of the coding sequence of the enzyme related to the biosynthesis of triterpenoid saponin. Detecting SNP sites of pseudo-ginseng disease-resistant groups by Dongling and the like, finding that the record _519688 sites are related to the pseudo-ginseng disease resistance, and performing systematic breeding on potential disease resistance of the pseudo-ginseng groups to breed a first new pseudo-ginseng disease-resistant variety 'Mianxiangkang seven No. 1'; the Prunus sibirica and the like find that a large number of SSR sites exist in the transcriptome of the Panax notoginseng by analyzing the transcriptome data of the Panax notoginseng, so that abundant candidate molecular markers are provided for genetic diversity analysis and genetic map construction of the Panax notoginseng; identifying and evaluating the consistency, stability and specificity of 3 improved groups and natural groups after four generations of group selection by using two molecular markers of ISSR and SRAP, wherein the results show that the consistency of 3 groups selected by the group is greater than that of the natural groups; liuli and the like utilize RAPD technology to evaluate the genetic relationship among ginseng, American ginseng and pseudo-ginseng, and the result shows that the genetic relationship between ginseng and American ginseng is relatively close and the genetic relationship between pseudo-ginseng is relatively far; zhang jin Yu et al utilizes EST-SSR marker, 17 breeding lines with basically consistent appearance and shape are selected from 4 different cultivation colonies through 3 generations of group breeding as materials, and the panax stipuleanatus is used as contrast to analyze the genetic diversity among the groups, and the result shows that the 17 breeding line materials and the panax stipuleanatus are divided into 4 large groups, wherein the 17 panax stipulatus breeding lines are divided into 3 groups, and the panax stipulatus is independently gathered into 1 group.

Analyzing the genetic diversity of the panax notoginseng:

genetic diversity refers to the sum of the genetic information carried by an organism. Broadly refers to intraspecific or interspecies genetic variations at the molecular, cellular, individual level; in a narrow sense, refers to the degree of genetic polymorphism within different populations of species and between different individuals of the same population.

Since the germplasm resource garden of panax plants such as panax stipuleanatus, panax notoginseng, panax japonicus, ginseng, American ginseng, panax quinquefolius and panax quinquefolius established by panax notoginseng research institute in wenshan state of Yunnan province in 1987, the panax notoginseng has been carefully studied in the aspects of cultivation and breeding, biology, chemical components, pest control, GAP planting and the like, but the study on the genetic structure and genetic diversity is insufficient, and the systematic and comprehensive analysis is not carried out.

The oldest and simplest methods of genetic variation detection utilize morphological or phenotypic traits, which mainly include monogenic traits that follow mendelian genetic rules and quantitative traits determined by multiple genes. The Xiaohui et al observes, counts and analyzes 33 phenotypic characters of 10 panax notoginseng cultivation groups in four regions of Wenshan, and the results show that the polymorphism of panax notoginseng among and in the groups is obvious, the phenotypic variation is rich, and the genetic diversity is rich; the Zhang Jing and the like carry out statistical analysis on the phenotypic characters of 10 different cultivation colonies in four regions of the Wen mountain, and the results show that the variation coefficient and the amplitude of the related quality characters (including the fresh weight and the dry weight of plants, the fresh weight and the dry weight of main roots and the fresh weight and the dry weight of pruning wounds) are larger in all the characters, and the quality variation of the pseudo-ginseng cultivation colonies is rich. The analysis according to the phenotypic diversity index shows that the genetic diversity of quantitative traits is rich.

The gene for controlling the phenotypic character and the position of the genome are found through the molecular marker in the genetic marker, so that marker-assisted selective breeding is realized. Dong Wang et al analyzed the genetic diversity of 92 plants from 4-county Panax notoginseng population in Wenshan by fluorescent AFLP, and found that not only the morphological feature variation among the samples was large, but also the molecular variation analysis showed that the genetic diversity in the population was as high as 93.5%; the Chinese zodiac hui and the like research the genetic diversity of the pseudo-ginseng and the related species of the root of membranous milk vetch through isozyme marking, and the result shows that the genetic variation mainly exists among the colonies and the genetic differentiation in the colonies is small; zhang jin Yu analyzes the genetic diversity of 6 Jiang groups of radix notoginseng, rhizoma panacis majoris and radix cynanchi glaucescentis through EST-SSR, and the result shows that the genetic diversity of radix notoginseng in the radix notoginseng group is rich, the radix notoginseng and the rhizoma panacis majoris have a closer genetic relationship and a longer genetic distance with the radix cynanchi glaucescentis.

The research shows that the panax notoginseng has abundant genetic variation both in the population and between the populations. The breeding success of the new panax notoginseng variety depends on the genetic diversity of the variety to a great extent. By researching the genetic diversity of the pseudo-ginseng, the method is not only beneficial to establishing a theoretical basis for collecting and storing pseudo-ginseng varieties, but also can lock and improve certain characters, and provides ideal germplasm resources for improving the pseudo-ginseng varieties.

Compared with EST-SSR, SSR can reveal higher polymorphism and genetic information than EST-SSR, and meanwhile, genome SSR is distributed throughout the biological genome, and EST-SSR is only one part of expressed genes. Cho Y G et al found that the polymorphism of genome SSR was 83.80% higher than that of EST-SSR in rice (54.00%), and EUjay I compared the genome SSR of durum wheat with EST-SSR found that EST-SSR produced high quality markers, but revealed that the polymorphism (25%) was lower than that of genome SSR (53.00%).

The previous researches on the genetic diversity of the panax notoginseng and the wild kindred species thereof comprise isozyme markers, ISSR, RAPD and EST-SSR. But the molecular markers for breeding and genetic improvement of new panax notoginseng varieties are few, and the SSR markers developed by ESTs only analyze a small part of genome sequences, so that the distribution characteristics of the SSR markers of the whole panax notoginseng genome are less researched.

Disclosure of Invention

Aiming at the technical problems, the invention provides the application of the notoginseng SSR marker in the determination of the content of the saponin Rd.

The technical scheme of the invention is as follows: application of Notoginseng radix SSR marker in determination of saponin Rd content is provided.

Further, ginsenoside Rd is related to site SSR 35.

Further, ginsenoside Rd is related to site SSR 42.

Further, ginsenoside Rd is related to site SSR 9.

Further, ginsenoside Rd is related to a locus SSR 2-57.

Compared with the prior art, the invention has the beneficial effects that:

1. the research on the relevance of the SSR marker and the saponin Rd is beneficial to the development of the pseudo-ginseng breeding with high-content saponin Rd.

Drawings

FIG. 1 is a capillary electrophoresis peak diagram of a partial amplification product of a primer PSQ63, wherein the abscissa is the size of the amplification product, the ordinate is the signal intensity, a double peak indicates a diploid heterozygote plant, and A, B, C represents control, purple stem and green stem panax notoginseng respectively;

FIG. 2 is a change rule of Ln P (D) value with K value in panax notoginseng population structure analysis;

FIG. 3 is the change rule of the delta K value along with the K value in the analysis of the panax notoginseng colony structure;

FIG. 4 is a genetic structure diagram of 248 different cultivation populations of Panax notoginseng based on SSR markers, wherein red represents population 1, green represents population 2, in the diagram, numbers 1-28 represent ZY population, 29-57 represent AG population, 58-80 represent U6 population, 81-92 represent LJ population, 93-121 represent DQHY population, 122-;

FIG. 5 is HPLC chromatogram of saponin content of Notoginseng radix, wherein a represents AG, b represents KQ, and c represents ZY.

Detailed Description

The technical solution of the present invention will be further described with reference to the accompanying drawings and examples.

Example (b): the invention is based on panax notoginseng genome sequencing information, excavates SSR locus information in panax notoginseng genome, develops polymorphic primers, and analyzes the genetic relationship between panax notoginseng (P.notoginseng) and its kindred wild species panax japonicus (P.japonica), panax stipuleanatus (P.stipuleanatus), panax gingeri (P.zingiberensis) and variant panax angustifolia (P.japonica var.angustifolia), panax notoginseng (P.vietnamensis var.fuscidiscusis), and panax japonicus (P.japonica var.major).

The invention adopts different panax notoginseng germplasm resources as materials for correlation analysis, and mainly comprises panax notoginseng varieties subjected to group breeding; miao Xiang pseudo-ginseng No. 1, anti-pseudo-ginseng No. 1 and Yunnan pseudo-ginseng No. 1; two breeding strains: excellent 6, short stalk; and 5 cultivation communities respectively from seven rivers and villages in the ancient city of Lijiang city, Jiu Jia village county of Pu' er city and Qishan village county of Wenshan city, and on the basis of analyzing genetic diversity, different software processing results are mutually verified to obtain a community structure. Meanwhile, observing phenotypic characters of the panax notoginseng, measuring saponin content, analyzing the correlation among the characters, and obtaining SSR markers associated with the characters by using TASSEL software. Finding out SSR markers associated with the phenotype of the panax notoginseng, and providing theoretical basis for the genetic improvement and new variety breeding of the panax notoginseng.

1 materials and methods

1.1 test materials:

the materials shown in the table 1 are pseudo-ginseng, including Miao Xiang pseudo-ginseng No. 1, anti-seven No. 1 and Dianqin No. 1 formed by group breeding; two breeding strains: you 6, dwarf and 5 different cultivated notoginseng florists respectively from Yuanbei county, Yuan county, Jiu Jia county, and seven river county. Taking fresh tender leaves for extracting panax notoginseng genome DNA; and the phenotypic characters of 10 pseudo-ginseng groups are measured and counted.

TABLE 1 Notoginseng radix different cultivation group material information

1.2 laboratory instruments and reagents

Main experimental apparatus equipment: the main instruments used in the experiment are a vernier caliper, a straight ruler, a measuring tape, a pencil, an electronic balance, a liquid-transfering gun with various measuring ranges, an H1650-W desk-type microcentrifuge (Hunan instruments laboratory development Co., Ltd.), an L550 desk-type low-speed large-capacity centrifuge, a Vortex QL-901 Vortex mixer and an ssw-420-2s type electric heating constant-temperature water bath, thermo Q constant temperature metal bath, 2720 thermal cycler PCR instrument, 3730 sequencer, JY300C power electrophoresis instrument, JY04S-3C gel imaging analysis system, Agilent 1260 Infinity liquid chromatograph (Agilent technologies Co., Ltd.), SB-5200D ultrasonic cleaner (Ningbo New Zhi Biotech Co., Ltd.), American Danver electronic analysis balance TP-214, Mettler-Toledo AE240 type electronic (Mettler-Toledo Co., Ltd., Switzerland), Orliban 1000A type pulverizer (Shanghai Saiki Kaishi mechanical Co., Ltd.).

The main reagents are as follows: the main reagents for the experiment are mix enzyme, 1 Xbromophenol blue, agarose, GS500LIZ, fluorescent dye Tamra, Hex, Fam, marker, EB, 0.5 XTBE, 100% methanol, absolute ethanol, sterile water, Trelife provided by Kunming Shuozhi Biotech limited^TMPlant Genomic DNA Kit (RNase A, Buffer BL, Buffer gP1, Buffer gP2, Buffer PW, Wash Buffer, TE Buffer, Spin pools, collection Tube)

1.3 Experimental methods

1.3.1 SSR locus information search in Notoginseng radix genome

SSR site detection was performed on the reassembled 2.39Gb Notoginseng radix genome using software MISA (Microcutellite identification tool, http:// pgrc. ipkgatersleen. de/MISA /). The search criteria selected motifs with repeat units of 1, 2, 3, 4, 5, 6 bases and minimum repeat numbers of 12, 6, 5, 4 respectively. The number of bases between two adjacent SSRs ≦ 100, which is defined as composite SSR.

1.3.2 design and Synthesis of SSR primers for Panax notoginseng

According to conserved sequences at two ends of an SSR locus, a primer3(http:// primer3. sourceform. net /) is used for designing a primer, the length of the primer is 20-23 bp, and the annealing temperature is about 60 ℃; the primer has a base number of less than or equal to 4, and two ends of the primer cannot have 2 continuous A/T bases; the PCR product size was between 150 and 300 bp. 200 pairs of primers were randomly selected, and M13F universal primer sequence 5'-TGTAAAACGACGGCCAGT-3' was added to the 5' end of the forward primer, and synthesized by Kunming Shuoyang technologies, Inc., to screen for polymorphic primers.

1.3.3 preparation and detection of genomic DNA of Panax notoginseng

Storing tender leaf tissue of Notoginseng radix material to be tested in liquid nitrogen, and using Trelife provided by NYunnan Kunming Shuichi Biotech Co., Ltd^TMThe Plant Genomic DNA Kit is used for extraction, and the extraction steps are as follows:

(1) spin column was placed in the collection tube, 250. mu.l of buffer BL was added, and the mixture was centrifuged at 12000rpm for 1min to activate the silica gel membrane.

(2) Adding liquid nitrogen into young leaves of Notoginseng radix, grinding, placing into 1.5mL centrifuge tube, adding 400 μ l Buffer gp1, vortex shaking for 1min, water bathing at 65 deg.C for 10-30min, taking out, reversing, and mixing to thoroughly crack.

(3) Add 150. mu.l Buffer gp2, vortex for 1min, ice-wash for 5 min.

(4) Centrifuge at 12000rp for 5min and transfer the supernatant to a new centrifuge tube.

(5) Adding anhydrous ethanol with the same volume as the supernatant, immediately and fully shaking and uniformly mixing, transferring all liquid into spin column, centrifuging at 12000rp for 30s, and discarding the waste liquid.

(6) Mu.l of Buffer PW (previously checked for absolute ethanol addition) was added to spin column, centrifuged at 12000rp for 30s, and the waste solution was discarded.

(7) Mu.l of Wash Buffer (previously checked for the addition of absolute ethanol) was added to spin column, centrifuged at 12000rp for 30s, and the waste solution discarded.

(8) Operation 7 is repeated.

(8) Spin column was returned to the collection tube, centrifuged at 12000rp for 2min, uncapped and air dried for 1 min.

(10) Taking out spin column, putting the spin column into a clean centrifugal tube, adding 50-100 μ l of TE Buffer (the TE Buffer is preheated at 65 ℃ and has better elution effect) in the center of the adsorption membrane, standing at 20-25 ℃ for 2min, and centrifuging at 12000rp for 2 min.

A DNA detection method. Mixing 2. mu.l DNA sample with 6. mu.l bromophenol blue, 0.8% agarose gel, voltage 300v, time 12min, and detecting DNA quality with JY04S-3C gel imaging analysis system.

1.3.4 SSR-PCR amplification system for Notoginseng radix

The primer sequence was designed with primer3 referring to flanking sequence of SSR site in genome sequence of Panax notoginseng, and synthesized by Kunming Shuozhi Biotech Co.

SSR-PCR Primary amplification reaction System (15. mu.l):

the amplification reaction procedure was: pre-denaturation at 94 ℃ for 5min → denaturation at 94 ℃ for 30s → optimal annealing temperature for each SSR primer for 30s → extension at 72 ℃ for 30s → 30 cycles, and after completion of the last cycle → extension at 72 ℃ for 10min → storage at 4 ℃.

Second amplification reaction (15. mu.l):

after the first amplification is finished, sucking 2 mu l of PCR product and 6 mu l of bromophenol blue, mixing, carrying out electrophoresis in 1 XTBE buffer solution and 0.8% agarose gel (containing EB) at the voltage of 300V for 12min, carrying out imaging analysis on the gel in a JY04S-3C gel imaging analysis system, and using the primer generating a clear band for secondary amplification. The secondary amplification procedure is the same as the reaction procedure of the primary amplification, and the product obtained after the secondary amplification is denatured at 94 ℃ for 5min, stored in a refrigerator at-20 ℃ and sequenced by a 3730 sequencer.

1.3.5 SSR polymorphic primer screening

Randomly selecting 200 pairs of SSR primers designed by primer3, collecting fresh leaves of 16 single plants for polymorphic primer screening, wherein the fresh leaves comprise 6 single plants in a natural population, 6 single plants in Miao Xiang pseudo-ginseng No. 1 and 4 single plants in Yunnan pseudo-ginseng No. 1. And (3) carrying out PCR amplification on the 200 pairs of primers by taking DNA of 16 materials as a template, analyzing PCR products by using a 3730 sequencer, and screening the polymorphic primers according to sequencing results.

1.3.6 data analysis

Performing site polymorphism analysis on the sequencing result by using software GeneMapper v4.1, determining the size of a core site fragment according to a generated peak diagram, selecting high specificity and polymorphismThe site peak map with good sex generates excel data, and POPGENE32 software is used for calculating observed number of alloels (A) and effective number of alloels (A) of species level and population level_e) The shannon's information index (i), observed heterozygosity (H)_o) Expected heterozygosity (H)_e) Nei's expected heterozygosity (H), genetic differentiation coefficient (F)_ST) Gene flow (N)_m) And Nei's unbiased Genetic Distance (GD) for evaluation of genetic diversity.

According to the unbiased inheritance-distance of Nei's calculated by POPGENE32, clustering analysis is carried out by using an unweighted pair arithmetic mean (UPGMA) with the software of NTSYSpc 2.1, and various clustering analysis graphs are drawn. The software PIC CALC calculates the polymorphism information content of each marker, and the SSR is regarded as a co-dominant marker in statistical analysis.

1.3.7 Observation of major phenotypic traits

And (3) phenotypic character survey:

the invention observes 17 personality of root, stem, leaf and the like of 10 colonies and 300 single plants of panax notoginseng, and comprises the following steps: stem color, stem number, stem thickness, plant height, compound leaf number, lobular number, compound leaf stem length, leaf type, leaf margin serration, medium leaf length, medium leaf width, medium leaf length-width ratio, main root shape, main root length, main root thickness, main root fresh weight, and main root dry weight.

And (3) determining the content of notoginsenoside:

drying Notoginseng radix main root at 60 deg.C to constant weight, pulverizing with pulverizer, weighing 0.6g sample with analytical balance, placing in 50mL conical flask, adding 50mL 100% methanol solution, sealing the flask with sealing film, soaking for 30min, ultrasonically extracting for 30min, taking out, standing for 30min, filtering with 0.45 μm microporous membrane, collecting filtrate, and treating Notoginseng radix saponin R1 and ginsenoside Rg₁Ginsenoside Re and ginsenoside Rb₁And ginsenoside Rd five saponins were measured.

Table 2 mobile phase gradient elution procedure

Chromatographic conditions are as follows: detecting the content of 10 Panax notoginseng taproot saponins by Agilent Zorbax SB-C18(250mm × 4.6mm,5 μm) with mobile phase of 0.2% phosphoric acid water (A) -acetonitrile (B) and flow rate of 1.5ml min^-1The detection wavelength is 203nm, the column temperature is 30 ℃, and the injection volume is 10 mu l.

1.3.8 phenotypic trait and saponin content data analysis

Carrying out statistical description and variance analysis on the phenotypic data of the characters of the material to be tested by using SPASS 20.0 software, and calculating pearson correlation coefficients among the characters; the coefficient of variation CV% was analyzed by (CV% ═ standard deviation/average) × 100.

1.3.9 Association analysis of quality and phenotypic Properties of Panax notoginseng

And (3) analyzing a population structure: estimating the group Structure by using a software Structure 2.2, wherein the Structure parameter settings are respectively as follows: k value is 1-10, and the repetition frequency is set as 10; the length of each iteration is 10000 times (length of burn in period) at the beginning of MCMC (Markov Chain Monte Carlo), then the MCMC after the iteration is 100000 times, and the default settings of software are adopted for the other parameters. Calculating the delta K according to LnP (D), selecting a proper K value according to the delta K, and obtaining a Q matrix corresponding to the K value (the probability that the genomic genetic variation of the ith material is derived from the Kth population).

Linkage disequilibrium analysis: using the software TASSEL 2.2: (http://www.maizegenetics.net/Bioinformatics/TASSEL /) analysis was performed by first converting the original 0, 1 DATA into allelic form imported DATA according to the DATA entry format of TASSEL2.2, filtering the genotypic DATA using the DATA module, and then analyzing the LD value matrix plot between sites using link²And a P value.

Phenotype and saponin content correlation analysis: firstly, generating a genetic relationship matrix (K matrix) for genotype data by using software TASSEL2.2, performing association analysis by using a Mixed Linear Model (MLM) by combining the genotype data, a property value and a Q matrix obtained by structure software, and calculating the contribution rate of a marker locus to the phenotypic variation, wherein the group Q value is used as the covariance of the analysis process.

2 results and analysis

2.1 screening and verification of Notoginseng radix genome SSR polymorphic primers

Carrying out polymorphism detection on sample sites by using 200 pairs of randomly screened and synthesized pseudo-ginseng SSR primers, carrying out capillary electrophoresis on all PCR amplification products, and detecting sample site information by using a peak image generated by Genemapper v 4.1. The SSR polymorphism is formed by the repeat number difference of the SSR repeated motif and the short insertion deletion event, and the information shown by a peak diagram is the product fragment information fed back by a PCR product with a fluorescent primer after capillary electrophoresis. After analyzing the size information of the respective specific site fragments shown by the peak graphs generated by each pair of primers in each sample, wherein the peak graphs of 27 pairs of primers are the same in size and have no difference, and 132 pairs of primers do not amplify fragments, the final products of 41 pairs of primers conform to the expected size, and the 41 pairs of primer peak graphs are used for calculating the polymorphism information content of the primers, as shown in figure 1.

The allele observed value of 41 pairs of primers, expected allele factors, shannon indexes and polymorphism information content are calculated through software POPGENE32, the number of alleles at each locus ranges from 2-10, and the average number is 3.9. PIC values of 41 primers were calculated and found to be highly polymorphic (PIC >0.50) for 16 primers, moderately polymorphic (0.30< PIC <0.50) for 23 primers, and less polymorphic (PIC <0.30) for 2 pairs with an average PIC value of 0.46, as shown in table 3.

TABLE 3 41 SSR site sequences and related information for this experiment

2.2 analysis of genetic diversity of Panax notoginseng culture population

2.2.1 frequency analysis of major phenotypic traits of Panax notoginseng

TABLE 4 frequency analysis of 7 different cultivation groups of notoginseng (n ═ 30) for binary and polymorphic character

TABLE 5 mean of 11 quantitative traits for different cultivation groups of Notoginseng (mean + -SD, n ═ 30)

Through analyzing the average value of the main phenotypic characters among 10 cultivated panax notoginseng colonies, the variation range of the plant height among the colonies is 28.8-45.3, and the KQ group plant height is the highest (45.3); the variation range of the stem thickness among the groups is 0.3-0.7, and the stem thickness is the largest (0.7cm) in the LJ group; the variation range of the middle leaf length among the groups is 9.7-15.4, wherein the middle leaf length difference of ZY, AG, KQ and MXYH groups is not significant, the middle leaf length of LJ group is the largest (15.4), and the middle leaf length difference among DQYH, U6, QB1, QB2 and ZHY is not significant; the distribution of the difference between the population of the mesoleaf width, the mesoleaf aspect ratio and the population of the mesoleaf length is the same; the variation range of the multiple leaf stalk length among the groups is 7.0-11.4, the multiple leaf stalk length of the LJ group is the longest (11.4), and the multiple leaf stalk length of the AG group is the shortest (7.0); the variation range of the main root length is 3.7-7.6, wherein the main root length of an AG population is the longest (7.6), and the main root length of a QB1 population is the shortest (3.7); the major roots were largest and the differences were not significant in the LJ (2.7) and ZY (2.6) populations; the same fresh and dry primary root weights were also greatest in the LJ and ZY populations (table 5).

It can be seen from table 6 that the inter-individual differences were present in almost every trait of every population. In contrast, the aspect ratio of the middle leaves (9.6%), the main root thickness (11.0%) and the stem thickness (11.6%) are more stable than other traits, wherein the leaf length and the leaf width reflect the leaf type to a certain extent, and the aspect ratio of the middle leaves, which is not greatly varied among the groups, also reflects the leaf type variation among the groups is smaller; the root characteristics are large and unstable in main root length, fresh weight and dry weight variation. From the perspective of a single trait at the population level, the variation varies from population to population for the same trait. Taking plant height as an example, the variation range of the plant height in ten colonies is 9.0% -20.5%, wherein the variation coefficient of QB colonies is the minimum (cv is 9.0%), and the variation coefficient of KQ is the maximum (cv is 20.5%). The coefficient of variation of different characters of the same population is different, taking KQ of inkstone county as an example, CV values of 10 characters are different, wherein the coefficient of variation of stem thickness is 0, the coefficient of variation of fresh weight and dry weight of the main root is the largest, and CV values are respectively 50.4% and 51.1%.

The average coefficient of variation for 10 traits in each population ranged from 14.33% to 24.71%. Wherein the coefficient of variation of MXYH was the largest (24.71%), the coefficient of variation of AG population was the smallest (14.33%); the average coefficient of variation of the two KQ and DQYH varieties is 22.82 percent and 18.80 percent respectively; the average coefficient of variation of the two breeding lines AG and U6 is 14.33 percent and 16.55 percent respectively.

TABLE 6 coefficient of variation CV (%) for 11 different cultivars of notoginseng (n ═ 30)

Note: stem number SN: stem number; number of lobules NL: number of leaves; number of double leaves NCL: number of compound leaves; stem diameter SD is Stem diameter; plant height PH: plant height; middle leaf length MLL: middlel leaf length; middle leaf width MLW: middlel leaf width; middle leaf aspect ratio LWR: a Length width ratio of middel lobe; length of cotyledon stalk PLCL: a period length of a compound leaf; major root length MRL: main root length; primary root crude MRD: a Main root diameter; fresh weight of main root MRFW: main root fresh weight; major root dry weight MRDW: main root dry weight.

2.2.2 genetic diversity of different populations of Panax Notoginseng

On the species level, the 26 pairs of primers detect 218 alleles in 248 individuals of 10 panax notoginseng culture groups, the number of the alleles is from 2 to 23, and the average is 8.4; effective allelic factor (A)_e) Ranging from 1.2227 to 11.5357 with an average value of 3.13; the shannon informative index (I) ranged from 0.4214 to 2.6436 with an average value of 1.21; observation of heterozygosity (H)_o) Ranging from 0.0936 to 0.8024 with an average value of 0.51; desired degree of heterozygosity (H)_e) Ranging from 0.1825 to 0.9152 with an average value of 0.6; nei's expected heterozygosity (H) ranges from 0.1821 to 0.9133, with an average of 0.6; the data indicate that the panax notoginseng species has abundant genetic diversity at the level, which is shown in table 7.

The information about each marker can be evaluated based on its PIC value, which reflects the diversity of the gene according to Nei's (1973), with high polymorphisms at PIC 0.5 or more, low polymorphisms at PIC 0.3 or less, and medium polymorphisms at 0.3 or less and 0.5 or less. As can be seen from Table 7, the mean PIC at all sites was 0.54 (C:)>0.5) is highly polymorphic and has large genetic variation, and the highest PIC value is loci SSR2-46(0.91) and SSR2-41(0.85), which indicates that the genetic diversity among the markers is rich and can be used as molecular markers for association analysis (Table 7). The genetic differentiation value was between 0.0064 and 0.2674, with an average value of 0.0446; this indicates that 4.46% of the genetic variations of notoginseng were present between the populations and 95.54% were present within the population. Gene flow between sites (N)_m) Values between 0.6849 and 38.93 averaged 10.3, which indicates greater gene communication among panax notoginseng populations (table 7).

At the population level, the selected material observed allele factors (a) ranged from 3.88 to 5.23, with an average of 4.7; effective allelic factor (A)_e) Ranging from 2.52 to 2.979 with an average value of 2.74; the shannon information index (I) ranges from 0.9982 to 1.119, with an average value of 1.07; observation of heterozygosity (H)_o) Ranging from 0.4899 to 0.5507 with an average value of 0.5129; desired degree of heterozygosity (H)_e) Ranging from 0.5688 to 0.6 with an average value of 0.5806; nei's expected heterozygosity (H) ranges from 0.5456 to 0.5816 with an average of 0.5675. From the perspective of each genetic parameter, there are large genetic variations among the notoginseng populations, see table 8.

TABLE 726 SSR locus genetic diversity coefficients

TABLE 8 genetic diversity of different cultivated populations of Panax notoginseng

The main effective component of Notoginseng radix comprises notoginsenoside R₁Ginsenoside Rg₁Ginsenoside Re and ginsenoside Rb₁And ginsenoside Rd. Five saponin contents were determined by testing ten notoginseng populations. From result analysis, the content of 5 monomeric saponins, the content of R1+ Rg1+ Rb1 and the content of total saponins in different culture populations of panax notoginseng have significant differences. Notoginseng radix saponin R₁The content was highest in the ZY (2.6%) population, lowest in the ZHY (1.2%), LJ (1.4%) population; ginsenoside Rg₁The content was relatively high in ZY (7.8%), QB (7.6%), DQYH (7.5%) populations, and the difference was not significant; the content of ginsenoside Re is the highest in ZY (1.4%) population, the content of ginsenoside Re is the lowest in LJ (0.4%) population, and the difference between other populations is not significant; ginsenoside Rb1 (8.5%) was highest in ZY population and lowest in LJ (2.3%) population; ginsenoside Rd content was highest in ZY (1.8%) and QB1 (1.6%) and lowest in LJ (0.6%). The sum of the three saponins R1+ Rg1+ Rb1 was highest in both the ZY (18.8%) and QB1 (16.9%) populations, and lowest in the LJ (7.3%) population. The total saponin content is highest in ZY (22.0%) and QB1 (19.6%),the lowest of the LJ (8.3%) populations. Comparing the content of 5 monomeric saponins with the content of total saponins, the difference between the DQYH and MXYH populations and between the QB1 and QB2 populations was not obvious.

TABLE 9 Total arasaponin content of ten populations

Note: distinct differences in different lower case letters after the same column of values (P < 0.05)

2.2.3 population Structure analysis

Group structure analysis was performed on 10 panax notoginseng materials by structure 2.2 software to eliminate false positives of group structure in association analysis. As can be seen from fig. 2, as the K value increases, the posterior logarithm probability (lnp (d)) also increases gradually, if the proper K value cannot be determined according to the lnp (d) value. According to the method for calculating the delta, namely the Evanno G2005, the delta values in different K value ranges can be conveniently calculated, so that 10 materials are divided into 2 subgroups. FIG. 3 shows the change of LnP (D) and Δ n for different values of K. Fig. 4 is a group structure diagram when K is 2, and fig. 5 is a notoginseng group HPLC chromatogram.

Fig. 4 is a group structure analysis of 248 test materials using structure software, and it can be seen from the figure that 248 test materials are divided into 2 subgroups according to the optimal K value (K ═ 2), and the abscissa represents the number of individuals and the ordinate represents the probability that the individuals are divided into different subgroups. Subgroup 1 mainly comprises 152 parts of materials, namely 28 parts of Zhenyan, 28 parts of dwarf straw, 23 parts of U6, 29 parts of Dianqin No. 1, 12 parts of Lijiang and 26 parts of KANGQI No. 1; subgroup 2 mainly comprises 95 parts of materials, 55 parts of QB population, 28 parts of neutralization population and 12 parts of Miao Xiang No. 1.

2.2.4 Panax notoginsenosides content and phenotypic trait correlation analysis

Using pearson correlation analysis of SPASS 20.0, we obtained a correlation coefficient table 10 of saponin content and phenotypic traits for seven different cultivar populations over three years. And (3) combining the relevant results of the indexes to obtain a relevant conclusion: indices of significant positive correlation at the 0.01 level: r1 and Rg1, Rd, total saponin content; rg1, Re, Rb1, Rd, total saponin content, and stem number; re and Rb1, Rd, total saponin content; rb1 and Rd, total saponin content, stem number, and leaf number; rd and total saponin content, stem number; total saponin content-stem number; the total saponin content, the number of compound leaves and the dry weight of main roots; small leaf number and multiple leaf number, stem thickness, plant height, multiple leaf stalk length, main root thickness, main root dry weight; the number and stem of multiple leaves, plant height, the length of multiple leaf stalks, the thickness of main roots, the fresh weight of the main roots and the dry weight of the main roots; stem thickness and plant height, middle leaf length, middle leaf width, middle leaf length-width ratio, compound leaf stalk length, main root thickness, main root fresh weight and main root dry weight; plant height, compound leaf stalk length, thick main root and dry main root weight; the length and width of the middle leaf, the length-width ratio of the middle leaf, the thickness of the main root and the dry weight of the main root; the width of the middle leaf, the length of the compound leaf stalk, the thickness of the main root and the dry weight of the main root; the length of the compound leaf stalk, the thickness of the main root and the dry weight of the main root; the thickness of the main root, the fresh weight of the main root and the dry weight of the main root; fresh weight of primary root-dry weight of primary root.

Indices that are significantly negatively correlated at the 0.01 level: rg 1-major root length; re-medium leaf length; rb1, median leaf length to width ratio, main root length; rd-major root length; the total saponin content, the length-width ratio of the middle leaves and the main root length; lobular number-major root length; number of leaves-major root length; stem thickness-major root length; medium leaf width-main root length; double leaf stalk length-main root length; major root length-major root thickness.

2.2.5 Association analysis of notoginsenoside content and SSR marker

The Mixed Linear Model (MLM) method of the TASSEL software is adopted to perform correlation analysis on the content of notoginsenoside and 13 phenotypic characters. Table 11 reflects markers with significant associations between panax notoginseng saponin content and phenotypic traits under the conditions of P <0.05 and P <0.01, and 8 markers among 26 markers were found to be associated with panax notoginseng phenotype and saponin content, with an interpretation rate of phenotypic variation ranging from 0.3% to 9.6%, and an average interpretation rate of 1.7%, wherein some SSR markers are associated with 2 or more phenotypic traits.

As can be seen from table 11, under the significant condition that P is less than 0.05, there are 7 markers associated with phenotypic traits, and 1 marker is associated with stem number, and the interpretation rate of phenotypic variation is 0.5%; 1 is related to the number of compound leaves, and the phenotypic variation interpretation rate is 0.8%; 3 related to the main root length, and the mean value of the phenotypic variation interpretation rate is 0.5%; 3 related to the fresh weight of the main root, and the mean value of the phenotypic variation interpretation rate is 0.67%; 2 were associated with the main root dry weight with an interpretation rate of phenotypic variation of 0.6; and the 7 markers are associated with at least more than two traits.

Under the significant condition that P is less than 0.01, 7 markers are related to phenotype and saponin content, 1 marker is related to the number of small leaves, and the phenotypic variation interpretation rate is 0.8%; 2 are related to the number of compound leaves, and the phenotypic variation interpretation rate is 0.9%; 2 are related to stem thickness, and the interpretation rate of phenotypic variation is 1, 4%; 1 is related to Rd content, and the interpretation rate of phenotypic variation is 5.0%; 1 correlated with Rg1 content, and the interpretation rate of phenotypic variation was 0.4%.

TABLE 10 analysis of saponin content and phenotypic traits of different cultivated populations of Panax notoginseng

Note: and indicate significant correlation at 0.05 and 0.01 levels, respectively. And (d) express identity at 0.05 and 0.01 level, and Total saponin content TS of the representational Total saponin.

TABLE 11 correlation analysis results of saponins, phenotypic traits and SSR loci of different culture populations of Panax notoginseng

P-marker: significance of markers and phenotypic traits; r²: marking the interpretation rate of phenotypic variation; and; significant correlation at a 0.05 good 0.01 level.

To further investigate the reliability of SSR markers associated with phenotype, a whole genome scan was performed on 208 materials of 8 different notoginseng populations in the wenshan area using 26 SSR markers, and 8 SSR markers associated with phenotype and saponin content were detected at 0.05 and 0.01 levels, with an interpretation rate of phenotypic variation of 0.1% to 17.06%, with an average of 2.3%, as shown in table 12.

Under significant conditions of P <0.05, 8 markers were all associated with phenotype and saponin content, with SSR35 associated with stem number, leaflet number, Re, Rb 1; SSR2-6 is associated with the number of compound leaves, the dry weight of main roots, the fresh weight of main roots and Re; SSR2-57 is associated with a compound leaf stalk length and a medium leaf length-to-width ratio; SSR43 is related to the dry weight of main roots, the content of R1, the plant height, the length of middle leaves and the fresh weight of the main roots; SSR89 correlated with major root dry weight, with an interpretation rate of phenotypic variation of 2.2%; SSR42 was associated with Rd with an interpretation rate of phenotypic variation of 2.2%; SSR9 is roughly associated with the main root, and the interpretation rate of phenotypic variation is 1.0%; SSR92 correlates with the fresh weight of the main root, the aspect ratio of the midleaves, see Table 12.

Under the significant condition that P is less than 0.01, 7 markers are associated with phenotypic traits and saponin content, wherein SSR89 is associated with stem number, compound leaf stalk length, middle leaf width, middle leaf length-width ratio, main root length and main root thickness; SSR2-6 is associated with stem number and main root thickness; SSR43 is related to the number of lobules, petiole length and width of medium leaves; SSR92 correlates with leaflet number, compound petiole length, and main root dry weight; SSR35 is related to the number of compound leaves, total saponin, R1, Rd, the length-width ratio of the middle leaves and the main root length; SSR2-57 is associated with the number of compound leaves, the length of the middle leaf and the width of the middle leaf; SSR9 and Rd were correlated with an interpretation of phenotypic variation of 3.8%, see table 12.

TABLE 12 correlation analysis results of saponin, phenotypic character and SSR locus of different panax notoginseng cultivation groups in Wenshan region

8 loci are detected in two different regions, the same character is associated with a plurality of loci, 3 loci are associated with the number of lobules, 5 loci are associated with the number of compound leaves, 4 loci are associated with the stem thickness, 4 loci are associated with the plant height, 4 loci are associated with the middle leaf length, 4 loci are associated with the middle leaf width, 4 loci are associated with the stalk length of the compound leaves, 4 loci are associated with the main root length, 7 loci are associated with the main root thickness, 2 loci are associated with total saponins, 3 loci are associated with Re, 4 loci are associated with Rd, 1 loci are associated with Rg1, 4 loci are associated with R1, and 2 loci are associated with Rb 1; where the 7 loci associated with the fresh and dry primary root weights are the same, see table 13.

TABLE 13 sites detected in different regions

The foregoing is a more detailed description of the invention in connection with specific preferred embodiments and it is not intended that the invention be limited to these specific details. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.

Claims

1. The application of the pseudo-ginseng SSR35 marker in the content prediction of saponin Rd;

wherein: the primers for amplifying the pseudo-ginseng SSR35 marker are as follows:

SSR35 forward primer: GATCGCCGGTTATGTATTTGTAT

Reverse primer: TCCTAGTAGTCGTTGCACGTAGA are provided.